Three 2,3-diketoquinoxaline alkaloids with hepatoprotective activity from Heterosmilax yunnanensis / 药学学报

Three 2,3-diketoquinoxaline alkaloids were isolated from Heterosmilax yunnanensis Gagnep. Their structures were determined through 1D and 2D NMR, HR-ESI-MS, UV, and IR as 1-[5′-(3″-hydroxy-3″-methyl) glutaryl] ribityl-2,3-diketo-1,2,3,4-tetrahydro-6,7-dimethylquinoxaline (1), 1-[2′-(3″-hydroxy-3″-methyl) glutaryl]ribityl-2,3-diketo-1,2,3,4-tetrahydro-6,7-dimethylquinoxaline (2), and 1-ribityl-2,3-diketo-1,2,3,4-tetrahydro-6,7-dimethylquinoxaline (3). Compounds 1 and 2 are novel compounds, and 3 was isolated from H. yunnanensis for the first time. The hepatoprotective activity of these three compounds was evaluated, with compound 3 showing promising hepatoprotective activity.

Effect of enriched environment combined with acupuncture at head points on behavior in rats with autism spectrum disorder / 中国康复理论与实践

ObjectiveTo observe the effect of enriched environment (EE) combined with acupuncture at head point (HA) on behavior in rats with autism spectrum disorder. MethodsHealthy female Wistar rats were given peritoneal injection of sodium valproate at 12.5 days of gestation. Twenty-four male offspring rats were randomly selected and then randomly divided into model group (n = 6), EE group (n = 6), HA group (n = 6) and EE combined with HA group (the combined group, n = 6). Six male offspring rats born from female mice injected with the same amount of saline intraperitoneally were as control group. After four weeks of treatment, all the five groups were tested with three-chamber test and marble burying test, and the sociability index, the social novelty index and the number of buried marbles were recorded. The levels of interleukin (IL)-1β and IL-6 in peripheral blood were determined by enzyme-linked immunosorbent assay (ELISA). ResultsAfter treatment, compared with the model group, the sociability index and the social novelty index improved (P < 0.05), the number of buried marbles reduced (P < 0.05), and the levels of IL-6 and IL-1β in peripheral blood decreased in EE group, HA group and the combined group (P < 0.05); while the combined group was the best (P < 0.01). ConclusionBoth EE or acupuncture at HA could improve behavioral symptoms, and reduce the expression of inflammatory factors in rats with autism spectrum disorder. The combination of the two methods showed the best result.

Study on injectable chitosan hydrogel with tendon-derived stem cells for enhancing rotator cuff tendon-to-bone healing / 中国修复重建外科杂志

OBJECTIVE@#To explore the effect of chitosan (CS) hydrogel loaded with tendon-derived stem cells (TDSCs; hereinafter referred to as TDSCs/CS hydrogel) on tendon-to-bone healing after rotator cuff repair in rabbits.@*METHODS@#TDSCs were isolated from the rotator cuff tissue of 3 adult New Zealand white rabbits by Henderson step-by-step enzymatic digestion method and identified by multidirectional differentiation and flow cytometry. The 3rd generation TDSCs were encapsulated in CS to construct TDSCs/CS hydrogel. The cell counting kit 8 (CCK-8) assay was used to detect the proliferation of TDSCs in the hydrogel after 1-5 days of culture in vitro, and cell compatibility of TDSCs/CS hydrogel was evaluated by using TDSCs alone as control. Another 36 adult New Zealand white rabbits were randomly divided into 3 groups ( n=12): rotator cuff repair group (control group), rotator cuff repair+CS hydrogel injection group (CS group), and rotator cuff repair+TDSCs/CS hydrogel injection group (TDSCs/CS group). After establishing the rotator cuff repair models, the corresponding hydrogel was injected into the tendon-to-bone interface in the CS group and TDSCs/CS group, and no other treatment was performed in the control group. The general condition of the animals was observed after operation. At 4 and 8 weeks, real-time quantitative PCR (qPCR) was used to detect the relative expressions of tendon forming related genes (tenomodulin, scleraxis), chondrogenesis related genes (aggrecan, sex determining region Y-related high mobility group-box gene 9), and osteogenesis related genes (alkaline phosphatase, Runt-related transcription factor 2) at the tendon-to-bone interface. At 8 weeks, HE and Masson staining were used to observe the histological changes, and the biomechanical test was used to evaluate the ultimate load and the failure site of the repaired rotator cuff to evaluate the tendon-to-bone healing and biomechanical properties.@*RESULTS@#CCK-8 assay showed that the CS hydrogel could promote the proliferation of TDSCs ( P<0.05). qPCR results showed that the expressions of tendon-to-bone interface related genes were significantly higher in the TDSCs/CS group than in the CS group and control group at 4 and 8 weeks after operation ( P<0.05). Moreover, the expressions of tendon-to-bone interface related genes at 8 weeks after operation were significantly higher than those at 4 weeks after operation in the TDSCs/CS group ( P<0.05). Histological staining showed the clear cartilage tissue and dense and orderly collagen formation at the tendon-to-bone interface in the TDSCs/CS group. The results of semi-quantitative analysis showed that compared with the control group, the number of cells, the proportion of collagen fiber orientation, and the histological score in the TDSCs/CS group increased, the vascularity decreased, showing significant differences ( P<0.05); compared with the CS group, the proportion of collagen fiber orientation and the histological score in the TDSCs/CS group significantly increased ( P<0.05), while there was no significant difference in the number of cells and vascularity ( P>0.05). All samples in biomechanical testing failed at the repair site during the testing process. The ultimate load of the TDSCs/CS group was significantly higher than that of the control group ( P<0.05), but there was no significant difference compared to the CS group ( P>0.05).@*CONCLUSION@#TDSCs/CS hydrogel can induce cartilage regeneration to promote rotator cuff tendon-to-bone healing.

Mapping the modulating effect of transcutaneous auricular vagus nerve stimulation on voxel-based analyses in patients with first-episode major depressive disorder: a resting-state functional magnetic resonance imaging study

Introduction: Seed-based analysis has shown that transcutaneous auricular vagus nerve stimulation (taVNS) can modulate the dysfunctional brain network in patients with major depressive disorder (MDD). However, the voxel-based neuropsychological mechanism of taVNS on patients with first-episode MDD is poorly understood. The objective of this study was to assess the effects of an 8-week course of taVNS on patients with first-episode MDD. Methods: Twenty-two patients with first-episode MDD accepted an 8-week course of taVNS treatment. Resting-state functional magnetic resonance imaging (rs-fMRI) scans were performed before and after treatment. Voxel-based analyses were performed to characterize spontaneous brain activity. Healthy controls (n=23) were recruited to minimize test-retest effects. Analysis of covariance (ANCOVA) was performed to ascertain treatment-related changes. Then, correlations between changes in brain activity and the Hamilton Depression Rating Scale (HAM-D)/Hamilton Anxiety Scale (HAM-A) remission rate were estimated. Results: Significant group-by-time interactions on voxel-based analyses were observed in the inferior ventral striatum (VSi) and precuneus. Post-hoc analyses showed that taVNS inhibited higher brain activity in the VSi, while upregulating it in the precuneus. Functional connectivity (FC) between the VSi and precuneus decreased. Positive correlations were found between the HAM-D remission rate and changes in brain activity in the VSi. Conclusion: taVNS reduced the FC between VSi and precuneus by normalizing the abnormal spontaneous brain activity of VSi in first-episode MDD patients.

Relationship between the inserting sites of Fu's subcutaneous needling and traditional acupoints: revelation to acupuncture and moxibustion / 中国针灸

Focusing on the phenomenon of "de-acupoints" of the needle insertion sites in Fu's subcutaneous needling (FSN), the authors allocated the evolution and characteristics of the needle insertion sites of FSN. From six aspects, named morphology and structure, location, nomenclature, numbers and meridian tropism, indications and acupuncture manipulations, the comparison was made between the insertion sites of FSN and traditional acupoints. It is believed: ①The needle insertion sites of FSN has the basic attributes of acupoint, which not only refers to the operation site, but also indicates the reaction of disease; moreover, it is the treatment site with significant therapeutic effect. ②The optimized sites of insertion in FSN should be named differently and their locations and numbers should be specified relatively. ③The insertion sites of FSN should be further intersected and integrated with traditional acupoints, and a part of traditional acupoints should become the insertion sites of FSN. ④Accepting and integrating the insertion sites of FSN, and expanding the scope of traditional acupoints may be the new project in the research of traditional acupoints.

Progress in research of etiology of childhood obesity based on interaction between genes and environment / 中华流行病学杂志

Childhood obesity is a global public health problem, which can not only endangers children's health, but also might be an important cause of chronic diseases in adulthood. In recent years, with the in-depth development of precision medicine research, more and more research evidences have shown that there are interactions between environmental factors, such as early intrauterine environment, children's diet, physical activity and children's gene factor on the incidence of childhood obesity, which can result in or inhibit the incidence and development of childhood obesity. This paper summarizes the progress in research in this field to reveal the effects and potential mechanisms of genetic factors and environmental factors on the incidence of childhood obesity in order to provide reference for the precise prevention and control of childhood obesity under different genetic backgrounds.

Diagnosis of a patient with Spinocerebellar ataxia type 29 due to a novel variant of ITPR1 gene / 中华医学遗传学杂志

OBJECTIVE@#To explore the clinical and genetic characteristics of a child with spinocerebellar ataxia type 29 (SCA29) due to novel variant of the inositol 1,4,5-trisphosphate receptor type 1 (ITPR1) gene.@*METHODS@#The child was subjected high-throughput sequencing, and candidate variant was verified by Sanger sequencing of his family members.@*RESULTS@#The child was found to harbor a c.800C>T (p.T267M) variant of the ITPR1 gene, which was not found in his parents and their fetus. The variant has occurred in a hotspot of the ITPR1 gene variants and was unreported before in China. Based on his clinical and genetic characteristics, the child was diagnosed with SCA29.@*CONCLUSION@#The novel heterozygous c.800C>T (p.T267M) of the ITPR1 gene probably underlay the SCA29 in this child.

Research progress on structure, structure-activity relationship, and biological activity of Aconiti Lateralis Radix Praeparata polysaccharides / 中国中药杂志

Aconiti Lateralis Radix Praeparata polysaccharides(AP) are a class of bioactive macromolecules extracted from the herbs of Aconiti Lateralis Radix Praeparata and its various processed products. Since the AP was first separated in 1986, its pharmacological effects include immune regulation, anti-tumor, anti-depression, organ protection, hypoglycemia, and anti-inflammatory had been found. In recent years, with the development of polysaccharide extraction, separation, and structure identification technologies, more than 20 kinds of AP have been separated from Aconiti Lateralis Radix Praeparata and its processed products, and they have ob-vious differences in relative molecular weight, monosaccharide composition, glycosidic bond, structural characteristics, and biological activities. In particular, AP may be dissolved, degraded, or allosteric under the complex processing environment of fermentation, soaking, cooking, etc., leading to the diversified structure of AP, which provides a possibility for further understanding of the structure-activity relationship of AP. Therefore, this study systematically reviewed the research progress on the structure and structure-activity relationship of AP, summarized the biological activity and potential action mechanism of AP, and discussed the technical challenges in the development and application of AP, so as to promote the quality control and further development and utilization of AP.

Expert consensus on core indicators for lifecycle value assessment of Chinese patent medicine / 中国中药杂志

The establishment of core indicators for assessment plays an important role in carrying out the lifecycle value assessment of Chinese patent medicine, which are developed based on the concepts such as clinical value oriented, paying attention to the human use experience, and whole process quality control. To this end, the Specialty Committee of Data Monitoring and Decision Making of the World Federation of Chinese Medicine Societies organized experts to draft the Expert Consensus on Core Indicators for Lifecycle Value Assessment of Chinese Patent Medicine based on the research including Chinese Medicine Registration Review Evidence System in Combination of Traditional Chinese Medicine Theory, Human Use Experience, and Clinical Trials(GZY-FJS-2022-206) by National Administration of Traditional Chinese Medicine. This consensus proposed 92 core indicators from four stages, including new drug R&D project approval, pre-clinical research, new drug marketing authorization, and post-marketing, combining the assessment purposes and needs of different stakeholders from different dimensions such as clinical needs, clinical positioning, human use experience, effectiveness, safety, quality control, innovation, accessibility, and suitability. This consensus also interpreted the indicators to clearly elucidate the core elements of the value assessment of Chinese patent medicine in different R&D stages and guided the stakeholders to identify, analyze, and assess the value of Chinese patent medicine in the R&D and use process based on the core indicators in a scientific, objective, and standardized approach. This consensus is expected to play an important role in the high-quality new drug development, drug pricing and compensation of Chinese patent medicine, the development of clinical pathways, and rational clinical application.

Diosgenin alleviates NAFLD induced by a high-fat diet in rats via mTOR/SREBP-1c/HSP60/MCAD/SCAD signaling pathway / 中国中药杂志

This study aims to observe the effects of diosgenin on the expression of mammalian target of rapamycin(mTOR), sterol regulatory element-binding protein-1c(SREBP-1c), heat shock protein 60(HSP60), medium-chain acyl-CoA dehydrogenase(MCAD), and short-chain acyl-CoA dehydrogenase(SCAD) in the liver tissue of the rat model of non-alcoholic fatty liver disease(NAFLD) and explore the mechanism of diosgenin in alleviating NAFLD. Forty male SD rats were randomized into five groups: a control group, a model group, low-(150 mg·kg~(-1)·d~(-1)) and high-dose(300 mg·kg~(-1)·d~(-1)) diosgenin groups, and a simvastatin(4 mg·kg~(-1)·d~(-1)) group. The rats in the control group were fed with a normal diet, while those in the other four groups were fed with a high-fat diet. After feeding for 8 weeks, the body weight of rats in the high-fat diet groups increased significantly. After that, the rats were administrated with the corresponding dose of diosgenin or simvastatin by gavage every day for 8 weeks. The levels of triglyceride(TG), total cholesterol(TC), alanine transaminase(ALT), and aspartate transaminase(AST) in the serum were determined by the biochemical method. The levels of TG and TC in the liver were measured by the enzyme method. Oil-red O staining was employed to detect the lipid accumulation, and hematoxylin-eosin(HE) staining to detect the pathological changes in the liver tissue. The mRNA and protein levels of mTOR, SREBP-1c, HSP60, MCAD, and SCAD in the liver tissue of rats were determined by real-time fluorescence quantitative polymerase chain reaction(RT-qPCR) and Western blot, respectively. Compared with the control group, the model group showed increased body weight, food uptake, liver index, TG, TC, ALT, and AST levels in the serum, TG and TC levels in the liver, lipid deposition in the liver, obvious hepatic steatosis, up-regulated mRNA and protein expression levels of mTOR and SREBP-1c, and down-regulated mRNA and protein expression levels of HSP60, MCAD, and SCAD. Compared with the model group, the rats in each treatment group showed obviously decreased body weight, food uptake, liver index, TG, TC, ALT, and AST levels in the serum, TG and TC levels in the liver, lessened lipid deposition in the liver, ameliorated hepatic steatosis, down-regulated mRNA and protein le-vels of mTOR and SREBP-1c, and up-regulated mRNA and protein levels of HSP60, MCAD, and SCAD. The high-dose diosgenin outperformed the low-dose diosgenin and simvastatin. Diosgenin may prevent and treat NAFLD by inhibiting the expression of mTOR and SREBP-1c and promoting the expression of HSP60, MCAD, and SCAD to reduce lipid synthesis, improving mitochondrial function, and promoting fatty acid β oxidation in the liver.

Prognosis of childhood adrenoleukodystrophy with cognitive disorder after haploidentical allogenic hemato-poietic stem cell transplantation / 中华实用儿科临床杂志

Objective:To investigate the prognosis of childhood adrenoleukodystrophy (ALD) with cognitive disorder after haploidentical allogenic hematopoietic stem cell transplantation (haplo-HSCT), and to identify risk factors affecting the prognosis.Methods:It was a single-center retrospective study involving 31 ALD children receiving haplo-HSCT in Peking University People′s Hospital from January 2014 to October 2022.Survival analysis was performed by Kaplan-Meier method. Cox regression analysis was performed to identify risk factors for the prognosis of childhood ALD following haplo-HSCT. Results:Among the 31 children with ALD, 1 case died of cardiogenic shock during the transplantation, and the remaining had a successful haplo-HSCT.Ten children with ALD had cognitive disorder before haplo-HSCT, including 3 cases with the minimal LOES score ≥10 points and 8 cases with the Neurologic Function Score (NFS)>0 point before haplo-HSCT.Six children had major functional disability (MFD) and 2 cases died due to progression of ALD after haplo-HSCT.Twenty children did not have cognitive disorder before haplo-HSCT, of whom 3 cases had the LOES score≥10 points and 6 cases had NFS>0 before haplo-HSCT.Four children had MFD and 2 cases died due to progression of ALD after haplo-HSCT.For ALD patients without cognitive disorder after haplo-HSCT, the 3-year and 5-year survival rate were 100.0% and 72.9%, respectively, and the 5-year MFD-free survival was 61.6%.For ALD patients with cognitive disorder after haplo-HSCT, the 3-year survival rate was 83.3%.Compared with ALD patients with the LOES score<10 points before haplo-HSCT, those with the LOES score≥10 points had 9.243 times the risk of developing MFD after haplo-HSCT ( P=0.024, 95% CI: 1.332-64.127). Compared with ALD patients without cognitive disorder before haplo-HSCT, ALD patients with cognitive disorder had 9.749 times the risk of developing MFD after haplo-HSCT ( P=0.023, 95% CI: 1.358-66.148). Conclusions:Cognitive disorder and LOES score≥10 points before haplo-HSCT are risk factors for developing MFD in children with ALD following haplo-HSCT.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Efficacy Evaluation of Apparent Diffusion Coefficient in the Treatment of Uterine Fibroid by Magnetic Resonance Guided Focused Ultrasound Surgery / 中山大学学报(医学科学版)

ObjectiveTo assess the value of apparent diffusion coefficient （ADC） in the treatment of uterine fibroid using magnetic resonance guided focused ultrasound surgery （MRgFUS）. MethodsThe MRI and clinical data of 56 patients with uterine fibroid before， at 3 and 6 months after MRgFUS treatment， at Foshan Hospital of Traditional Chinese Medicine from December 2018 to October 2022， were retrospectively analyzed. The correlation between the ADC value and lesion volume， symptoms severity score （SSS） and uterine fibroid symptoms quality of life questionnaire （UFS-QOL） were analyzed. ANOVA was used to compare the differences in related parameters before and after treatment， and Pearson’s method was performed to analyze data correlation. ResultsThere were significant differences in ADC value ［（1.11±0.13）， （1.84±0.09）， （2.12±0.24），×10-3/（mm2/s）］， lesion volume （102±35.30， 56.70±18.88， 46.93±18.99，cm3）， SSS （36.73±11.74， 21.77±10.21， 17.66±9.30） and UFS-QOL score （59.05±17.48， 76.54±16.50， 82.46±12.37） between before treatment and each time point after treatment （F value was 557.837， 73.589， 53.976 and 37.606， respectively， all P<0.05）. The ADC values were negatively correlated with lesion volume and SSS， and positively correlated with UFS-QOL score， with correlation coefficients of -0.586， -0.630 and 0.592， respectively （all P<0.05）. ConclusionThe ADC value has clinical significance for the treatment of uterine fibroid using MRgFUS.

Value of resting state electroencephalogram in the diagnosis of Alzheimer's disease / 四川精神卫生

BackgroundThe diagnosis of Alzheimer's disease （AD） still faces great challenges， and the advantage of electroencephalogram （EEG） diagnosis lies in its portable and non-invasive nature， so the EEG diagnosis of AD has occupied an important place in clinical research. ObjectiveTo evaluate the value of resting state EEG for AD diagnosis， and to provide references for early recognition of AD in clinical practice. MethodsClinical data of AD patients （n=59） in an Inpatient Geriatric Psychiatry Unit of Shenzhen Kangning Hospital from May 2019 to May 2022 were retrospectively analyzed， and healthy elderly individuals attending outpatient clinics at the hospital during the same period were enrolled as control group （n=54）. Eight-channel resting state EEG data were acquired， and the absolute power values in the α， β， θ and δ frequency bands and the α/θ ratio were obtained and calculated using Fast Fourier Transform （FFT）. Cognitive function assessments of patients were done by Mini-Mental State Examination （MMSE） and Montreal Cognitive Assessment （MoCA）. Spearman correlation analysis was used to examine the correlation between EEG findings and MMSE and MoCA scores of AD patienrs. Logistic regression prediction model for AD was built using currently available EEG and clinical variables， and the model performance was assessed using the receiver operating characteristic （ROC） curve and the area under curve （AUC）. ResultsThe θ-band absolute powers in the right mid-frontal （F4） and mid-lateral （F7， F8） regions were higher in AD patients than those in healthy controls， with statistically significant difference （t=-2.844， -2.825， -3.014， P<0.05 or 0.01）. The absolute powers of α/θ ratio in prefrontal （Fp1， Fp2）， mid-frontal （F3， F4） and mid-lateral （F7， F8） regions showed a notable reduction in AD patients compared with healthy controls， with statistical difference （t=2.081， 2.327， 3.423， 2.358， 3.272， 2.445， P<0.05 or 0.01）. Spearman correlation analysis denoted that MMSE score was positively correlated with the absolute powers of α-band， β-band and α/θ ratio （r=0.206， 0.288， 0.372， P<0.05 or 0.01）. MoCA score was positively correlated with β absolute powers and α/θ ratio （r=0.201， 0.315， P<0.05 or 0.01）， and negatively correlated with θ absolute power （r=-0.218， P<0.05）. ROC curve revealed an AUC of 0.882 （95% CI： 0.820~0.943）， a sensitivity of 0.966 and a specificity of 0.673 for the AD prediction model based on EEG variables， while the prediction model for AD using comprehensive variables achieved better predictive efficacy， reaching an AUC， sensitivity and specificity of 0.946 （95% CI： 0.905~0.986）， 0.948 and 0.873， respectively. ConclusionResting state EEG of AD patients is correlated with cognitive function， and are of great value in the diagnosis of AD， with θ absolute power and α/θ ratio in EEG being the most strongly correlated with AD.

Pathogenic characteristics of bloodstream infections in patients with hematological diseases and the impact of stem cell transplantation on them / 中国热带医学

@#Abstract: Objective To investigate the epidemiological characteristics of pathogens causing bloodstream infection in hematology patients during treatment and to compare the effects of allogeneic hematopoietic stem cell transplantation (HSCT) on them, so as to provide evidence for the diagnosis and treatment of bloodstream infection. Methods A total of 292 cases with bloodstream infection in hematology wards of the PLA General Hospital were collected from 2017 to 2021, which were divided into HSCT group and N-HSCT group according to whether performed HSCT or not. The epidemiological characteristics and influence of pathogenic bacteria in blood stream infection were analyzed and compared between the two groups. Results A total of 362 strains of pathogenic bacteria were collected from 292 cases, including 106 strains in HSCT group (84 cases) and 256 strains in N-HSCT group (208 cases). Bloodstream infections were more common in acute myeloid leukemia (130/392, 44.52%), followed by non-Hodgkin's lymphoma (74/292, 25.34%). The rate of once bloodstream infection in HSCT group was higher than that in N-HSCT Group, but the rate of twice bloodstream infections in N-HSCT group was higher. Gram-negative Bacilli were the most common pathogens (56.08%), with Escherichia coli being absolutely dominant (109/362, 30.11%), followed by Klebsiella pneumoniae (39/362, 10.77%). Coagulase-negative staphylococci (CoNS) (107/362, 29.56%) were the most common Gram-positive cocci. The detection rate of fungi in HSCT group (10/106, 9.43%) was significantly higher than that in N-HSCT Group (3.52%). The drug resistance rate of the common pathogenic bacteria was at a high level, and there was a certain proportion of multi-drug resistant strains (except for Pseudomonas aeruginosa). The resistance rates of CoNS to penicillin, gentamicin, moxifloxacin, clindamycin and rifampicin in HSCT group were higher than those in N-HSCT Group. The resistance rate of Escherichia coli to piperacillin/tazobactam, cephalosporins and etapenem in HSCT group was significantly higher than that in N-HSCT group. Conclusions The pathogens of blood stream infection in hematology patients are complicated and various. It is difficult for clinical diagnosis and treatment to detect multiple infections and multiple pathogens. HSCT patients have a higher risk of fungal bloodstream infection and more multi-drug resistant strains detected. Therefore, the identification of bloodstream infection and multi-drug resistant strains associated with HSCT patients should prompt surveillance.

Relationship of Microvascular Obstruction with Global and Regional Myocardial Function Determined by Cardiac Magnetic Resonance after ST-Segment Elevation Myocardial Infarction / 中国医学科学杂志(英文版)

Objective To investigate the impact of microvascular obstruction (MVO) on the global and regional myocardial function by cardiac magnetic resonance feature-tracking (CMR-FT) in ST-segment-elevation myocardial infarction (STEMI) patients after percutaneous coronary intervention.Methods Consecutive acute STEMI patients who underwent cardiac magnetic resonance imaging 1 - 7 days after successful reperfusion by percutaneous coronary intervention treatment were included in this retrospective study. Based on the presence or absence of MVO on late gadolinium enhancement images, patients were divided into groups with MVO and without MVO. The infarct zone, adjacent zone, and remote zone were determined based on a myocardial 16-segment model. The radial strain (RS), circumferential strain (CS), and longitudinal strain (LS) of the global left ventricle (LV) and the infarct, adjacent, and remote zones were measured by CMR-FT from cine images and compared between patients with and without MVO using independent-samples t-test. Logistic regression analysis was used to assess the association of MVO with the impaired LV function.Results A total of 157 STEMI patients (mean age 56.66 ± 11.38 years) were enrolled. MVO was detected in 37.58% (59/157) of STEMI patients, and the mean size of MVO was 3.00 ±3.76 mL. Compared with patients without MVO (n =98 ), the MVO group had significantly reduced LV global RS (t= -4.30, P < 0.001), global CS (t= 4.99, P < 0.001), and global LS ( t= 3.51, P = 0.001). The RS and CS of the infarct zone in patients with MVO were significantly reduced (t= -3.38, P = 0.001; t= 2.64, P = 0.01; respectively) and the infarct size was significantly larger (t= 8.37, P < 0.001) than that of patients without MVO. The presence of LV MVO [OR= 4.10, 95%CI: 2.05 - 8.19, P<0.001) and its size [OR=1.38, 95%CI: 1.10-1.72, P=0.01], along with the heart rate and LV infarct size were significantly associated with impaired LV global CS in univariable Logistic regression analysis, while only heart rate (OR=1.08, 95%CI: 1.03 - 1.13, P=0.001) and LV infarct size (OR=1.10, 95%CI: 1.03 - 1.16, P=0.003) were independent influencing factors for the impaired LV global CS in multivariable Logistic regression analysis.Conclusion The infarct size was larger in STEMI patients with MVO, and MVO deteriorates the global and regional LV myocardial function.

Prediction of superantigen active sites and clonal expression of staphylococcal enterotoxin-like W / 中华流行病学杂志

Objective: The docking and superantigen activity sites of staphylococcal enterotoxin-like W (SElW) and T cell receptor (TCR) were predicted, and its SElW was cloned, expressed and purified. Methods: AlphaFold was used to predict the 3D structure of SElW protein monomers, and the protein models were evaluated with the help of the SAVES online server from ERRAT, Ramachandran plot, and Verify_3D. The ZDOCK server simulates the docking conformation of SElW and TCR, and the amino acid sequences of SElW and other serotype enterotoxins were aligned. The primers were designed to amplify selw, and the fragment was recombined into the pMD18-T vector and sequenced. Then recombinant plasmid pMD18-T was digested with BamHⅠand Hind Ⅲ. The target fragment was recombined into the expression plasmid pET-28a(+). After identification of the recombinant plasmid, the protein expression was induced by isopropyl-beta-D- thiogalactopyranoside. The SElW expressed in the supernatant was purified by affinity chromatography and quantified by the BCA method. Results: The predicted three-dimensional structure showed that the SElW protein was composed of two domains, the amino-terminal and the carboxy-terminal. The amino-terminal domain was composed of 3 α-helices and 6 β-sheets, and the carboxy-terminal domain included 2 α-helices and 7 antiparallel β-sheets composition. The overall quality factor score of the SElW protein model was 98.08, with 93.24% of the amino acids having a Verify_3D score ≥0.2 and no amino acids located in disallowed regions. The docking conformation with the highest score (1 521.328) was selected as the analysis object, and the 19 hydrogen bonds between the corresponding amino acid residues of SElW and TCR were analyzed by PyMOL. Combined with sequence alignment and the published data, this study predicted and found five important superantigen active sites, namely Y18, N19, W55, C88, and C98. The highly purified soluble recombinant protein SElW was obtained with cloning, expression, and protein purification. Conclusions: The study found five superantigen active sites in SElW protein that need special attention and successfully constructed and expressed the SElW protein, which laid the foundation for further exploration of the immune recognition mechanism of SElW.

Depression status of elderly patients with metabolic syndrome in three provinces of China / 中华流行病学杂志

Objective: To understand the depression status and its influencing factors in elderly patients with MS in China and to explore the correlation between various components of elderly MS and depression. Methods: This study is based on the "Prevention and Intervention of Key Diseases in Elderly" project. We used a multi-stage stratified cluster random sampling method to complete 16 199 elderly aged 60 years and above in 16 counties (districts) in Liaoning, Henan, and Guangdong Provinces in 2019, excluding 1 001 missing variables. Finally, 15 198 valid samples were included for analysis. The respondents' MS disease was obtained through questionnaires and physical examinations, and the respondents' depression status within the past half month was assessed using the PHQ-9 Depression Screening Scale. The correlation between elderly MS and its components and depression and its influencing factors were analyzed by logistic regression. Results: A total of 15 198 elderly aged 60 years and above were included in this study, with the prevalence of MS at 10.84% and the detection rate of depressive symptoms in MS patients at 25.49%. The detection rates of depressive symptoms in patients with 0, 1, 2, 3, and 4 MS abnormal group scores were 14.56%, 15.17%, 18.01%, 25.21%, and 26.65%, respectively. The number of abnormal components of MS was positively correlated with the detection rate of depressive symptoms, and the difference between groups was statistically significant (P<0.05). The risk of depression symptoms in patients with MS, overweight/obesity, hypertension, diabetes, and dyslipidemia was 1.73 times (OR=1.73, 95%CI:1.51-1.97), 1.13 times (OR=1.13, 95%CI:1.03-1.24), 1.25 times (OR=1.25, 95%CI:1.14-1.38), 1.41 times (OR=1.41, 95%CI:1.24-1.60), 1.81 times (OR=1.81,95%CI:1.61-2.04), respectively, more than those without the disease. Multivariate logistic regression analysis showed that the detection rate of depressive symptoms in patients with sleep disorders was higher than that with normal sleep (OR=4.89, 95%CI: 3.79-6.32). The detection rate of depressive symptoms in patients with cognitive dysfunction was 2.12 times higher than that in the average population (OR=2.12, 95%CI: 1.56-2.89). The detection rate of depressive symptoms in patients with impaired instrumental activities of daily living (IADL) was 2.31 times (OR=2.31, 95%CI: 1.64-3.26) higher than that in the average population. Tea drinking (OR=0.73, 95%CI: 0.54-0.98) and physical exercise (OR=0.67, 95%CI: 0.49-0.90) seemed to be protective factors for depression in elderly MS patients (P<0.05). Conclusions: Older patients with MS and its component abnormalities have a higher risk of depression than the average population. Sleep disorders, cognitive impairment, and IADL impairment are important influencing factors for depression in elderly MS patients, while tea drinking and physical exercise may help to reduce the risk of the disease.

Different frequency of acupoint thread-embedding for overweight/obesity of spleen deficiency and dampness retention: a randomized controlled trial / 中国针灸

OBJECTIVES@#To compare the effect of different frequency of acupoint thread-embedding on weight loss in subjects with overweight/obesity of spleen deficiency and dampness retention.@*METHODS@#A total of 126 subjects with overweight/obesity of spleen deficiency and dampness retention were randomized into a 2-week group(63 cases, 13 cases dropped out)and a 3-week group(63 cases, 11 cases dropped out, 1 case was eliminated). The two groups were treated with acupoint thread-embedding once every 2 weeks and once every 3 weeks respectively, Zhongwan(CV 12), Shuifen(CV 9), Qihai(CV 6), Guanyuan(CV 4) and bilateral Zhangmen(LR 13), Tianshu(ST 25), Liangmen(ST 21), Daheng(SP 15), Fujie(SP 14), Pishu(BL 20), Yinlingquan(SP 9)were selected. Four times were required in the two groups. Before and after treatment, follow-up after 2 months of treatment completion, the body mass index(BMI), body weight, waist circumference, hip circumference, waist-to-hip ratio, obesity degree, fat percentage(F%), skin fold thickness were observed in the two groups.@*RESULTS@#After treatment and in follow-up, the BMI, body weight, waist circumference, hip circumference, waist-to-hip ratio, obesity degree, F%, skin fold thickness in the two groups were decreased compared with those before treatment (P<0.001, P<0.01), the changes of BMI, body weight, obesity degree, F%, skin fold thickness in the 2-week group were larger than those in the 3-week group(P<0.05, P<0.01, P<0.001).@*CONCLUSIONS@#The effect of acupoint thread-embedding once every 2 weeks on weight loss in subjects with overweight/obesity of spleen deficiency and dampness retention is superior to that once every 3 weeks.

Discussion on the Doctor-patient Relationship Model in Psychiatry Based on the Szasz & Hollender’s Model of Doctor-patient Relationship / 中国医学伦理学

Due to the particularity of mental diseases, doctor-patient relationship in psychiatric medicine is a subject that needs to be paid attention to. This paper focused on the discussion of the model of doctor-patient relationship in psychiatric medicine from the perspective of constructing a harmonious doctor-patient relationship. Based on the Szasz & Hollender’s Model of Doctor-patient Relationship and combined with the characteristics of psychiatric medicine, this paper discussed the applicable doctor-patient relationship models, namely, the shared participation model, the guidance-cooperation model, the active-passive model, and the protective-constraint model. The specific application of the shared participation model, the guidance-cooperation model, and the active-passive model in the psychiatric medicine context were introduced in detail, and the reasons and characteristics of the protective-constraint model added on the basis of Szasz & Hollender’s Model of Doctor-patient Relationship were elaborated. Meanwhile, the realization paths of the protective-constraint model in clinical practice were further explored, which included evaluating the behavioral capacity and consciousness state of patients with mental disorders, obtaining informed consent, and standardizing the use of intervention rights and withdrawal mechanisms. The discussion of this model will promote the improvement of doctor-patient relationship and the development of psychiatric medicine.