ABSTRACT
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
ABSTRACT
Aim To study the effect of echinacoside on behavior and proteins expression from substantia nigra and striatal tissue in MPTP mouse model of Parkinsons disease(PD)and discover the mechanism of its potential dopaminergic neuroprotective effect in the protein level.Methods The mouse model of PD was induced by 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine(MPTP)and the behavioral analysis of C57BL/6 mice was performed by using spontaneous movement and rotarod test.A proteomic approach based on 2-dimensional electrophoresis(2-DE),mass spectrometry(MS)and figure analysis was used to evaluate the effect of echinacoside on the behavior and the protein expression in substantia nigra and striatal tissue in C57BL/6 mice after MPTP administration.Results ① Compared with control,MPTP lesion significantly reduced the number of spontaneous movement and latent period of mice on the rotating rod(both P