Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 6 de 6
Filter
Add filters








Language
Year range
1.
Chinese Journal of Applied Clinical Pediatrics ; (24): 928-932, 2018.
Article in Chinese | WPRIM | ID: wpr-696532

ABSTRACT

Objective To explore the clinical features,treatment and prognosis of malignant solid tumors in the digestive tract in children and adolescents. Methods Sixty-five children and adolescents with malignant solid tumors in the digestive tract from January 1997 to June 2017 were selected,who were treated at the Affiliated Cancer Hospital of Zhengzhou University/Henan Cancer Hospital. The tumor site,gender,age,clinical presentations,treatment, follow-up time and their life status by deadline follow-up in 65 children and adolescents were collected respectively, and the clinical features,treatment methods and prognosis were retrospectively analyzed. The follow-up deadline was on December 31,2017. Results The most frequent sites of tumors were liver tumor(36 cases,55. 38%),followed by rectum tumor(11/65 cases,16. 92%),colon tumor(6/65 cases,9. 23%),pancreas tumor(5/65 cases,7. 69%),gas-tric(3/65 cases,4. 62%),esophagus (1/65 cases,1. 54%),gallbladder tumor (1/65 cases,1. 54%),ileum tumor (1/65 cases,1. 54%),and appendix tumor (1/65 cases,1. 54%). The prevalence rate in males and females was 1. 32:1. 00. The age of embryo tumor incidence was smaller,and the age of epithelium cancer incidence was older. The main symptoms included abdominal distension and pain (66. 15%,43/65 cases). Twenty-seven patients (41. 5%, 27/65 cases)was in stageⅣ. Radical and palliative surgery were the main treatment in 50 cases (76. 92%). The 1-year,3-year,5-year overall survival rates were 60. 7%,31. 0%,18. 8%,respectively. The overall survival rate of co-lon and rectal cancer was higher than that of hepatocellular cancer,and the differences were all statistically significant (χ2=6. 268,P=0. 012;χ2=11. 772,P=0. 001). The overall survival rate of patients who received surgery combined with chemoradiotherapy was the longest and those undergoing chemotherapy only was the shortest,but the differences had no statistical significance among 4 groups of sheer surgery,chemotherapy alone,surgery combined with chemothera-py and surgery combined with chemoradiotherapy(all P>0. 05). Conclusion The malignant solid tumors in the di-gestive tract in children and adolescents have a poor prognosis. The unspecific presentation makes the diagnosis diffi-cult. It is very important to diagnose early and treat as soon as possible by the combination of surgery,chemotherapy and radiotherapy to improve the overall survival rate.

2.
Chinese Journal of Applied Clinical Pediatrics ; (24): 208-211, 2017.
Article in Chinese | WPRIM | ID: wpr-510247

ABSTRACT

Objective To detect the expression levels of metallothionein1 H(MT1 H)in children and adoles-cents osteosarcoma serums,and to analyze its relationship with clinicopathological features,and to explore the effect of MT1 H on cell proliferation of osteosarcoma cells and its mechanism.Methods Enzyme -linked immuno sorbent assay (ELISA)was performed to detect the expression of MT1 H in children and adolescents osteosarcoma serums and non-neoplastic disease serums.MT1 H vector was transfected into the osteosarcoma U2OS cells.Reverse transcription -poly-merase chain reaction(RT -PCR)and Western blot were used to detect the expression of the mRNA and protein of MT1 H,respectively.Methylthiazolyldiphenyl -tetrazolium bromide(MTT)was used to detect the cell growth.Western blot was performed to detect the expression of nuclear factor(NF)-κB,and inhibitor of κB (IκB)-αprotein. Results The expressions of MT1 H in osteosarcoma serums and nonneoplastic disease serums was (0.51 ± 0.52)μg/L and (2.17 ±0.78)μg/L,respectively,with a significant difference between the 2 groups(t =-8.966, P <0.05).The expression of MT1 H in stage Ⅰ -ⅡA andⅡB -Ⅲ was (1 .98 ±0.69)μg/L and (2.45 ±0.82)μg/L,respectively,showing a gradual increase depending on clinical staging(t =-2.343,P <0.05).The expressions of MT1 H mRNA and protein were elevated in osteosarcoma U2OS cells after MT1 H vector transfection(all P <0.05). MTT assay showed that,the A value in blank control group,blank vector group,MT1 H vector group were 0.38 ±0.03, 0.36 ±0.03,0.42 ±0.03,respectively,the cell proliferation in the MT1 H vector group was significantly promoted when compared with these in the blank vector group and blank control group(F =4.213,P <0.05)from the third day.West-ern blot showed that,the relative expression of NF -κB in blank control group,blank vector group,MT1 H vector group were 0.56 ±0.05,0.53 ±0.05,0.92 ±0.07,respectively,the relative expression of IκB -αprotein were 0.64 ± 0.06,0.62 ±0.09,0.34 ±0.08,respectively,the expression of NF -κB protein was up -regulated and the expression of IκB -αprotein was down -regulated in the MT1 H vector group when compared with those in the blank vector group and blank control group(F =44.581 ,14.927,all P <0.05).Conclusions The expression of MT1 H is increased in children and adolescents osteosarcoma serums compared with that in nonneoplastic disease serums.The clinical stage is later,the expression of MT1 H is higher.MT1 H promotes cell proliferation through regulating the NF -κB pathway.

3.
Chongqing Medicine ; (36): 4753-4756,4762, 2017.
Article in Chinese | WPRIM | ID: wpr-664331

ABSTRACT

Objective To establish the effect of curcumin on PTX-resistant esophageal cancer cell line EC9706/PTX and to investigate the mechanism of curcumin on the epithelial stromalization (EMT) of EC9706/PTX cells.Methods EC9706/PTX cells were established by medium concentration intermittent method.The drug resistance index and cross resistance were measured by MTT assay.The inhibitory effects of different concentrations of curcumin on EC9706/PTX cell proliferation were detected.The effects of curcumin on the morphological changes,migration and invasion of EC9706/PTX cells were examined by cytostatic staining,scratching and transwell invasion assay.The effects of curcumin on the expression of E-cadherin,N-cadherin,vimentin and fibronectin in EC9706/PTX cells at mRNA and protein levels were detected by fluorescence quantitative PCR and Western blot.The effect of curcumin on the expressions of NF-κB p65 and Snail in EC9706/PTX cells were detected by Western blot.Results The drug resistance index of EC9706/PTX was 28.4,which was cross-resistant to cisplatin and doxorubicin.Curcumin could inhibit the proliferation of EC9706/PTX cells.The migration and invasion of EC9706/PTX cells were significantly decreased under the action of curcumin at 20 μmol/L concentration.Fluorescence quantitative PCR and Western blot analysis showed that the expression of Ecadherin was down-regulated and the expression of N-cadherin was up-regulated,and curcumin reversed this phenomenon.Western blot analysis showed that the expression of NF-κB p65 and Snail protein was enhanced after PTX-resistant generated in EC cell,but curcumin reversed this phenomenon.Conclusion Curcumin can inhibit the proliferation,migration and invasion of EC9706/PTX cells.The mechanism maybe that curcumin inhibits the NF-κB-Snail pathway.

4.
Chinese Journal of Pharmacology and Toxicology ; (6): 296-301, 2014.
Article in Chinese | WPRIM | ID: wpr-445803

ABSTRACT

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

5.
China Oncology ; (12)2006.
Article in Chinese | WPRIM | ID: wpr-548157

ABSTRACT

Background and purpose:More and s’more evidence has demonstrated that DNMT1 was expressed at high levels in many different kinds of human tumor tissues or cells,suggesting that high expression of DNMT1 was closely associated with occurrence and development of tumors.In this study,effect of down-regulation of DNMT1 on cell proliferation and migration ability of esophageal squamous cell carcinoma(ESCC) cell line EC9706 cells was studied and its related mechanism was explored.Methods:Cell proliferation assay was investigated using CCK-8 Kit,cell migration ability was analyzed using Boyden chamber and the expressions of DNMT1 and MMP-2 were detected by Real-time PCR and Western blotting methods.Results:The result of cell proliferation experiment showed that down-regulation of DNMT1 could markedly inhibit cell proliferation in EC9706 cells.After transfection with DNMT1 siRNA,invasiveness and metastasis ability of EC9706 cells displayed an obvious decrease(P

6.
China Pharmacy ; (12)2005.
Article in Chinese | WPRIM | ID: wpr-533929

ABSTRACT

0.05). The main toxicity reactions were myelosuppression,gastrointestinal reactions,peripheral neurotoxicity and most of the patients can suffer that. CONCLUSION:Docetaxel combined with oxaliplatin and capecitabine have good effect on advanced gastric cancer and are less toxic. It can be the main treatment way to cure advanced gastric cancer.

SELECTION OF CITATIONS
SEARCH DETAIL