B7-H3 and CD 133 expression in non-small cell lung cancer and correlation with clinicopathologic factors and prognosis

To detect the expression of B7-H3 and CD 133 in human non-small cell lung cancer [NSCLC] specimens and lung benign lesions, and to evaluate the correlation between the 2 biomarkers and clinicopathologic features. This is a case-control study of 102 tissue specimens collected from NSCLC participants undergoing thoracic surgery in the Second Affiliated Hospital of Soochow University, Suzhou, China, between January 2006 and December 2008. From the 102 patients, 25 adjacent non-cancer samples were verified pathologically as normal tissue [positive group], and 24 benign inflammatory lesion tissues were used as control [negative group]. Specimens from 126 participants were stained immunohistochemically using Image-Pro Plus software, and the cell number was measured in each section. Of the 102 specimens, 71 expressed B7-H3, and 51 expressed CD 133, higher than that in benign lesions [p<0.001] or non-cancer tissues [p<0.001]. B7-H3 expression in squamous cell carcinoma [SCC] was significantly higher than those in adenocarcinoma [p=0.048], while CD 133 expression in large cell lung carcinoma was higher than that in SCC [p=0.023]. The mean number of tumor-infiltrating lymphocytes [TILs] in the B7-H3-positive group was lower than that in the B7-H3-negative group [p=0.026]. The mean TILs in the CD133-positive group was significantly lower than that in CD133-negative group [p=0.029]. We found that CD 133 was related to tumor cell differentiation degree and CD 133 expression was negatively correlated with B7-H3 expression. The CD 133 positive or B7-H3 negative was associated with poor prognosis of NSCLC patients by Cox regression analysis. Both CD 133 and B7-H3 might induce apoptosis of TILs in NSCLC and tumor evading host immune surveillance. Either CD 133 or B7-H3 might be an independent risk factor of NSCLC participants

Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells / 中华肿瘤杂志

<p><b>OBJECTIVE</b>To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.</p><p><b>METHODS</b>PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.</p><p><b>RESULTS</b>The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.</p><p><b>CONCLUSION</b>Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.</p>