Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 5 de 5
Filter
Add filters








Language
Year range
1.
Chinese Journal of Medical Genetics ; (6): 450-454, 2011.
Article in Chinese | WPRIM | ID: wpr-326912

ABSTRACT

<p><b>OBJECTIVE</b>To analyze the human leukocyte antigens(HLA)-A, -B, -Cw, -DRB1 and DQB1 nucleotide sequences between patients waiting for allogenic hematopoietic stem-cell transplantation (HSCT) and donors in Chinese population, and to establish strategy for maximizing optimal donor selection.</p><p><b>METHODS</b>HLA high-resolution typing in a total of 537 recipient-donor pairs was determined by sequence based typing (SBT) method. The nucleotide BLAST tool was used to compare the nucleotide sequences among recipient-donor pairs.</p><p><b>RESULTS</b>Only 16.20% (88/537) of recipient-donor pairs were found to fully match for nucleotide sequences of all HLA-A,-B,-Cw, -DRB1 and -DQB1 loci. Mismatch rate in single locus were 8.38% in HLA-A, 0.74% in HLA-B, 12.29% in HLA-C, 2.42% in HLA-DRB1, and 2.79% in HLA-DQB1, respectively. Mismatch rate in two or multiple HLA loci was 42.65%. Nonpermissive allele mismatch combinations (A 02:01-A 02:06, A 02:06-A 02:07, Cw 03:04-Cw 15:02, Cw 03:03-Cw 04:01, Cw 03:04-Cw 14:02, Cw 03:03-Cw 08:01, DRB1 04:03:01-DRB1 04:05) were detected in single mismatch HLA locus of recipient-donor pairs, mismatches of B 07:05:01-B 07:06, Cw 07:01:01-Cw 07:06 combinations outside of epitope positions were detected in two recipient-donor pairs.</p><p><b>CONCLUSION</b>Our data suggested that attention should be paid in comparing nucleotide sequences between recipient and donor, and in distinguishing nucleotide sequence mismatches within and outside of the epitope positions. These results could serve as guidelines for donor selection.</p>


Subject(s)
Humans , Base Sequence , Donor Selection , Methods , Epitopes , Genetics , HLA Antigens , Genetics , Hematopoietic Stem Cell Transplantation , Methods , Tissue Donors
2.
Journal of Experimental Hematology ; (6): 691-693, 2008.
Article in Chinese | WPRIM | ID: wpr-267909

ABSTRACT

In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.


Subject(s)
Humans , Alleles , Asian People , Genetics , Blood Donors , Blood Group Antigens , Genetics , Cell Adhesion Molecules , Genetics , Exons , Genetics , Homozygote , Polymorphism, Genetic , Sequence Analysis, DNA
3.
Chinese Journal of Medical Genetics ; (6): 520-523, 2007.
Article in Chinese | WPRIM | ID: wpr-247278

ABSTRACT

<p><b>OBJECTIVE</b>Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.</p><p><b>METHODS</b>Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.</p><p><b>RESULTS</b>The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.</p><p><b>CONCLUSION</b>A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.</p>


Subject(s)
Humans , Alleles , Asian People , Genetics , Base Sequence , Ethnicity , Genetics , Fucosyltransferases , Genetics , Genotype , Pedigree , Phenotype , Polymerase Chain Reaction , Sequence Analysis, DNA , Serologic Tests
4.
Journal of Forensic Medicine ; (6): 283-285, 2007.
Article in Chinese | WPRIM | ID: wpr-983299

ABSTRACT

OBJECTIVE@#To study the molecular genetic background of Diego blood group in Chinese Han population.@*METHODS@#A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing.@*RESULTS@#Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19.@*CONCLUSION@#Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.


Subject(s)
Humans , Asian People/genetics , Base Sequence , Blood Donors , Blood Group Antigens/metabolism , Blood Grouping and Crossmatching/methods , China/ethnology , Exons/genetics , Genotype , Molecular Sequence Data , Phenotype , Polymerase Chain Reaction/methods , Sequence Analysis, DNA
5.
Chinese Journal of Hematology ; (12): 473-477, 2004.
Article in Chinese | WPRIM | ID: wpr-291394

ABSTRACT

<p><b>OBJECTIVE</b>To analyze human leukocyte antigen (HLA) polymorphism and search for new alleles in Chinese Han population bone marrow registry donors.</p><p><b>METHODS</b>DNA-based HLA genotyping methods were used including PCR-SSP, BST and molecular cloning.</p><p><b>RESULTS</b>A total of 6965 unrelated donors, 4707 from South China origin and 2258 from north, were typed for HLA-A, B, and DRB1 loci. Seventy-two specificities of HLA alleles were identified. The HLA-A25, A34, A74, B41, B42, B53, B73 and B81 that were rarely reported in previously Chinese population studies were identified in this study. Estimation of gene frequency indicated that the blank gene frequency was less than 0.2% for HLA-A, 0.25% for HLA-B and 0.70% for HLA-DRB1 loci. Three novel alleles were identified and officially assigned by the World Health Organization (WHO) Nomenclature Committee as A*0253N, A*1114 and B*5610.</p><p><b>CONCLUSION</b>Large-scale DNA-based HLA genotyping used in bone marrow registry donors is highly accurate and reliable for estimating gene frequency and searching for new alleles. The discrepancy of HLA gene distribution between South and North China Han population showed the necessity of setting the more regions in South and North China to screen the bone marrow registry donors for bone marrow transplant.</p>


Subject(s)
Female , Humans , Male , Bone Marrow Transplantation , China , Ethnology , Gene Frequency , HLA-A Antigens , Genetics , HLA-B Antigens , Genetics , HLA-DR Antigens , Genetics , HLA-DRB1 Chains , Histocompatibility Antigens Class I , Genetics , Histocompatibility Antigens Class II , Genetics , Polymorphism, Genetic , Registries , Tissue Donors
SELECTION OF CITATIONS
SEARCH DETAIL