ABSTRACT
The prevalent ages at onset for Kawasaki Disease (KD) and Epstein-Barr virus (EBV) infection are known to be similar in Korea and Japan. We evaluated the correlation between EBV infection and KD. The antibodies to EBV such as anti-viral capsid antigen (VCA) IgG and IgM, anti-diffuse and restricted early antigen IgG (anti-EADR IgG), and the anti-EBV determined nuclear antigen IgG (anti-EBNA IgG) were examined in 29KD patients at five separate times sequentially during a period of one year, and also in 14 other children with a past history of KD. The results of each group were compared with those of age-matched controls. The positive rates of anti-VCA IgG and IgM at presentation in the KD patients were 41.4% (12/29) and 0% (0/29), respectively. Only one patient was found to be anti-VCA IgM-positive within two months. There were no cases of anti-VCA IgG except one, anti-EADR IgG and anti-EBNA IgG positive to negative seroconversion during the year. The children with a past history of KD showed higher anti-EBNA IgG-positive rates than the controls (p=0.04). There was no difference in the seropositive rates of the antibodies to EBV, cytomegalovirus, herpes simplex virus and herpes zoster virus. In conclusion, children with KD were noted to have normal immune responses to EBV infection. Children with a past history of KD seemed to be infected with EBV at a later age than children with no history of KD.
Subject(s)
Male , Infant , Humans , Female , Child, Preschool , Mucocutaneous Lymph Node Syndrome/virology , Korea , Immunoglobulins/metabolism , Immunoglobulin M/chemistry , Immunoglobulin G/chemistry , Herpesvirus 4, Human/metabolism , Epstein-Barr Virus Infections/complications , Antibodies, Viral/chemistry , Age of OnsetABSTRACT
PURPOSE: Recently, many studies on febrile convulsions again suggest that the degree of pyrexia may be related to the recurrence of febrile convulsions. In a previous study, we advocated that a low body temperature during the initial febrile convulsions is associated with an increase of recurrent febrile convulsions. Therefore, we have expanded the study by including 246 febrile convulsions during 6 years and investigated risk factors and especially the relationship between pyrexia and the recurrence rates. METHODS: Children with febrile convulsions were divided into three groups according to the degree of fever. Group I showed body temperatures higher than 39.5 degrees, group II from 38.5 to 39.4 degrees, and group III lower than 38.4 degrees. Then, we analyzed the recurrence rates of febrile convulsions. RESULTS: There occurred recurrent febrile convulsions in 19(41.3%) children with family history of febrile convulsion and 5(35.7%) children whose first-degree relatives diagnosed epilepsy. In group I, 5(13.5%) infants aged 6-18 months and 5(19.2%) aged 19-30 months had recurrent febrile convulsions. In group II, 22(36.1%) infants aged 6-18 months and 8(24.2%) aged 19-30 months had recurrent febrile convulsions. In group III, 21(42.0%) infants aged 6-18 months and 8(38.1%) aged 19-30 months had recurrent febrile convulsions. CONCLUSION: Children with a lower degree of pyrexia and also younger age at the onset of the first febrile convulsion were more susceptible to recurrent febrile convulsios than otherwise.
Subject(s)
Child , Humans , Infant , Body Temperature , Epilepsy , Fever , Recurrence , Risk Factors , Seizures, FebrileABSTRACT
PURPOSE: Hyponatremia may be common in febrile convulsions and lower the threshold for febrile convulsions. We evaluated the association between hyponatremia and febrile convulsions and also examined the effect of hyponatremia on the recurrence of convulsions during the same febrile illness. METHODS: Serum sodium levels were measured from 98 children with febrile convulsions, among whom there were 21 recurrent and 77 non-recurrent patients during the same febrile illness. Also, as a control group, we selected 32 febrile and 48 non-febrile children, who did not have febrile convulsions. Results were analyzed by Student's t-test and logistic regression. RESULTS: The average serum sodium level in febrile convulsions was 135.5+/-3.7 mEq/ L, which was significantly lower than 138.7+/-3.2 mEq/L of febrile children and 138.0+/-3.0 mEq/L of non-febrile children in the control group(P<0.05). The average serum sodium level in recurrent febrile convulsions during the same febrile illness was 133.1+/-4.1 mEq/ L, which was significantly lower than 136.1+/-3.3 mEq/L in non-recurrent febrile convulsions(P<0.05). CONCLUSION: The serum sodium levels of the patients with febrile convulsions were significantly lower than those of the children in the control group. Also, the lower the sodium levels were, the higher recurrent febrile convulsions during the same febrile illness occurred.
Subject(s)
Child , Humans , Hyponatremia , Logistic Models , Recurrence , Seizures , Seizures, Febrile , SodiumABSTRACT
PURPOSE: Studies gave conflicting results as to the association between febrile seizures(FSs) and IL1B promoter polymorphisms. In the present study, to determine whether or not the function-related two single nucleotide base C/T biallelic polymorphisms in the promoter region at positions -31 and -511 of the IL1B gene are associated with susceptibility to FSs, the frequencies of the polymorphisms were investigated in children with FSs and GEFS+, and normal control subjects. METHODS: 72 FSs, 23 GEFS+ and 174 healthy control subjects were selected throughout a collaborative study of Catholic Child Neurology Research Group. IL1B promoter -31 C/T and -511 C/T genotyping was performed by means of PCR-restriction fragment length polymorphism. RESULTS: The distribution of IL1B -31 genotypes and the frequencies of allele in children with FSs and GEFS+, and healthy control subjects were not significantly different. The distributions of IL1B -31 genotypes(CC, CT, TT) are 22.2%, 50%, and 27.8% in children with FSs, 21.7%, 43.5% and 34.8% in children with GEFS+, and 27.6%, 49.3% and 24.1% in healthy control subjects. The distribution of IL1B -511 genotypes and the frequencies of allele in children with FSs and GEFS+, and healthy control subjects were not significantly different. The distributions of IL1B -511 genotypes(CC, CT, TT) are 23.6%, 47.2%, and 29.2% in children with FSs, 26.1%, 39.1% and 34.8% in children with GEFS+, and 27.6%, 49.3% and 24.1% in healthy control subjects. CONCLUSION: Theses data suggest that genomic variations of IL1B promoter might not be one of the susceptibility factors for FSs in the Korean population.
Subject(s)
Child , Humans , Alleles , Genotype , Interleukin-1beta , Neurology , Promoter Regions, Genetic , Seizures, FebrileABSTRACT
PURPOSE: In order to elucidate the actual mechanism and the optimal concentration of Lamotrigine(LTG) that suppresses epileptiform discharges, we observed epileptiform discharges from hippocampal slices of immature rat in 4-aminopyridine(4-AP) added Mg2+ - free medium of artificial cerebrospinal fluid(aCSF) with various LTG concentrations. METHODS: We divided 19-23 day-old Sprague-Dawley rats into 4 groups; control group(n=12) and 3 LTG groups depending on the concentrations of LTG such as 400 (n=9), 800(n=7), and 1,000(n=8) microM. The rats were anesthetized and their brains were taken, soaked in aCSF(NaCl 125 mM, KCl 2.5 mM, NaH2PO4 2 mM, MgSO4 1.25 mM NaHCO3 25 mM, CaCl2 2 mM, Glucose 10 mM, pH 7.3-7.4). And then the brains were cut into 400 microm hippocampal slices by a vibratome. The slices of control group were soaked in 200 microM 4-AP added Mg2+ -free medium of aCSF for 1 hour, and then extracellular recordings were performed in hippocampal CA1 pyramidal region. The slices of LTG groups were soaked in the solution containing 400, 800, and 1,000 microM LTG, then extracellular recordings were performed. RESULTS: Interictal discharges were observed in all the control and the LTG groups. The latency to the first interictal discharges after 4-AP addition was 52.7+/-26.9 sec in control group, but was 225.0+/-28.2 sec in 800 microM and 322.1+/-116.4 sec in 1,000 microM group of LTG(P<0.05). The duration of interictal discharges was 64.6+/-35.6 sec in control group, but was the shortest in 800 microM group of LTG at 39.3+/-12.6 sec. Ictal discharges were observed in all of control and 400 microM group, but the frequency was decreased as the concentration of LTG increases, 57.1% in 800 microM, 12.5% in 1,000 microM group. The latency to ictal discharge after 4-AP addition was 142.1+/-52.6 sec in control group, but increased as the concentration of LTG increases, 304.4+/-84.5 sec in 400 microM group and 689.8+/-213.1 sec in 800 microM group(P<0.05). The duration of ictal discharges was 1,534.7/-339.3 sec in control group, but decreased as the concentration of LTG increases, it was 126.5+/-76.1 sec in 800 microM group(P <0.05) and 42 sec in 1,000 microM group. CONCLUSION: The antiepileptic effects of LTG were most significant when the concentration, inhibiting epileptiform discharges induced by 4-AP and Mg2+ -free medium in hippocampal slices of immature rats, was 800 microM or higher. Although the basic pharmacologic mechanism of LTG is the inhibition of sodium channel, it may also work on potassium channel at higher concentrations.
Subject(s)
Animals , Rats , 4-Aminopyridine , Brain , Glucose , Hydrogen-Ion Concentration , Potassium Channels , Rats, Sprague-Dawley , Sodium ChannelsABSTRACT
PURPOSE: Febrile seizures are characterized by a heterogenous phenotype segregating as an autosomal dominant trait with incomplete penetrance. Mutations in GABRG2 gene were identified in two families with generalized epilepsy and febrile seizures plus (GEFS+) and with absence epilepsy and febrile seizures(FSs). The present study assessed the role of GABRG2 gene in FSs and GEFS+ of the Korean population. METHODS: 66 FSs, 20 GEFS+ and 94 healthy control subjects were selected throughout a collaborative study of Catholic Child Neurology Research Group. The SNP211037 of GABRG2 was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. Genotypes and allelic frequencies for GABRG2 gene polymorphism in three groups were compared. RESULTS: The number of individuals with the GABRG2(SNP211037)-C/C genotype in patients with FSs was significantly greater compared with that in healthy control subjects and the GABRG2(SNP211037)-C allele frequency in patients with FSs was significantly higher than that in healthy control subjects. The odds ratio for developing FSs in individuals with the GABRG2(SNP211037)-CC genotype was 5.96 compard with individuals with the GABRG2(SNP211037)-T/T genotype. In contrast, the GABRG2 (SNP211037) gene in GEFS+ and control groups was not significantly different. CONCLUSION: Theses data suggest that genomic variations of GABRG2 might be one of the susceptibility factors for FSs in the Korean population.
Subject(s)
Child , Humans , DNA , Epilepsy, Absence , Epilepsy, Generalized , Gene Frequency , Genotype , Neurology , Odds Ratio , Penetrance , Phenotype , Polymorphism, Single Nucleotide , Seizures, FebrileABSTRACT
PURPOSE: The goal of the present study was to investigate the effects of 4-aminopyridine(4-AP) on the excitability of visual cortex, observe the induction of epileptiform activity and define the characteristics of spontaneous activity. METHODS: We divided 19 to 23-day-old Sprague-Dawley rats into 3 groups by the concentration of 4-AP:5(n=10), 50(n=11), and 100(n=12) microM. The slices from their brains were incubated in artificial CSF for 1 hour, and then extracellular recordings were performed. RESULTS: Spontaneous epileptiform activities were observed in 50 and 100 microM 4-AP groups. The latencies of interictal epileptiform activity were 7.8+/-1.1 and 5.8+/-0.9 min, the frequencies 1.8+/-0.2 and 24.1+/-6.6 min-1, the amplitudes 0.7+/-0.1 and 2.8+/-0.5 mV, and the durations 238.0+/-57.8 and 242.2+/-70.0 ms in 50 and 100 microM 4-AP groups respectively. The latencies of ictal epileptiform activity were 21.0+/-9.8 and 6.7+/-2.3 min, the frequencies 116.2+/-46.7 and 193.7+/-26.4/event, the amplitudes 3.1+/-0.8 and 2.8+/-0.9 mV, and the durations 26.9+/-27.6, 35.2+/-12.6 s in 50 and 100 microM 4-AP groups respectively. CONCLUSION: 4-AP showed increased excitability in the visual cortex and induced interictal and ictal spontaneous epileptiform activity. This induction was decreased by D- AP5 or CNQX. Those results suggest that both types of inotropic excitatory amino acid receptors are overactivated and contribute to seizure initiation and propagation.
Subject(s)
4-Aminopyridine , 6-Cyano-7-nitroquinoxaline-2,3-dione , Brain , Rats, Sprague-Dawley , Receptors, Glutamate , Seizures , Visual CortexABSTRACT
PURPOSE: Treatment efficacy for children with speech and language delay has been the subject of considerable debate in recent years. We evaluated the clinical features of children with delayed speech and language and their prognoses according to their etiologies after 6 months of speech and language therapy. METHODS: From January, 2000 to March, 2004, we retrospectively reviewed 56 children with speech and language delay who were administered speech and language therapy for 6 months in Uijongbu St. Mary's Hospital. RESULTS: Of 56 cases, the proportion of developmental language disorder was 66.1 percent, structural malformation 19.6 percent, mental retardation 12.5 percent, hearing defect 1.8 percent. The ratio of male to female was 4.6: 1 and the most frequent age group was over 47 months. The mean age of first spontaneous words with useful meaning was 15.9 months. The mean gestational age of the subjects was 39.8 weeks. The proportion of full-term infants was 96.4 percent and of premature infants was 3.6 percent. As for the birth order, the proportion of the first baby was 51.8 percent, the one of second babies it was 42.9 percent, and percent of third babies it was 7.1 percent. After 6 months of language intervention, 32.4 percent of patients with developmental language disorder showed normal linguistic development. All the patients with mental retardation showed sustained language and speech delay. As for the patients with structural malformations, five out of 11 patients showed normal linguistic development. CONCLUSION: The relatively advanced old age of majority of participants in this study suggests the necessity of screening test for language delay in this local community.
Subject(s)
Child , Female , Humans , Infant , Infant, Newborn , Male , Birth Order , Gestational Age , Hearing , Infant, Premature , Intellectual Disability , Language Development Disorders , Language Therapy , Linguistics , Mass Screening , Prognosis , Retrospective Studies , Treatment OutcomeABSTRACT
PURPOSE: Topiramate(TPM), one of the newest antiepileptic drugs, has been prescribed not only to refractory partial seizures but to generalized tonic-clonic seizures. However, its action mechanisms are not well understood and the optimal dose of antiepileptic efficacy in animal seizure models is not determined yet. In order to elucidate the action mechanisms and the optimal concentration of TPM that suppresses epileptic discharges, we observed ictal and interictal discharges from immature rat hippocampal slices in Mg(2+)-free, and 4-aminopyridine(AP) added artificial CSF with various TPM concentrations. METHODS: We divided Sprague-Dawley rats of 19 to 23 days old into 5 groups; namely, a control group(n=12) and 4 TPM groups according to the concentration of TPM, 6 (n=11), 20(n=7), 60(n=10), and 200(n=14) micrometer. The rats were anesthetized and their brains were taken, and soaked in artificial CSF(NaCl 125 mM; KCl 2.5 mM; NaH2PO4 2 mM; MgSO4 1.25 mM; NaHCO3 25 mM; CaCl2 2 mM, Glucose 10 mM, and pH 7.3-7.4). Then the brains were cut into 400 micrometer hippocampal slices by a vibratome. The slices of the control group were soaked in 200 micrometer 4-AP added Mg(2+)-free medium for 1 hour, and then extracellular recordings were performed in the hippocampal CA1 pyramidal region. The slices of TPM groups were soaked in solutions containing 6, 20, 60, 200 micrometer TPM, and then extracellular recordings were performed. RESULTS: Interictal discharges were observed in the control group and 6, 20 micrometer groups but the frequency decreased as the concentration of TPM increased:90% in 60 micrometer group, and 35.7% in 200 micrometer group. And the amplitude of TPM groups was much smaller than that of the control group. The latency to the first interictal discharge after 4-AP addition was 52.7+/-7.5 sec in the control group, 290.2+/-78 sec in 60 micrometer group, and 568+/-113.1 sec in 200 micrometer group. Duration of the interictal discharge was 64.6+/-10.3 sec in the control group, but was prolonged to 141+/-38.1 sec in 60 micrometer group(P<0.05). Ictal discharges were observed in all of the control and 6 micrometer groups, but the frequency decreased as the concentration of TPM increased:55.6% in 60 micrometer, and 28.6% in 200 micrometer groups. The amplitude of the TPM groups was much smaller than that of the control group. The latency to ictal discharges after 4-AP addition was 141+/-15.2 sec in the control group, but increased as the concentration of TPM increased:431.8+/-57.4 sec in 60 micrometer, and 627.8+/-143.5 sec in 200 micrometer group(P<0.05). The duration of ictal discharges was 1,534.7+/-97.9 sec in the control group, but decreased as the concentration of TPM increased, the shortest in 60 micrometer group, 155.2+/-65.5 sec(P<0.05). Status epilepticus was seen in 58.3% of the control and 27.2% of 6 microM groups. CONCLUSION: TPM suppresses the frequency, latency, and duration of epileptiform discharges induced by Mg(2+)-free, and 4-AP added artificial CSF in immature rat hippocampal slices, starting from 20 micrometer and reaching the maximal effect at over 60 micrometereter. This finding is presumably due to TPM enhancing of GABA receptor currents and/or K+ channel conductance in response to TPM.
Subject(s)
Animals , Rats , 4-Aminopyridine , Anticonvulsants , Brain , Glucose , Hydrogen-Ion Concentration , Rats, Sprague-Dawley , Receptors, GABA , Seizures , Status EpilepticusABSTRACT
We evaluated the inflammatory indices according to the fever duration in children with Kawasaki disease (KD), and determined duration when the inflammatory processes in KD reach their peak. Children with KD (n=152) were classified into 7 groups according to fever duration: at the third day or earlier (n=20), fourth (n=33), fifth (n=46), sixth (n=15), seventh (n=15), eighth (n=9), and at the ninth day or later after fever onset (n= 14). The levels of various laboratory indices were determined 3 times: before, 24 hr and 7 days after intravenous immunoglobulin administration (2 g/kg). WBC and neutrophil counts, and C-reactive protein level were the highest at the sixth day. Levels of hemoglobin, albumin, and high density lipoprotein cholestrol were the lowest at the sixth day. Although these indices were not significant statistically between groups, the indices showed either bell-shaped or U-shaped distribution of which peak or trench were at the sixth day. These findiugs showed that the inflammatory processes in KD reach peak on the sixth day of fever onset. This finding is important because a higher single-dose intravenous immunoglobulin treatment before the peak day may help reduce the coronary artery lesions in KD.
Subject(s)
Child, Preschool , Female , Humans , Infant , Male , Coronary Vessels/pathology , Fever/blood , Immunoglobulins, Intravenous/therapeutic use , Inflammation/blood , Mucocutaneous Lymph Node Syndrome/blood , Time FactorsABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Homozygote , Introns , Neurology , Polymorphism, Single Nucleotide , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Homozygote , Introns , Neurology , Polymorphism, Single Nucleotide , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: The greatest concern for children with febrile seizures is not only the possibility of epilepsy, but also unprovoked seizures. The present study examined the risk and predictors of unprovoked seizures. Study factors include three identified factors of unclear significance-family history of febrile seizures and the number of recurrent febrile seizures and two new factors that are important predictors - the height of temperature and the duration of fever prior to the initial febrile seizure. METHODS: Children(n=333) between 6 months and 5 years of age with first febrile seizures were reviewed to determine the risk and predictors of unprovoked seizures for 10 years. Children with the central nervous system infections(meningitis or encephalitis), past history of febrile seizures or epilepsies were excluded. RESULTS: 10(43.5%) of 23 children with neurodevelopmental abnormalities had epilepsies. 12(10%) of 120 children with complex febrile seizures had epilepsies. 17(6.6%) of 256 children without family history of febrile seizures in 1 degrees relative and 8(10.4%) of 77 children with family history of febrile seizures in 1 degrees relative had epilepsies. CONCLUSION: In our results, there exists a strong association between unprovoked seizures and complex features in neurodevelopmentally abnormal children compared with normal children.
Subject(s)
Child , Humans , Central Nervous System , Epilepsy , Fever , Seizures , Seizures, FebrileABSTRACT
PURPOSE: The greatest concern for children with febrile seizures is not only the possibility of epilepsy, but also unprovoked seizures. The present study examined the risk and predictors of unprovoked seizures. Study factors include three identified factors of unclear significance-family history of febrile seizures and the number of recurrent febrile seizures and two new factors that are important predictors - the height of temperature and the duration of fever prior to the initial febrile seizure. METHODS: Children(n=333) between 6 months and 5 years of age with first febrile seizures were reviewed to determine the risk and predictors of unprovoked seizures for 10 years. Children with the central nervous system infections(meningitis or encephalitis), past history of febrile seizures or epilepsies were excluded. RESULTS: 10(43.5%) of 23 children with neurodevelopmental abnormalities had epilepsies. 12(10%) of 120 children with complex febrile seizures had epilepsies. 17(6.6%) of 256 children without family history of febrile seizures in 1 degrees relative and 8(10.4%) of 77 children with family history of febrile seizures in 1 degrees relative had epilepsies. CONCLUSION: In our results, there exists a strong association between unprovoked seizures and complex features in neurodevelopmentally abnormal children compared with normal children.
Subject(s)
Child , Humans , Central Nervous System , Epilepsy , Fever , Seizures , Seizures, FebrileABSTRACT
PURPOSE: We evaluated the effects of intravenous immunoglobulin(IVIG) on level of laboratory parameters examined serially according to the existence of coronary artery lesions in children with Kawasaki disease. METHODS: Children with Kawasaki disease(n=63), treated with IVIG at a dose of 2.0 g/kg, were classified as a group with coronary artery lesions(CALs+ group, n=9) or a group without coronary artery lesions(CALs- group, n=54). Levels of various laboratory parameters were determined three times during admission; before, 24 hrs after and 7 days after IVIG administration. RESULTS: There were no significant differences in laboratory parameters performing at, before and 7 days after IVIG administration. However WBC and neutrophil counts, and CRP were significantly higher, and the level of albumin was significantly lower at 24 hrs after IVIG administration. CONCLUSION: Approximately 15% of patients with Kawasaki disease showed CALs in the acute stage. Kawasaki disease patients with CALs were associated with persistent elevated levels of inflammatory parameters including WBC count, neutrophil count and CRP examined 24 hours after IVIG administration.
Subject(s)
Child , Humans , Coronary Vessels , Immunoglobulins , Immunoglobulins, Intravenous , Mucocutaneous Lymph Node Syndrome , NeutrophilsABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Electroencephalography , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Neurology , Phenotype , Polymerase Chain Reaction , Seizures , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: A part of seizure disorders, hemosiderin deposits are noted in epileptogenic lesions cytopathologically and iron status may affect the seizure threshold. To investigate this possibility, measures of iron sufficiency were evaluated. METHODS: Children between 6 months and 5 years of age with febrile illnesss with (n=45) or without simple febrile seizures(n=50) were eligible for study. Children with the central nervous system(meningitis or encephalitis) infection, developmental delay, neurologic deficit, or past history of febrile seizures were excluded. RESULTS: The hemoglobin level was 11.99+/-0.96 gm/dL in the febrile seizure and 11.44+/-1.6 gm/dL in the control group. The mean corpuscular volume was 77.9+/-6.2 fL in the febrile seizure group and 74.6+/-10.5 fL in the control group. The mean corpuscular hemoglobin was 26.8+/-2.1 pg in the febrile seizure group and 25.4+/-3.6 pg in the control group. The platelet count was 348.6+/-141.4(x10(9)/L) in the febrile seizure group and 382.3+/-107.3(x10(9)/L) in the control group. The ferritin was 27.5+/-20.2 mg/L in the febrile seizure group and 22.5+/-15.6 mg/L in the control group. CONCLUSION: A relationship between iron deficiency and a reduced risk of febrile seizures is consistent with the study hypothesis that iron deficiency may thereby raise the febrile seizure threshold. Therefore, the effects of antioxidants on the frequency of febrile seizures could be evaluated to test this hypothesis more directly. Studies using iron chelators would be necessary to delineate these possible effects.
Subject(s)
Child , Humans , Anemia , Anemia, Iron-Deficiency , Antioxidants , Chelating Agents , Epilepsy , Erythrocyte Indices , Ferritins , Hemosiderin , Iron , Neurologic Manifestations , Platelet Count , Seizures , Seizures, FebrileABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Electroencephalography , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Neurology , Phenotype , Polymerase Chain Reaction , Seizures , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: A part of seizure disorders, hemosiderin deposits are noted in epileptogenic lesions cytopathologically and iron status may affect the seizure threshold. To investigate this possibility, measures of iron sufficiency were evaluated. METHODS: Children between 6 months and 5 years of age with febrile illnesss with (n=45) or without simple febrile seizures(n=50) were eligible for study. Children with the central nervous system(meningitis or encephalitis) infection, developmental delay, neurologic deficit, or past history of febrile seizures were excluded. RESULTS: The hemoglobin level was 11.99+/-0.96 gm/dL in the febrile seizure and 11.44+/-1.6 gm/dL in the control group. The mean corpuscular volume was 77.9+/-6.2 fL in the febrile seizure group and 74.6+/-10.5 fL in the control group. The mean corpuscular hemoglobin was 26.8+/-2.1 pg in the febrile seizure group and 25.4+/-3.6 pg in the control group. The platelet count was 348.6+/-141.4(x10(9)/L) in the febrile seizure group and 382.3+/-107.3(x10(9)/L) in the control group. The ferritin was 27.5+/-20.2 mg/L in the febrile seizure group and 22.5+/-15.6 mg/L in the control group. CONCLUSION: A relationship between iron deficiency and a reduced risk of febrile seizures is consistent with the study hypothesis that iron deficiency may thereby raise the febrile seizure threshold. Therefore, the effects of antioxidants on the frequency of febrile seizures could be evaluated to test this hypothesis more directly. Studies using iron chelators would be necessary to delineate these possible effects.
Subject(s)
Child , Humans , Anemia , Anemia, Iron-Deficiency , Antioxidants , Chelating Agents , Epilepsy , Erythrocyte Indices , Ferritins , Hemosiderin , Iron , Neurologic Manifestations , Platelet Count , Seizures , Seizures, FebrileABSTRACT
A 4-year-old boy showed two episodes of encephalitis/encephalopathy involving disturbed consciousness, convulsion, and paresis associated with the elevated levels of protein and no pleocytosis of the cerebrospinal fluid. MRI studies of the brain revealed symmetrical lesions in the brain stem and thalamus at the first episode, and their sizes were regressed. The lesions were enlarged to the previous size in the second episode. These episodes were not followed by an elevation of the anti-viral antibody titer. In the second episode, intravenous methylprednisolone therapy and intravenous immunoglobulin therapy were introduced.