ABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Homozygote , Introns , Neurology , Polymorphism, Single Nucleotide , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: 22 GEFS+ and 62 FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. The exon 9 region of SCN1A was screened by DHPLC. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: A total 84 individuals(22 GEFS+ and 62 FSs) was screened for mutations. Among 22 GEFS+ and 62 FSs patients, five and forty nine showed simple FSs, and seventeen and thirteen had complex FSs. 0% and 8.3% were younger than 12 months old, 22.7% and 46.8% were between 12 and 35 months old, 18.2% and 41.9% were between 36 and 83 months old, and 59.1% and 0% were older than 84 months old. The ratios of male to female were 1.75:1 and 1.82:1. Mutational analysis detected no mutation of SCN1A. Mutational analysis detected eleven silent exonic polymorphisms at G1212A in exon 9 and forty two polymorphisms on intron 9, and 23 intron A/As in 73 homozygote samples. There were no significant differences in allelic frequencies(G/G intron A/A or G/G, G/G intron G/A, G/A intron G/A, reported G/A) of G1212A in SCN1A-exon 9 between the patients with GEFS+ and FSs(31.8% vs. 32.3%, 54.5% vs. 54.8%, 9% vs. 6.5%, 4.5% vs. 6.5%). CONCLUSION: Although our study demonstrated that SCN1A is not frequently involved in GEFS+ and FSs, further systemic research would be necessary.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Homozygote , Introns , Neurology , Polymorphism, Single Nucleotide , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.
Subject(s)
Child , Child, Preschool , Female , Humans , Infant , Male , DNA , Electroencephalography , Epilepsies, Myoclonic , Epilepsy , Epilepsy, Generalized , Exons , Neurology , Phenotype , Polymerase Chain Reaction , Seizures , Seizures, Febrile , Sodium ChannelsABSTRACT
PURPOSE: Febrile seizures affect 2-5% of all children younger than 6 years old. A small proportion of children with febrile seizures later develop epilepsy. Muations in the voltage-gated sodium channel subunit gene SCN1A have been associated with febrile seizures(FSs) in autosomal dominant generalized epilepsy with febrile seizures plus (GEFS+) families and severe myoclonic epilepsy of infancy. The present study assessed the role of SCN1A in familial typical FSs. METHODS: Forty-eight familial FSs were selected throughout a collaborative study of Catholic Child Neurology Research Group. To identify unknown mutations, regions containing the exons for SCN1A gene was performed with two primer(Foward GGAGGGTGAGACGCTGACTC, Reverse CACCTGGAGCTCCCCAGCTG) by touchdown PCR method, and to identify known mutations, regions containing exons of the SCN1A gene were amplified by PCR using suitable primer sets. Ten reported mutations of SCN1A were screened by SNaPshot method. DNA fragments showing variant chromatograms were subsequently sequenced. RESULTS: Among 48 FS patients, thirty(62.5%) showed simple FSs, and eighteen(37.5 %) had complex FS+. Three patients(6.3%) were younger than 12 months old, twenty- nine(60.4%) between 12 and 36 months old, and sixteen(33.3%) older than 36 months old. The ratio of female to male was 0.66:1.0. In the phenotypes of FSs, forty-five patients (93.8%) had generalized tonic-clonic seizures, one patient(2.1%) myoclonic seizures and two patients(4.2%) atonic seizures. In EEG findings of FSs, thirty-eight(79.2%) patients had normal findings, and ten(20.9%) patients had mild aspecific abnormalities. Mutational analysis detected no mutations of SCN1A. CONCLUSION: Our study demonstrated that SCN1A is not frequently involved in common FSs and sugggested any involvement of specific FS genes.