ABSTRACT
Objective To investigate the high-risk behaviors related to acquared immune deficiency syndrome/sexually transmitted disease (AIDS/STDs) infection among fishermen in Lv-si harbor,Jiangsu province.Methods A cross-sectional study was designed to investigate the research participants' demographic characteristics,high-risk behaviors that related to AIDS/STDs.Logistic regression was performed to measure the associations between potential risk factors and reported potential high-risk sexual behavior.Results 817 fishermen participated in the study and casual or commercial sex activities appeared to be the main high-risk behavior for AIDS/STDs infection in the target population.The rates of casual and commercial sex reported were 18.1% and 28.9% among fishermen.Risk factors associated with AIDS/STDs related high-risk behaviors among fishermen were high mobility (OR=1.516,P=0.038),higher lifetime sex frequency (OR=1.422,P=0.002)and unmarried status ( OR =7.527,P=0.014).Protective factors against high-risk behaviors were low intake of alcohol (OR=0.803,P=0.053),negative STD history (OR=0.268,P=0.001 ),age of initial sexual intercourse at or older than 22 years (OR =0.440,P=0.000) of age,as well as negative attitude toward multiple sexual parmers (OR=0.662,P=0.023 ) and legitimation for commercial sex (OR=0.612,P=0.007).Conclusion There were risk behaviors of AIDS/STDs in those infected fishmen.Casual and commercial sex were common high-risk behaviors.
ABSTRACT
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.