ABSTRACT
ObjectiveTo investigate the association between serum level of osteopotin(OPN) and disease activity of rheumatoid arthritis (RA) patients, and explore the importance of OPN in the pathogenesis of interstitial lung disease (ILD) in RA. MethodsSixty-five RA patients and 20 healthy controls were pros-pectively enrolled. RA patients were divided into active group(n=43) and inactive group(n=22), and ILD groups (n=24) and non-ILD group (n=41). Enzyme-linked immunosorbent assay (ELISA) was used to detect the serum levels of OPN in patients with RA and healthy controls, and the relationship between OPN and other clinical and laboratory findings were analyzed.Results① Serum OPN tended to be significantly higher in RA patients (median, 18.0 ng/ml) than in the healthy controls (median, 14.3 ng/ml), P<0.01; ②The serum level of OPN in RA patients showed a significant positive correlation with the course of disease, numbers of tender joints , ESR and CRP, but no positive relationship was found in number of swollen joints; ③ The serum level of OPN was significantly higher in RA-ILD patients(median, 20.0 ng/ml) than that in non-lLD (median, 17.0 ng/ml, P<0.05). And there was remarkable negative correlation between the concentration of serum OPN and the value of PaO2, but no association was found with pulmonary function %VC and %DLCO. ④ Compared with the non-ILD group, the ILD group had more active disease in terms of tender joint counts and swollen joint counts, ESR, CRP(P<0.01) and the serum titer of RF-IgM,(P<0.05). ConclusionOPN plays a role in the pathogenesis of RA and is related to the disease activity. It may serve as an active disease inflammatory marker of RA . OPN may be involved in the pathogenesis of RA related ILD and is associated with the severity of pulmonary damage.
ABSTRACT
Objective To detect pathologic fungi existed in experimental or clinical specimens. Methods A hot initiated polymerase chain reaction (PCR) based method with a set of universal fungus specific primers that are capable of detecting a wide range of medically important fungi is developed in this paper. Such primers allow specific amplification of fungal DNA but not other eukaryotes or prokaryotes. The gene sequences are:①AACTTAAAGGAATTGACGGAAG;②GCATCACAGACCTGTTATTGCCTC. Results A 310bp product was successfully amplified from all 42 strains of 23 fungal species studied, and from 22 culture proved clinical specimens within 3 hours, but not from any strains of other microbes and human cells. This detection system is of high sensitivity. Conclusion This highly universal primer system in combinaition with highly specific hot initiated PCR might be used in the detection of medically important fungi in experimental or clinical specimens.
ABSTRACT
Objective To explore the pathogenic relationship between cell surface hydrophobicity (CSH) and adhesion of Cryptococcus neoformans (C.neoformans) to host cells. Method Some drugs and chemical agents were used to pre treat the yeast to observe the impact of iatrogenic factors on CSH, adhesion to host cells and capsule of the yeasts which were treated pretreated with low concentration of drugs and chemical agents for short duration in vitro. Results The results showed that both amphotericin B (AmB) and fluconazole (FCZ) decreased the adhesion of the yeasts, and caused vasiation of CSH. Ampicillin (AMP) had little influence on CSH and adhesion of the yeasts to host cells, but it caused characteristic ultrastructural changes of outer wall of yeasts and acapsulated changes which were reversible as AmB did. FCZ produced a different ultrazstructural change of the yeast′s wall and capsulated change. The chemical agents, such as PHA, ConA, fucose, mercaptoethanol and trypsin decreased CSH and adhesion level of the yeast while lectin increased adhesion level. Conclusion The above data suggest that there is no significant relationship among CSH, adhesion to host cells and the capsule of C.neoformans which are three independent biologic features of the cell wall surface of yeasts.