Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 180
Filter
1.
Chinese Journal of Laboratory Medicine ; (12): 375-384, 2023.
Article in Chinese | WPRIM | ID: wpr-995740

ABSTRACT

Objective:We aimed to explore the prognostic value of serum cystatin C (CysC) levels on kidney disease outcome in type 2 diabetes mellitus (T2DM) patients with chronic kidney disease (CKD).Methods:The clinical data and pathological examination results of 113 T2DM patients with CKD, who were hospitalized in the First Affiliated Hospital of Nanjing Medical University from January 2011 to July 2020, were retrospectively analyzed in this study. Clinicopathological features and renal outcomes were compared between patients with CysC>1.54 mg/L ( n=57) and CysC≤1.54 mg/L ( n=56) at the time of renal biopsy. Cox regression analysis was used to analyze the risk factors of poor renal prognosis. The relationship between serum CysC level and renal prognosis was analyzed by smoothing curve fitting and threshold effect. Kaplan-Meier survival curve was used to compare and analyze the difference of renal survival rate. Further, the receiver operator characteristic curve was used to evaluate the predictive value of serum CysC combined with renal tubular marker blood and urinary neutrophil gelatinase-associated lipocalin (NGAL) on renal prognosis in all enrolled patients and those with different kidney disease stages. Besides, the ability of serum CysC level to predict renal prognosis within 3 years was evaluated by time-dependent area under the curve (AUC). Results:Compared with patients with serum CysC levels≤1.54 mg/L, patients with CysC>1.54 mg/L had more deteriorated renal function, decreased levels of hemoglobin and serum 25(OH) vitamin D, but more severe interstitial inflammation, higher glomerular sclerosis ratio and severe vascular lesion (all P<0.05). During 36.77 (29.34, 44.20) months follow-up, the composite renal outcomes were noted in 37.2% patients. Kaplan-Meier survival curve showed that the cumulative survival rates of patients without renal end points was significantly lower in CysC level>1.54 mg/L group than in CysC≤1.54 mg/L group (χ 2=5.752, P=0.016). Adjusted multivariate Cox analysis showed that serum CysC level ( HR=7.850, 95% CI 1.248-49.382, P<0.05) was an independent risk factor for renal prognosis. Smoothing curve fitting analysis showed that there was a linear relationship between serum CysC level and relative risk of renal endpoint event (β=2.25, 95% CI 1.06-4.81, P=0.036). The time-dependent receiver operator characteristic curve showed that the AUC of serum CysC in predicting the poor renal prognosis of T2DM patients within 3 years after renal biopsy were 0.714, 0.625 and 0.631, respectively. The AUC of serum CysC combined with blood and urinary NGAL was 0.694 (sensitivity 55.56%, specificity 77.78%). In the population with eGFR less than 60 ml·min -1·1.73m -2 ( n=51), the AUC was 0.817 (sensitivity 66.67%, specificity 85.00%). Conclusions:Higher serum CysC level is associated with deteriorated renal function, more severe renal pathological lesions and increased risk of worse renal prognosis in T2DM patients. Serum CysC level presents better predictive value for the renal prognosis of T2DM patients within 1 year after renal biopsy. Combined with renal tubular marker blood and urinary NGAL, serum CysC level might serve as a potential tool for identifying cases with high-risk of unsatisfactory renal prognosis, especially in those with eGFR less than 60 ml·min -1·1.73m -2.

2.
Chinese Journal of Ocular Fundus Diseases ; (6): 605-610, 2023.
Article in Chinese | WPRIM | ID: wpr-995673

ABSTRACT

Inherited retinal diseases (IRDs) are the major cause of refractory blinding eye diseases, and gene replacement therapy has already made preliminary progress in the treatment of IRDs. For IRDs that cannot be treated by gene replacement therapy, gene editing provides an alternative therapeutic method. Strategies like disruption of pathogenic variants with or without gene augmentation therapy and precise repair of pathogenic variants can be applied for IRDs with various inheritance patterns and pathogenic variants. In animal models of retinitis pigmentosa, Usher syndrome, Leber congenital amaurosis, cone rod cell dystrophy, and other disorders, CRISPR/Cas9, base editing, and prime editing showed the potential to edit pathogenic variations in vivo, indicating a promising future for gene editing therapy of IRDs.

3.
Chinese Journal of Ocular Fundus Diseases ; (6): 594-599, 2023.
Article in Chinese | WPRIM | ID: wpr-995671

ABSTRACT

Familial exudative vitreoretinopathy (FEVR) is a serious hereditary retinal vascular disease. The clinical manifestations vary, and the severity of the patients' condition is different. In severe cases, it may lead to bilateral blindness. The pathogenic mechanism of FEVR is also complex. At present, more than ten classical and candidate pathogenic genes have been found: NDP, FZD4, LRP5, TSPAN12, CTNNB1, KIF11, ZNF408, RCBTB1, LRP6, CTNNA1, CTNND1, JAG1, ATOH7, DLG1, DOCK6, ARHGP31 and EVR3 region. These pathogenic genes are involved in Wnt/β-catenin signaling pathway, norrin/β-catenin pathway and Notch pathway. They regulate and affect the development of retinal blood vessels, hyaloid vascular system regression, endothelial cell connections, and blood retinal barrier homeostasis, ultimately leading to the occurrence and development of FEVR disease.

4.
Chinese Journal of Ocular Fundus Diseases ; (6): 170-178, 2023.
Article in Chinese | WPRIM | ID: wpr-995607

ABSTRACT

Objective:To analyze the clinical characteristics and evaluate the effect and safety of anti-vascular endothelial growth factor (VEGF) therapy in retinopathy of prematurity (ROP) in Sichuan province.Methods:A retrospective study. From January 2013 to January 2022, 156 patients (306 eyes) with ROP who received intravitreal anti-VEGF therapy for the first time in the Department of Ophthalmology, West China Hospital of Sichuan University were selected. According to the type of anti-VEGF drugs, the children were divided into intravitreal injection of ranibizumab (IVR) group and intravitreal injection of conbercept (IVC) group; IVC group was divided into hospital group and referral group according to the different paths of patients. After treatment, the patients were followed up until the disease degenerated (vascular degeneration or complete retinal vascularization) or were hospitalized again for at least 6 months. If the disease recurred or progressed, the patients were re-admitted to the hospital and received anti-VEGF drug treatment, laser treatment or surgical treatment according to the severity of the disease. Clinical data of these children was collected, including general clinical characteristics: gender, gestational age at birth (GA), birth weight (BW), history of oxygen inhalation; pathological condition: ROP stage, zone, whether there were plus lesions; treatment: treatment time, postmenstrual gestational age at the time of the first anti-VEGF drug treatment; prognosis: re-treat or not, time of re-treatment, mode of re-treatment; adverse events: corneal edema, lens opacity, endophthalmitis, retinal injury, and treatment-related systemic adverse reactions. The measurement data between groups were compared by t test, and the count data were compared by χ2 test or rank sum test. Results:Of the 306 eyes of 156 children with ROP, 74 were male (47.44%, 74/156) and 82 were female (52.56%, 82/156). Each included child had a history of oxygen inhalation at birth. The GA was (28.43±2.19) (23.86-36.57) weeks, BW was (1 129±335) (510-2 600) g, and the postmenstrual gestational age was (39.80±3.04) (31.71-49.71) weeks at the time of the first anti-VEGF drug treatment. All patients were diagnosed as type 1 ROP, including 26 eyes (8.50%, 26/306) of aggressive ROP (A-ROP), 39 eyes (12.74%, 39/306) of zone Ⅰ lesions, and 241 eyes (78.76%, 241/306) of zone Ⅱ lesions. The children were treated with intravitreal injection of anti-VEGF drugs within 72 hours after diagnosis. Among them, 134 eyes (43.79%, 134/306) of 68 patients were treated with IVR, and 172 eyes (56.21%, 172/306) of 88 patients were treated with IVC. In IVC group, 67 eyes of 34 patients (38.95%, 67/172) were in the hospital group and 105 eyes of 54 patients (61.05%, 105/172) were in the referral group. 279 eyes (91.18%, 279/306) were improved after one treatment, 15 eyes (4.90%, 15/306) were improved after two treatments, and 12 eyes (3.92%, 12/306) were improved after three treatments. The one-time cure rate of IVR group was lower than that of IVC group, but the difference was not statistically significant ( χ2=1.665, P=0.197). In different ROP categories, IVC showed better therapeutic effect in A-ROP, and its one-time cure rate was higher than that in IVR group, with statistically significant difference ( χ2=7.797, P<0.05). In the hospital group of IVC group, the GA, BW and the postmenstrual gestational age at first time of anti-VEGF drug treatment were lower than those in the referral group, and the difference was statistically significant ( t=-2.485, -2.940, -3.796; P<0.05). The one-time cure rate of the hospital group and the referral group were 94.94%, 92.38%, respectively. The one-time cure rate of the hospital group was slightly higher than that of the referral group, but the difference was not statistically significant ( χ2=0.171, P=0.679). In this study, there were no ocular and systemic adverse reactions related to drug or intravitreal injection in children after treatment. Conclusions:Compared with the characteristics of ROP in developed countries, the GA, BW and postmenstrual gestational age of the children in Sichuan province are higher. Both IVR and IVC can treat ROP safely and effectively. There is no significant difference between the two drugs in the overall one-time cure effect of ROP, but IVC performed better in the treatment of A-ROP in this study.

5.
Chinese Journal of Ocular Fundus Diseases ; (6): 78-82, 2023.
Article in Chinese | WPRIM | ID: wpr-995598

ABSTRACT

Diabetic retinopathy (DR) is one of the most common and serious complication of diabetes mellitus, which is the main cause of vision loss in adults. Biological clock genes produce circadian rhythms and control its operation, while the disorder of the expression causes the occurrence and development of a series of diseases. It has been demonstrated that biological clock genes might take effects in the development and progression of DR. On the one hand, circadian rhythm disorder-related behavior disrupts the circadian oscillation of clock genes, and the change in its expression level is prone to unbalanced regulation of glucose metabolism, ultimately increasing the risk of type 2 diabetes mellitus and DR pathogenesis. On the other hand, DR patients exhibit symptoms of circadian rhythm disorders, and it has been suggested that the clock genes may control the development and progression of DR by affecting a variety of retinal pathophysiological processes. Therefore, maintaining normal circadian rhythm can be used as a disease prevention strategy, and studying the molecular mechanism of clock genes in DR can provide new ideas for more comprehensive elaboration of the pathogenesis of DR and search for new therapeutic targets.

6.
International Eye Science ; (12): 1754-1759, 2023.
Article in Chinese | WPRIM | ID: wpr-987904

ABSTRACT

AIM: To assess the differences in corneal biomechanical parameters and their correlation with other ocular biometric parameters in myopic patients using a corneal visualisation scheimpflug technology(Corvis ST).METHODS: A total of 132 myopic patients who received treatment in the department of refractive surgery of Eyegood Ophthalmic Hospital from May to December 2021 were selected, and the data of right eye were taken. The subjects were classified into low and moderate myopia(-0.50 to -6.00D), high myopia(&#x003E;-6.00D to &#x003C;-8.00D), and super high myopia(≥-8.00D)according to the spherical equivalent(SE). The basic parameters of corneal biomechanical deformation measured with Corvis ST included the amount of corneal displacement at highest degree of concavity(DA), radius of curvature at highest concavity(HCR), and distance between the two peaks of the cornea at highest concavity(PD); stiffness parameters at applanation 1(SP-A1), integrated radius(IR), deformation amplitude ratio(DA ratio), Ambrosio relational thickness horizontal(ARTh), Corvis biomechanical index(CBI). Other ocular biometric parameters measured included SE, intraocular pressure(IOP), axial length(AL), central corneal thickness(CCT), white-to-white(WTW)and retinal nerve fiber layer(RNFL)thickness. The differences in corneal biomechanical parameters were compared among the three groups of myopic patients, and the correlation between corneal biomechanical parameters and other ocular biometric parameters and age was further analyzed.RESULTS: The SP-A1 in the low and moderate, high, and super high myopia groups were 106.8±16.2, 115.6±21.9, and 106.9±11.5, respectively. The SP-A1 in the high myopia group was higher than that in the low and moderate and severe myopia groups(all P&#x003C;0.05). All corneal biomechanics were significantly correlated with CCT(P&#x003C;0.01); all corneal biomechanics were correlated with IOP except ARTh(P&#x003C;0.05); AL was significantly and positively correlated with PD(r=0.270, P=0.002), weakly and positively correlated with HCR(r=0.177, P=0.043), and weakly and negatively correlated with IR(r=-0.183, P=0.036); WTW was positively correlated with PD, DA and DA ratio(r=0.363, P&#x003C;0.001; r=0.252, P=0.003; r=0.200, P=0.02); there was no correlation between corneal biomechanical parameters and age, SE, and RNFL.CONCLUSION: Corneal stiffness was higher in high myopia patients than in patients with low to moderate and super high myopia. IOP and CCT were both important factors affecting corneal biomechanics. Some of the biomechanical parameters also have certain correlation with AL and WTW. As the growth of axial length, the PD of corneal deformation and HCR were larger, and IR was smaller, but HCR and IR had little significance; the longer the WTW, the greater the corneal deformation amplitude. In clinical practice, attention should be paid to the corneal biomechanical parameters in patients with super high myopia.

7.
Chinese Journal of Epidemiology ; (12): 379-385, 2023.
Article in Chinese | WPRIM | ID: wpr-969917

ABSTRACT

Objective: To explore the epidemiological characteristic of a COVID-19 outbreak caused by 2019-nCoV Omicron variant BF.7 and other provinces imported in Shenzhen and analyze transmission chains and characteristics. Methods: Field epidemiological survey was conducted to identify the transmission chain, analyze the generation relationship among the cases. The 2019-nCoV nucleic acid positive samples were used for gene sequencing. Results: From 8 to 23 October, 2022, a total of 196 cases of COVID-19 were reported in Shenzhen, all the cases had epidemiological links. In the cases, 100 were men and 96 were women, with a median of age, M (Q1, Q3) was 33(25, 46) years. The outbreak was caused by traverlers initial cases infected with 2019-nCoV who returned to Shenzhen after traveling outside of Guangdong Province.There were four transmission chains, including the transmission in place of residence and neighbourhood, affecting 8 persons, transmission in social activity in the evening on 7 October, affecting 65 persons, transmission in work place on 8 October, affecting 48 persons, and transmission in a building near the work place, affecting 74 persons. The median of the incubation period of the infection, M (Q1, Q3) was 1.44 (1.11, 2.17) days. The incubation period of indoor exposure less than that of the outdoor exposure, M (Q1, Q3) was 1.38 (1.06, 1.84) and 1.95 (1.22, 2.99) days, respcetively (Wald χ2=10.27, P=0.001). With the increase of case generation, the number and probability of gene mutation increased. In the same transmission chain, the proportion of having 1-3 mutation sites was high in the cases in the first generation. Conclusions: The transmission chains were clear in this epidemic. The incubation period of Omicron variant BF.7 infection was shorter, the transmission speed was faster, and the gene mutation rate was higher. It is necessary to conduct prompt response and strict disease control when epidemic occurs.


Subject(s)
Male , Humans , Female , SARS-CoV-2 , COVID-19/epidemiology , Disease Outbreaks , Epidemics , China/epidemiology
8.
Chinese Journal of Ocular Fundus Diseases ; (6): 99-107, 2022.
Article in Chinese | WPRIM | ID: wpr-934278

ABSTRACT

With the rapid development of fundus imaging technology, it is of great significance to establish a new naming system for neovascular age-related macular degeneration (nAMD) based on the multi-mode imaging. In 2020, an international panel of retina specialists, imaging and image reading center experts, and ocular pathologists reached a consensus after repeated discussions, a new name for nAMD subtype and related lesions was established based on the previous knowledge of fundus fluorescein angiography and pathology, combining indocyanine green angiography, optical coherence tomography and optical coherence tomography angiography with current pathological knowledge, in order to help ophthalmologists to study nAMD. The consensus proposed the term "macular neovascularization" and classified it into type 1, type 2 and type 3. Many lesions related to macular neovascularization, such as pigment epithelial detachment, hemorrhage, fibrosis, rip of retinal pigment epithelium and so on, were named. The new designation will help improve clinical communication between different studies, establish standard definitions and terms between reading centers and researchers, and further promote the understanding and communication of nAMD among ophthalmologists.

9.
Chinese Journal of General Practitioners ; (6): 135-140, 2022.
Article in Chinese | WPRIM | ID: wpr-933705

ABSTRACT

Objective:To analyze the clinical characteristics of pneumonia caused by Chlamydia psittaci (C. psitttaci). Methods:A retrospective analysis was performed on the clinical data of 13 consecutive patients with C. psitttaci pneumonia admitted to the First Affiliated Hospital of Xiamen University from November 2018 to February 2021. Results:All 13 cases had symptoms of fatigue and 6 cases had headache. At consultation, the ΔSequential Organ Failure Assessment (SOFA) scores of all patients were ≥2 points. According to the Pneumonia Severity Index (PSI) score, 2 patients were grade Ⅱ and the other 11 patients were grade Ⅳ or Ⅴ. Laboratory tests showed that C-reactive protein (CRP) and procalcitonin (PCT) levels were elevated in all patients; CRP≥100 mg/L was found in 11 cases and PCT≥0.5 ng/ml was found in 9 cases.There were 12 cases with respiratory failure and 12 cases with elevated transaminase. Chest CT scans showed multiple patchy exudative shadow, focal consolidation and air bronchial sign; and the lesions were mainly in the lower lungs (8 cases). C. psitttaci infections were confirmed by metagenomics next-generation sequencing (mNGS) and the patients′ conditions improved rapidly after timely adjustment of doxycycline based drug treatment and active organ support. The lesions were completely absorbed without residual fibrous cord changes and the prognosis was good. Conclusions:Pneumonia caused by C. psitttaci usually presents sepsis, and the disease progresses rapidly. The mNGS is of value for the early diagnosis of C. psitttaci pneumonia. Timely adjustment of antibiotics treatment after etiological diagnosis can lead to a good prognosis.

10.
International Journal of Traditional Chinese Medicine ; (6): 12-16, 2022.
Article in Chinese | WPRIM | ID: wpr-930094

ABSTRACT

Australia and EU Member States have been the important components of global herbal medicine market. The legal use of Chinese Materia Medica in Australia and EU Member States is closely related to the internationalization of Chinese medicine, therefore it is of great significance to conduct a comparative study on their herbal medicine registration regulations. By summarizing the regulations issued by Therapeutic Goods Administration (TGA) and European Medicines Agency (EMA), and comparing related definitions and the regulations on quality management and medicinal product registration, we found that the method No.3 of L (A) 3 and the traditional-use registration are more conductive to bringing Chinese patent medicines to market in Australia and the EU Member States.

11.
Chinese Acupuncture & Moxibustion ; (12): 390-396, 2022.
Article in Chinese | WPRIM | ID: wpr-927394

ABSTRACT

OBJECTIVE@#To explore the effectiveness on exogenous fever and the characteristics of effective population, as well as the specialties of prescription of acupoint application.@*METHODS@#Using the internet electronic diagnosis and treatment platform (Spring Broadcast Wanxiangyun Clinic Database, and the main TCM suitable technology promoted by this platform is acupoint application therapy), from August 24, 2020 to November 5, 2020, the patients complained with fever and diagnosed as common cold, with a record of initial visit and at least one return visit, were included as the subjects. According to whether acupoint application therapy was received or not, the subjects were divided into an exposure group (with acupoint application therapy, 26 664 cases) and a non-exposure group (without acupoint application therapy, 515 cases). Using the propensity score, the mixed factors, e.g. age and sex, were matched between the two groups. The disappearance rate of fever (within 2 days) and the time for the first fever disappearance were taken as the effect indexes. The association rules extraction was adopted to analyze the characteristics of effective population and acupoint application prescription in treatment of exogenous fever.@*RESULTS@#After propensity score matching, there were 1 229 cases in the application group and 423 cases in the non-application group. The disappearance rate of fever in the application group was 1.82 times as high as that in the non-application group (P<0.05). The time for the first fever disappearance in the application group was shorter than the non-application group (P<0.01). A total of 5 370 cases were effective with acupoint application therapy, of which, the median age was 2 years old and the proportion of children patients under 6 years old was relatively high. In the effective crowd, the most commonly-used acupoints were Shenque (CV 8), Dazhui (GV 14), Yongquan (KI 1) and Tiantu (CV 22), etc. Shenque (CV 8) and Dazhui (GV 14) were highly associated and the support was 62.57%. The most common herbal materials in the acupoint application therapy included Radix et Rhizoma Rhei, Natrii Sulfas, Radix Scutellariae, Herba Ephedrae and Radix Bupleuri, etc. Radix et Rhizoma Rhei and Natrii Sulfas were most commonly used at Shenque (CV 8) and the supports were 57.49% and 57.21% respectively. Herba Ephedrae was most commonly applied to Shenque (CV 8) and Dazhui (GV 14) and the supports were 48.21% and 43.91% respectively. Radix Bupleuri was the most common herb at Dazhui (GV 14) with the support of 46.61%. Besides, the most commonly combined western drugs included cefixime and keteling in the acupoint application therapy and the supports were 13.07% and 12.72% respectively.@*CONCLUSION@#Acupoint application is effective on exogenous fever. The common therapy refers to Radix et Rhizoma Rhei and Natrii Sulfas plaster at Shenque (CV 8), while Herba Ephedrae and Radix Bupleuri at Dazhui (GV 14).


Subject(s)
Child , Child, Preschool , Humans , Acupuncture Points , Drugs, Chinese Herbal/therapeutic use , Fever/therapy , Retrospective Studies , Seasons
12.
Chinese Acupuncture & Moxibustion ; (12): 241-249, 2022.
Article in Chinese | WPRIM | ID: wpr-927367

ABSTRACT

OBJECTIVE@#To observe the influence of acupoint application on the use of antibiotics in primary clinic practice, and explore the effect of acupoint application and its influence on the use of antibiotics based on common diseases in primary clinic (fever, cough, diarrhea, sore throat).@*METHODS@#With the help of the internet electronic diagnosis and treatment platform (the main TCM suitable technology promoted by this platform is acupoint application therapy), the diagnosis and treatment data of 1.23 million patients in 2 000 primary clinics from August 24, 2020 to March 31, 2021 were collected. The patients were divided into an application group (acupoint application treatment) and a non-application group (non-acupoint application treatment), and the proportion of antibiotic use in the two groups was compared. The propensity score was used to match age, gender, concomitant symptoms, diagnosed diseases and other confounding factors of treatment, and the disappearance rate of symptoms (fever, cough, diarrhea, sore throat) and the time to first disappearance of symptoms were compared between the two groups.@*RESULTS@#A total of 1 230 923 patients were analyzed, including 1 048 382 cases in the application group, accounting for 85.2%; 182 541 cases in the non-application group, accounting for 14.8%. The most patients who used acupoint application treatment were 0-2 years old, followed by 3-6 years old, and the patients over 15 years old who did not use acupoint application treatment were the most. The proportion of antibiotic use in the application group was 2.4%, lower than that in the non-application group (44.2%, P<0.001). The proportion of antibiotic use in all ages of patients in the application group was lower than that in the non-application group (P<0.001). Among the common diseases in primary clinic (fever, cough, diarrhea and sore throat), the proportion of antibiotic use in the application group was lower than that in the non-application group (P<0.01); the disappearance rate of symptoms in the application group was higher than that in the non-application group, and the time to first disappearance of symptoms was shorter than that in the non-application group (P<0.001).@*CONCLUSION@#Acupoint application has a certain influence on the use of antibiotics in primary clinic patients. In the treatment of common diseases, patients treated with acupoint application have better curative effect and lower proportion of antibiotic use.


Subject(s)
Adolescent , Child , Child, Preschool , Humans , Infant , Infant, Newborn , Acupuncture Points , Anti-Bacterial Agents/therapeutic use , Cough/drug therapy , Diarrhea , Pharyngitis/drug therapy
13.
Journal of Peking University(Health Sciences) ; (6): 18-22, 2022.
Article in Chinese | WPRIM | ID: wpr-936107

ABSTRACT

OBJECTIVE@#To explore the correlation of cytochrome B-245 alpha chain (CYBA) rs4673 and cholesteryl ester transfer protein (CETP) rs12720922 polymorphisms with the susceptibility of gene-ralized aggressive periodontitis (GAgP).@*METHODS@#The study was a case-control trial. A total of 372 GAgP patients and 133 periodontally healthy controls were recruited. The CYBA rs4673 and CETP rs12720922 polymorphisms were detected by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-MS). Logistic regression models were used to analyze the correlation of CYBA rs4673 and CETP rs12720922 variants with the susceptibility of GAgP. The interaction between the two gene polymorphisms to the susceptibility of GAgP was analyzed by the likelihood ratio test. The interaction model adopted was the multiplication model.@*RESULTS@#The mean age of GAgP group and control group was (27.5±5.2) years and (28.8±7.1) years respectively. There was significant difference in age between the two groups (P < 0.05). The gender distribution (male/female) was 152/220 and 53/80 respectively, and there was no significant difference between GAgP group and controls (P>0.05). For CYBA rs4673, the frequency of CT/TT genotype in the GAgP group was significantly higher than that in the controls [18.0% (66/366) vs. 10.6% (14/132), P < 0.05]. After adjusting age and gender, the individuals with CT/TT genotype had a higher risk of GAgP (OR=1.86, 95%CI: 1.01-3.45, P < 0.05), compared with CC genotype. There was no statistically significant difference in distributions of the CETP rs12720922 genotypes (GG, AA/AG) between GAgP patients and healthy controls (P>0.05). A significant interaction between CYBA rs4673 and CETP rs12720922 in the susceptibility to GAgP was observed. The GAgP risk of the individuals with CYBA rs4673 CT/TT and CETP rs12720922 GG genotypes was significantly increased (OR=3.25, 95%CI: 1.36-7.75, P < 0.01), compared with those carrying CC and AA/AG genotypes.@*CONCLUSION@#CYBA rs4673 CT/TT genotype is associated with GAgP susceptibility. There is a significant interaction between CYBA rs4673 CT/TT genotype and CETP rs12720922 GG genotype in the susceptibility of GAgP.


Subject(s)
Adult , Female , Humans , Male , Young Adult , Aggressive Periodontitis/genetics , Case-Control Studies , Cholesterol Ester Transfer Proteins/genetics , Cytochrome b Group , Gene Frequency , Genetic Predisposition to Disease , Genotype , NADPH Oxidases/genetics , Polymorphism, Single Nucleotide
14.
Chinese Journal of Hepatology ; (12): 63-68, 2022.
Article in Chinese | WPRIM | ID: wpr-935909

ABSTRACT

Objective: To study the expression and effect of small nuclear ribonucleoprotein-associated protein B (SNRPB) on proliferation and metastasis of liver cancer tissues and cells. Methods: The bioinformatics database starBase v3.0 and GEPIA were used to analyze the expression of SNRPB in liver cancer tissue and normal liver tissue, as well as the survival and prognosis of liver cancer patients. The expression of SNRPB mRNA and protein in liver cancer cell lines were analyzed by qRT-PCR and Western blot. RNA interference technique (siRNA) was used to determine SNRPB protein expression down-regulation. The proliferation effect on hepatocellular carcinoma cells was observed by MTT assay. Transwell invasion and migration assay was used to detect the changes in the metastatic ability of liver cancer cells after SNRPB down-regulation. Western blot was used to detect the changes of epithelial mesenchymal transition (EMT) markers in liver cancer cells after down-regulation of SNRPB expression. Data were compared between two groups and multiple groups using t-test and analysis of variance. Results: The expression of SNRPB was significantly higher in liver cancer tissue than normal liver tissue, and its expression level was correlated with the prognosis of liver cancer patients. Compared with the immortalized hepatocyte LO(2), the expression of SNRPB was significantly increased in the liver cancer cells (P < 0.01). siRNA-SNRPB had significantly inhibited the expression of SNRPB mRNA and protein in liver cancer cells. MTT results showed that the absorbance value was lower in SNRPB knockdown group than negative control group, and the difference at 96 h after transfection was most significant (P < 0.01). Transwell assay results showed that compared with the negative control group, the SNRPB knockdown group (MHCC-97H: 121.27 ± 8.12 vs. 46.38 ± 7.54; Huh7: 126.50 ± 6.98 vs. 41.10 ± 8.01) invasion and migration (MHCC-97H: 125.20 ± 4.77 vs. 43.18 ± 7.32; Huh7: 132.22 ± 8.21 vs. 38.00 ± 6.78) ability was significantly reduced (P < 0.01) in liver cancer cells. Western blot showed that the expression level of epithelial phenotype marker E-cadherin was decreased after down-regulation of SNRPB, while the expression levels of mesenchymal phenotype markers N-cadherin and vimentin was increased, suggesting that down-regulation of SNRPB inhibited EMT in liver cancer cells. Conclusion: SNRPB expression is significantly increased in liver cancer tissues and cells, and it is involved in regulating the proliferation, metastasis and EMT of liver cancer cells.


Subject(s)
Humans , Carcinoma, Hepatocellular/genetics , Cell Line, Tumor , Cell Movement , Cell Proliferation , Epithelial-Mesenchymal Transition , Gene Expression Regulation, Neoplastic , Liver Neoplasms/genetics , snRNP Core Proteins
15.
Chinese Journal of Ocular Fundus Diseases ; (6): 954-959, 2021.
Article in Chinese | WPRIM | ID: wpr-934260

ABSTRACT

Objective:To deeply explore the clinical features and gene mutations of Waardenburg syndrome (WS) by tested of the eyes and genes of three patients.Methods:A Case series study. From 2019 to 2021, 3 children with WS who were diagnosed at Department of Ophthalmology, West China Hospital of Sichuan University were included in the study. Among them, there were 2 males and 1 female; the ages were 3, 4, and 12 months, respectively. All children underwent external eye, anterior segment, fundus and fluorescein fundus angiography, the clinical features of the eyes were observed. The peripheral venous blood of 3 children was collected, and the whole genome DNA was extracted for whole exome sequencing to analyze the gene mutation sites.Results:All children had different degrees of iris heterochromia and fundus pigment abnormalities, and were accompanied by sensorineural hearing impairment. Case 1 had dystopia canthorum; case 2 had macular fovea hypoplasia. The sequencing results of case 1 showed that there were large fragments of heterozygous deletion in exons 2-8 of the Paired box 3 ( PAX3) gene, who was diagnosed as WS Ⅰ type. The sequencing results of of case 2 showed heterozygous mutation in exon 9 of Microphthalmia-associated transcription factor ( MITF) gene (c.1066 C >T), combined with heterozygous mutation in exon 1 of HPS6 gene (c.1417 G> T), who was diagnosed as WS Ⅱ type. The sequencing result of case 3 showed that the exon 3 of SOX10 gene had loss of heterozygosity (c.497_500 delAAGA), who was diagnosed as WS Ⅳ type. Both PAX3 and SOX10 gene mutations were newly discovered mutations. Conclusions:The ocular clinical features of Waardenburg syndrome include hypopigmentation of the iris and choroid, and dystopia canthorum, etc. Early screening of the eye and hearing will help to better diagnose the disease. The large fragments of heterozygous deletion in exons 2-8 of the PAX3 gene, the heterozygous mutation in exon 9 of MITF gene (c.1066 C> T), and the loss of heterozygosity in exon 3 of SOX10 gene are pathogenic genetic variations of 3 children.

16.
Chinese Journal of Ocular Fundus Diseases ; (6): 169-172, 2021.
Article in Chinese | WPRIM | ID: wpr-885857

ABSTRACT

With the development of ophthalmic optical coherence tomography (OCT) and OCT angiography (OCTA), including the improving of light source, resolution, scanning depth and upgrade of analysis softwares, they can more accurately display the structure of retinal layers and give accurate quantitative measurement. In neuro-ophthalmic diseases, the OCT indicators (the thickness of retinal nerve fiber layer around optic disc and plexus layer in macular gangle cells) and OCTA indicators (the blood flow density of capillaries around optic disc, superficial and deep capillaries in macular area, and the area of foveal avascualr zone) had special changes. It has important value in the differential diagnosis of central nervous system diseases and retinal diseases with visual dysfunction as the first symptom, the diagnosis and differential diagnosis of neuro-ophthalmic disease, the evaluation of progression of neurodegenerative diseases. Neuro-ophthamologists should pay more attention to the exploration and application of OCT and OCTA in the field of neuro-ophthalmology.

17.
Chinese Journal of Contemporary Pediatrics ; (12): 259-264, 2021.
Article in Chinese | WPRIM | ID: wpr-879843

ABSTRACT

OBJECTIVE@#To study the clinical features of pericardial effusion caused by central venous catheterization in preterm infants.@*METHODS@#A retrospective analysis was performed on 11 preterm infants with pericardial effusion caused by central venous catheterization. Their catheterization features, manifestations, treatment, and prognosis were analyzed.@*RESULTS@#A total of 11 preterm infants (11/2 599, 0.42%) developed pericardial effusion, with a mean gestational age of (30.1±2.6) weeks and a mean birth weight of (1 240±234) g. Pericardial effusion mostly occurred within 4 days after central venous catheterization (10 cases, 91%). The main manifestations included poor response (6/11, 55%), cyanosis (5/11, 45%), increased respiratory rate (6/11, 55%), increased heart rate (6/11, 55%), aggravated dyspnea (5/11, 45%), and muffled heart sound (5/11, 45%). At the time of disease progression, 7 preterm infants (64%) had a deep position of the end of the catheter, 3 preterm infants (27%) had a correct position, and 1 preterm infant (9%) had a shallow position. Five preterm infants (45%) experienced cardiac tamponade, among whom 4 underwent pericardiocentesis. Seven preterm infants were given conservative medical treatment. Among the 11 children, 2 (18%) died and 9 (82%) improved.@*CONCLUSIONS@#Pericardial effusion caused by central venous catheterization mostly occurs in the early stage of catheterization and has critical clinical manifestations. Pericardiocentesis is required for cardiac tamponade, and early diagnosis and intervention can effectively improve prognosis.


Subject(s)
Child , Humans , Infant , Infant, Newborn , Catheterization, Central Venous/adverse effects , Infant, Premature , Pericardial Effusion/therapy , Pericardiocentesis , Retrospective Studies
18.
Chinese Journal of Medical Genetics ; (6): 170-173, 2021.
Article in Chinese | WPRIM | ID: wpr-879548

ABSTRACT

OBJECTIVE@#To explore the genetic basis for a child with ocular anomaly, microcephaly, growth retardation and intrauterine growth restriction.@*METHODS@#The patient underwent ophthalmologic examinations including anterior segment photography, fundus color photography, and fundus fluorescein angiography. The patient and her parents were subjected to whole exome sequencing. Candidate variants were verified by Sanger sequencing and bioinformatic analysis.@*RESULTS@#The patient was found to have bilateral persistent pupillary membrane and coloboma of inferior iris, in addition with macular dysplasia and radial pigmentation near the hemal arch of the temporal retina. She was found to have carried compound heterozygous missense variants of the PHGDH gene, namely c.196G>A and c.1177G>A, which were respectively inherited from her father and mother. Bioinformatic analysis suggested both variants to be pathogenic.@*CONCLUSION@#The patient was diagnosed with phosphoglycerate dehydrogenase deficiency. Above finding has enriched the phenotypic spectrum of the disease with ocular manifestations.


Subject(s)
Child , Female , Humans , Carbohydrate Metabolism, Inborn Errors/genetics , Coloboma , Microcephaly/genetics , Mutation , Phenotype , Phosphoglycerate Dehydrogenase/genetics , Psychomotor Disorders/genetics , Seizures/genetics , Exome Sequencing
19.
Chinese Journal of Medical Genetics ; (6): 42-46, 2021.
Article in Chinese | WPRIM | ID: wpr-879519

ABSTRACT

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.


Subject(s)
Child , Humans , CHARGE Syndrome/genetics , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Genetic Variation , Mutation , Phenotype
20.
Chinese Journal of Biotechnology ; (12): 4015-4023, 2021.
Article in Chinese | WPRIM | ID: wpr-921482

ABSTRACT

Metal-organic frameworks (MOFs) are formed by self-assembly of metal ions or clusters with organic ligands, and are widely used in the fields of catalysis, sensing, energy and biomedicine. Recently, biological composites based on MOFs have attracted increasing attention. MOFs can be used as a platform for encapsulating bioactive substances due to the advantages such as large pore capacity, large specific surface area and diverse structure composition. These features can protect bioactive substances from adverse conditions, e.g. high temperature, high pressure, and organic solvents, thus improving the anti-adversity of bioactive substances. This review summarizes the advances of using MOFs as protective coatings to improve the anti-adversity of different bioactive substances, and introduces the synthesis strategy of MOFs-based biological composites, with the aim to promote the practical application of MOFs-based biological composites.


Subject(s)
Catalysis , Ions , Metal-Organic Frameworks , Metals
SELECTION OF CITATIONS
SEARCH DETAIL