ABSTRACT
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
ABSTRACT
Objective To investigate the role of endothelial progenitor cells ( EPCs ) transplantation in rats with sepsis induced by endotoxin ( lipopolysaccharides, LPS ). Methods Sixty clean grade Sprague-Dawley ( SD ) rats with genetic background were divided into three groups according to random number table method:control group, model group, and EPCs transplantation group, with 20 rats in each group. The sepsis model was reproduced by intravenous delivery of LPS 5 mg/kg. Rats in control group were injected with the same amount of normal saline. EPCs were isolated, and cultured and identified were fluorescently labeled with the green fluorescent protein ( GFP ) adenoviral transfection method. The EPC transplantation group was injected with LPS, then a fluorescently labeled EPCs suspension was injected via the tail vein 1 hour later. The expression of fluorescent markers of EPCs was detected with both small animal in vivo imaging instrument and frozen section. Seven days after transplantation, abdominal aorta blood was collected to determine interleukins ( IL-6 and IL-10 ) in peripheral blood with enzyme linked immunosorbent assay ( ELISA ), and the lung, liver, and kidney tissues were harvested, the wet/dry ratio of the lung ( W/D ) was calculated, and hematoxylin and eosin ( HE ) staining was performed to observe, the change in histopathology. Toll-like receptor 4 ( TLR4 ) mRNA expression in lung, liver, and kidney tissues was determined with real-time reverse transcription-polymerase chain reaction ( RT-PCR ). Results The positive rate of EPCs cells with double marking of CD133 and CD34 was 99.0% at the 5th generation of subculture by using flow cytometry. After the transplantation of EPCs labeled with the green fluorescent protein, the appearance of fluorescence indicated that EPCs were mainly localized in the chest, and a stronger fluorescence was observed near the blood vessels. EPCs transplantation could significantly reduce the inflammatory cell infiltration and cell damage in lung, liver, and kidney tissue in septic rats. Compared with control group, the expression of IL-6 and IL-10 in the peripheral blood, W/D ratio, and TLR4 mRNA in lung, liver, and kidney were increased significantly in the model group. Compared with model group, the expressions of IL-6 and IL-10 in the peripheral blood were significantly reduced after EPCs transplantation [ IL-6 (μg/L ):2.127±0.118 vs. 2.664±0.438, IL-10 ( ng/L ): 24.5±3.9 vs. 31.5±3.8, both P < 0.01 ]. EPCs transplantation reduced the W/D ratio of lung, liver and kidney tissues ( lung: 4.68±0.24 vs. 5.48±0.15, liver: 3.33±0.11 vs. 3.94±0.09, kidney: 4.08±0.20 vs. 4.84±0.21, all P < 0.05 ], and down-regulated the expression of TLR4 mRNA ( ×103, lung: 782±131 vs. 1 136±126, liver: 39.1±14.0 vs. 69.2±8.7, kidney: 52.2±15.2 vs. 83.5±17.1, all P < 0.01 ). Conclusions EPCs can enter the lung, liver and kidney tissues of the rat successfully after transplantation of EPCs via vein. EPCs transplantation can down-regulate pro-inflammatory process, help to recover the balance of pro-and anti-inflammatory processes, alleviate the damage to the lung, liver, and kidney tissue significantly.
ABSTRACT
Objective To investigate the clinical effect and safety of the application of contitunous renal replacement therapy (CRRT) in non-kidney severe patients in MICU.Methods Twenty-nine cases who underwent the CRRT in MICU were included in the study.Vessel pathway were all through inserting double channel catheter in femoral vein or internal carotid vein.According to the patient's condition,patients were treated by slow continuous ultrafiltration( CVVH )or continuous veno-venous hemodialysis (CVVHDF).The duration was 4-12 hours or continuation if necessary.The volume of blood flow was 100-180 ml/h.The displacement liquid was 30-50 ml/time.The volume of dehydration was 0-4 kg according to the patient's condition.The clinical symptoms,hemodynamics,blood biochemistry,PaO2/FiO2,pH,tumor necrosis factor and acute physiology and chronic health evaluation (APACHE) Ⅱ were observed before and after therapy.The complications were monitored.Results The vital signs of the patients became stable shortly after CRRT therapy,before CRRT temperature ( 37.6 ± 0.88 ) ℃,respiratory rate ( 110.3 ± 19.54)time/min,the oxygention index (262.6 ± 10.6),WBC ( 11.33 ± 2.27) × 109/L,NE (85.62 ± 7.83 ) %,AST ( 74.58 ± 19.34 ) U/L,APPACHE Ⅱ score ( 24.37 ± 9.23 ),after CRRT temperature ＞( 36.84 ± 0.58 ) ℃.respiratory rate ( 102.0 ± 16.2 ) times/min,the oxygention index ( 373.2 ± 11.2),WBC (9.62 ±3.26) × 109/L,NE (71.58 ± 10.54) %,AST(38.34 ± 13.96) U/L,APACHE Ⅱ score ( 14.65 ± 6.54).There were significantly difference between the indices at before and after treatment ( P ＜ 0.05 ).Serious ions and acid base abnormality were rectified during CRRT therapy without any severe complications.Conclusions CRRT therapy could decline the level of infections reaction and improve organs' function,adjust the balance of internal environment,stable hemodynamics without any severe complication after treatment.CRRT is safe and effective.In conclusion,CRRT is a primary treatment and an important supportive therapy.
ABSTRACT
AIM:To observe the change of nitric oxide(NO)and hydrogen sulfide(H_2S)in blood and lung homogenate of hypoxic pulmonary hypertension(HPH)rat model,and to discuss the meaning of inhalation sodium nitrite and these factors in the treatment of HPH. METHODS:Fifty healthy male Wistar rats were assigned randomly into 5 groups(10 rats each):normoxia control group(NC),normoxia sodium nitrite group(NNI),hypoxic control group(HC),hypoxic normal saline group(HNS)and hypoxic sodium nitrite group(HNI). The mean pulmonary arterial pressure(mPAP),weight of right ventricle,weight of left ventricle plus septum,and the ratio of the weight of right ventricle to that of left ventricle plus septum(right ventricle hypertrophy index,RVHI)were also determined. The serum level of NO and plasma level of H_2S were measured,and at the same time the levels of NO in the lung homogenate were detected. The structures in pulmonary arteries were examined using optical microscope. RESULTS:After model established,compared to that in the normoxia groups,the body weight decreased significantly in hypoxia groups(P<0.05),although no difference of body weight in five groups before producing model was observed. Compared to that in normoxia groups,the levels of mPAP and RVHI increased significantly in hypoxia groups,and compared to that in hypoxia control groups and hypoxia normal saline group,mPAP and RVHI levels decreased significantly in hypoxia sodium nitrite group(P<0.05). Compared to that in normoxia groups,the serum level of NO decreased significantly in hypoxia groups(P<0.05). NO level in lung homogenate decreased significantly in hypoxia control group and hypoxia normal saline group as compared to that in normoxia groups(P<0.05),and no obvious difference between hypoxic sodium nitrite group and normoxia groups was found. The plasma level of H_2S was decreased significantly in hypoxia groups(P<0.05)as compared to that in normoxia groups. H_2S level increased significantly in hypoxia sodium nitrite group as compared to that in hypoxia control groups and hypoxia normal saline group(P<0.05). Observation under optical microscope,the lumen structure of lung in normoxia control group was normal. No significant change in normoxia sodium nitrite group was found. The proliferation of smooth muscle cells(SMCs),the collagen fiber deposition in the vessel wall and every caliber thickening was observed in hypoxic control group. The same changes were also observed in hypoxic normal saline group. The thickened caliber was relieved significantly in hypoxic nitrite group. CONCLUSION:Pulmonary hypertension and right ventricle reconstitution can be relieved by inhalation of sodium nitrite,and can be regulated by the level of NO and H_2S in rats. Above all,inhalation of sodium nitrite may degrade HPH directly or by affecting the externalization and synthesizing of gas signaling molecule indirectly.
ABSTRACT
Objective By using immunohistochemical staining of neuropeptide Y (NPY) and fluorescence of ethylaldehyde acid-induced biomonoamine mediators, to observe the distribution of sympathetic nerve terminals in human cervical capsule tissues, and to compare the two methods for further improvement. Methods Surgically removed joint capsule tissues from C 3~7 vertebrae of 17 cases were treated by paraffin imbedding with NPY immunohistochemical staining and frozen-section with fluorescence staining of ethylaldehyde acid-induced biomonoamine mediators. Slides were preconditioned by 1% KMnO4 and sections 15~20 ?m in thickness were made. The staining was conducted at 100 ℃ for 5 min firstly, and then at 80 ℃ for 2 min. We utilized adrenal glands of rats as positive control. The samples were observed under fluorescence microscope at 380~420 nm excitation wavelengths from a high-voltage mercury light source. Results NPY immunostaining findings indicated bulky positive materials in some arteriolar walls and nerve tracts of the joint capsules; biomonoamine mediators gave off fluorescence in green-yellow color under the induction of ethylaldehyde acid, which presented mostly as reticular or radial finely-broken fibers in vascular walls, basal laminae of the synovial membrane and dense connective tissues. The positive rates of NPY immunohistochemical staining were 70.6% (12/17) at C 3~4 intervertebral segment, 42.9% (6/14) at C 4~5 , 57.1% (8/14) at C 5~6 , and 50.0% (5/10) at C 6~7 , respectively, the total positive rate being 56.4% (31/55). When using the ethylaldehyde acid-induced biomonoamine fluorescence, the positive rates were 70.6% (12/17) at C 3~4 intervertebral segment, 93.8% (15/16) at C 4~5 , 66.7% (10/15) at C 5~6 , and 80.0% (8/10) at C 6~7 , respectively, the total positive rate being 77.6% (45/58). The positive rate was remarkably higher in ethylaldehyde acid-induced biomonoamine fluorescence than in NPY immunohistochemical staining, with statistically significant difference (?2=5.774,P=0016), especially at C 4~5 intervertebral segment (P=0.004). Conclusions Both the two methods can demonstrate the distribution of sympathetic nerve terminals, suggesting the presence of the terminals in human cervical capsule tissues. Modified ethylaldehyde acid-induced biomonoamine fluorescence offers a greater specificity.
ABSTRACT
0 05),but arterial oxygen tension and FEV 1 were elevated obviously (P
ABSTRACT
Objective Estimating the treatment to respiratory failure in acute exacerbation of chronic obstructive pulmonary disease by scores in the form of quantitative assessment.Methods 156 patients with chronic obstructive pulmonary disease with acute exacerbation of respiratory failure in patients in the medical intensive care unit based on the worst value of the calculated APACHEⅡ score were grouped,divided into groups and pairs of oxygen the level of non-invasive positive pressure ventilation group.Based on the worst values calculated by the APACHEⅡ and TISS-28 score within 24 h after admission into MICU selected cases is re-grouped into an effective group of oxygen,BiPAP effective group and invasive ventilation group.Statistics separately for each group of patients with APACHEⅡ score and TISS-28 score range,length of stay.Results The invasive ventilation group APACHEⅡ score(27.44?6.79)and TISS-28 score(28.22?7.90)was significantly higher than the other groups(P0.05),invasive ventilation group and effective group MICU hours of BiPAP have significant difference(P
ABSTRACT
Objective To investigate the clinicopathologic features of GIST. Method Fifty-five GIST cases were collected. Immunohistochemical assays of vimentin, CD117, CD34, S-100, SMA, desmin, NF were used to study the specimen. Results 69% (38/55) of the tumors located in the stomach, 18% (10/55) in the small intestine. Tumors varied greatly in size, ranging from 0.4 to 40 cm (average 6.7 cm). Morphologic criteria of malignancy are tumor size≥5 cm, mitotic rates≥5/50 HPF and ulcer formation and there were significant differences between the benign and the malignant. Immunohistochemical staining results: CD117 positive in 39 cases(71%), CD34 in 45 cases (82%), S-100 in 19 cases (35%), SMA in 12 cases (22%), vimentin in 32 cases (58%), desmin in 6 cases(11%),and NF in 2/4 (50%). All 13 benign cases were alive on the latest follow-up. In 42 cases of malignancy and potential malignancy, 4 developed metastasis, 13 died. Conclusion (1) GIST occur predominantly in middle-aged and older persons.(2) The main criteria of malignancy of GIST are tumor size≥5 cm, mitotic rates≥5/50 HPF and ulcer formation. (3)Whereas it is difficult to identify true leiomyomas/leiomyosarcomars and neuogenic tumors from GIST, immunohistochemical staining is capable of doing this.
ABSTRACT
The specific binding of~(125)INPY to membranes from mouse cerebral cortex was investigated using equilibrium binding and kinetic assay.The membranes were preparated by different—speed centrifugation.The equilibrium binding of~(125)I—NPY to membranes at 37℃ to equilibrium was by 50 minute and showed sharp optimum at PH7.0—7.4.The bound,which can't inhibited by other related peptides,was inhibited by unlabled NPY spe—cifically(IC50=0.4nmoi/L).The binding sites for~(125)I—NPY were sensitive to treatment with tripsin and thiol reagents.Theequilibrium binding of~(125)I-NPY to cerebral cortex at 37℃ was characterized by a Kd value of 0.30—0.40nmol/L and the receptor densities were 0.40—0.45 pmol/mg protein.
ABSTRACT
A simple specific and sensitive radioimmunoassay for ne(?)ropeptide (NPY) in plasma and tissue extracts was developed. There was no appreciable cross-reactivity with related neuropeptides. The minimum detectable NPY in plasma and tissue extracts was 150-200pg/ml and average recovery was 85-90%. Reverse-phase HPLC reveals that chromatographic charecterization of NPY-Li in plasma and tissue extracts was very similar to that of standard NPY.
ABSTRACT
A rapid and simple chromatographic procedure using HPLC-ECD is described for simultaneousdetermination of NE. E. DA. 5-HT with their precursor amino acid (Tyr. Trp) and their main metabolites (HVA. 5-HIAA). Using this assay,eight substrates are measured in cortex, diencephalon and brain stem of mice duing immunological response challenged by SRB6 3 days after challenged, the DA HVA in cortex, NE in diencephalon decrease obviously (p
ABSTRACT
In this study, authors observed and compared the clearances of different molecule weight substances between different dialysis membranes and different hemopurification methods. The results showed that the clearances of BUN by hemodialysis (HD) with cuprophan membrane, hemodiafiltration (HDF) with polysulfone and high flux dialysis (HFD) with polysulfone were all satisfactory. TACurea were all below 50 mg. Hemodialysis with cuprophan could clean out some middle molecule substances (MMS), but not ?2-microglobulin (?2m). Hemodiafiltration with polysulfone had the best clearances of MMS and ?2m. Hemofiltration (HF) with polysulfone had fair clearances of MMS and ?2m, but the clearances of BUN and Cr by HF were not so good. The clearances of MMS and ?2m by high flux dialysis were lower than those of HDF and HF. The clearances of MMS and ?2m by continuous ambulatory peritoneal dialysis (CAPD) at a single time were lower than those of HF, HDF and HFD, but the general clearances of MMS and ?2m by CAPD per week were two to four times higher than those by hemodialysis with cuprophan. CAPD is a choice method for those hospitals where HF or HDF can not be performed.