Incidence of Overactive Bladder in Benign Prostatic Hyperplasia and the Efficacy of Combination Therapy of Alpha Blocker with Tolterodine / 대한비뇨기과학회지

PURPOSE: The incidence of overactive bladder (OAB) and the efficacy of alpha blocker and tolterodine combination therapy were examined in patients with symptomatic benign prostatic hyperplasia (BPH). MATERIALS AND METHODS: Between March 2001 and December 2001, 144 BPH patients were subdivided into those with BPH, or BPH with OAB, based on urodynamic studies. All patients were treated with alpha blockers for 3 months. Patients with no symptomatic improvement were treated with alpha blockers and tolterodine for 2 months. An increase in the International prostate symptom scores (IPSS) of more than 3 points after medication was considered an improvement, but if not, as a failure. RESULTS: Of the 144 patients, 76 (53%) had BPH and 68 (47%) had BPH with OAB. The patients with BPH and OAB were older (p<0.05), but no differences were observed in the serum creatinine, IPSS, prostate volume, maximum flow rate or post-void residual urine (PVR) between the 2 groups. After 3 months treatment with alpha blockers, 79% (60/76) of the BPH and 35% (24/68) of the BPH with OAB patients had improved (p<0.05). Of the patients showing no improvement, 38% (6/16) with BPH and 73% (32/44) with BPH and OAB showed improvement after the addition of tolterodine. CONCLUSIONS: The combination therapy was more effective than alpha blockers alone in the treatment of patients with coexisting BPH and OAB. We recommend identifying these patients with an initial urodynamic study, which allows for the appropriate management and identification of those patients that may benefit from a more invasive treatment.

Effects of Epidermal Growth Factor, Basic Fibroblast Growth Factor and Keratinocyte Growth Factor on PSA Secretion and PSA mRNA Expression in LNCaP Prostate Cancer Cell Line / 대한비뇨기과학회지

PURPOSE: In order to characterize the effects of growth factors (EGF, bFGF, KGF) on the regulation of the PSA secretion and the PSA mRNA expression of androgen- dependent LNCaP prostate cancer cell line in serum-free conditions. MATERIALS AND METHODS: LNCaP cells at a concentration of 1x104cells/well, suspended in T-medium containing 2% TCM, were seeded in 24 well plates and were exposed to four different concentrations of these growth factors to evaluate the molecular basis of PSA secretion. Cell numbers were evaluated by crystal violet assay on day 5. PSA concentrations in conditioned medium were determined on day 5, and PSA/cell number was also calculated to measure net PSA secretion per cell. PSA mRNA expression of LNCaP was assessed by RT-PCR and Northern blot analysis on day 5. RESULTS: bFGF and KGF had significant stimulatory effects (p<0.05) on the proliferation of LNCaP. However, EGF had minimal, not significant, growth stimulatory effects. EGF, bFGF and KGF did not increase the PSA secretion of LNCaP and no apparent increase or decrease in the steady-state levels of the PSA mRNA expression of LNCaP could not be detected in spite of addition of EGF, bFGF and KGF. CONCLUSIONS: bFGF and KGF, not EGF, directly stimulate the proliferation of LNCaP cells. However, bFGF and KGF as well as EGF do not affect the PSA secretion and the PSA mRNA expression of androgen-dependent LNCaP in the absence of androgenic milieu. The regulation of the PSA secretion and the PSA mRNA expression of LNCaP is not directly associated with EGF, bFGF and KGF.

Induction of Humoral Immue Response in Mice by Wild and Mutant Type HBV Core DNA Vaccination / 대한면역학회지

No abstract available.

Detection of Herpes Simplex Virus DNA in Clinical specimens by Polymerasde Chain Reaction (PCR)

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.