Mechanism of salvianolic acid B protecting H9C2 from OGD/R injury based on mitochondrial fission and fusion / 药学学报

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

Noninvasive Diagnostic Technique for Nonalcoholic Fatty Liver Disease Based on Features of Tongue Images / 中国结合医学杂志

OBJECTIVE@#To investigate a new noninvasive diagnostic model for nonalcoholic fatty liver disease (NAFLD) based on features of tongue images.@*METHODS@#Healthy controls and volunteers confirmed to have NAFLD by liver ultrasound were recruited from China-Japan Friendship Hospital between September 2018 and May 2019, then the anthropometric indexes and sampled tongue images were measured. The tongue images were labeled by features, based on a brief protocol, without knowing any other clinical data, after a series of corrections and data cleaning. The algorithm was trained on images using labels and several anthropometric indexes for inputs, utilizing machine learning technology. Finally, a logistic regression algorithm and a decision tree model were constructed as 2 diagnostic models for NAFLD.@*RESULTS@#A total of 720 subjects were enrolled in this study, including 432 patients with NAFLD and 288 healthy volunteers. Of them, 482 were randomly allocated into the training set and 238 into the validation set. The diagnostic model based on logistic regression exhibited excellent performance: in validation set, it achieved an accuracy of 86.98%, sensitivity of 91.43%, and specificity of 80.61%; with an area under the curve (AUC) of 0.93 [95% confidence interval (CI) 0.68-0.98]. The decision tree model achieved an accuracy of 81.09%, sensitivity of 91.43%, and specificity of 66.33%; with an AUC of 0.89 (95% CI 0.66-0.92) in validation set.@*CONCLUSIONS@#The features of tongue images were associated with NAFLD. Both the 2 diagnostic models, which would be convenient, noninvasive, lightweight, rapid, and inexpensive technical references for early screening, can accurately distinguish NAFLD and are worth further study.

Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Endovascular treatment of ruptured lobulated anterior communicating artery aneurysms: A retrospective case series study of 24 patients / 国际脑血管病杂志

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

Risk Factors of Hypogonadism in Male Patients with Hyperuricemia in Xinjiang / 中山大学学报(医学科学版)

ObjectiveTo explore the risk factors of hypogonadism in male hyperuricemia （HUA） patients in Xinjiang. MethodsClinical data of 217 male patients with HUA admitted to the Department of Endocrinology and Metabolism of the People's Hospital of Xinjiang Uygur Autonomous Region from June 2021 to December 2022 were collected. Patients meeting the diagnostic criteria for hypogonadism were included in the case group （98 cases）， and patients with normal gonadism were included in the control group （119 cases）. The differences of different metabolic indexes between the two groups and the correlation of male hypogonadism were analyzed. ResultsCompared with those in normal gonadal function group， in hypogonadism group， age， waist circumference （WC）， body mass index （BMI）， the levels of fasting blood glucose （FPG）， fasting insulin （FINS）， insulin resistance index assessed by homeostasis model （HOMA-IR）， alanine aminotransferase （ALT）， blood uric acid （SUA） and sex hormone binding globulin （SHBG） were significantly increased； the levels of γ-glutamyltransferase （GGT）， 25-hydroxyvitamin D ［25（OH）D］， progesterone （P）， estradiol （E2）， dehydroepiandrosterone （DHEA） and serum free triiodothyronine （FT3） were significantly decreased （P < 0.05）； and the proportion of patients with obesity （OB）， non-alcoholic fatty liver （NAFLD）， hyperlipidemia （HLP）， hypertension （HBP）， coronary heart disease （CHD） and use of angiotensin receptor antagonist （ARB） and aspirin was significantly increased （P < 0.05）. Correlation analyses showed that free testosterone （FT） was negatively correlated with age， WC， BMI， FPG， FINS， HOMA-IR， SUA， SHBG and ALT， but positively correlated with 25（OH）D， P， E2， DHEA and FT3 （P < 0.05）. Logistic regression analysis showed that age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC were independent risk factors for hypogonadism （P < 0.05）. After multivariate adjustment， SUA remained an independent risk factor for hypogonadism ［OR = 1.009， 95%CI （1.004， 1.015）， P = 0.001］. ConclusionsMale HUA patients are often accompanied with hypogonadism. Age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC are independent risk factors of hypogonadism.

A novel method for electroencephalography background analysis in neonates with hypoxic-ischemic encephalopathy / 中国当代儿科杂志

OBJECTIVES@#To explore a new method for electroencephalography (EEG) background analysis in neonates with hypoxic-ischemic encephalopathy (HIE) and its relationship with clinical grading and head magnetic resonance imaging (MRI) grading.@*METHODS@#A retrospective analysis was performed for the video electroencephalography (vEEG) and amplitude-integrated electroencephalography (aEEG) monitoring data within 24 hours after birth of neonates diagnosed with HIE from January 2016 to August 2022. All items of EEG background analysis were enrolled into an assessment system and were scored according to severity to obtain the total EEG score. The correlations of total EEG score with total MRI score and total Sarnat score (TSS, used to evaluate clinical gradings) were analyzed by Spearman correlation analysis. The total EEG score was compared among the neonates with different clinical gradings and among the neonates with different head MRI gradings. The receiver operating characteristic (ROC) curve and the area under thecurve (AUC) were used to evaluate the value of total EEG score in diagnosing moderate/severe head MRI abnormalities and clinical moderate/severe HIE, which was then compared with the aEEG grading method.@*RESULTS@#A total of 50 neonates with HIE were included. The total EEG score was positively correlated with the total head MRI score and TSS (rs=0.840 and 0.611 respectively, P<0.001). There were significant differences in the total EEG score between different clinical grading groups and different head MRI grading groups (P<0.05). The total EEG score and the aEEG grading method had an AUC of 0.936 and 0.617 respectively in judging moderate/severe head MRI abnormalities (P<0.01) and an AUC of 0.887 and 0.796 respectively in judging clinical moderate/severe HIE (P>0.05). The total EEG scores of ≤6 points, 7-13 points, and ≥14 points were defined as mild, moderate, and severe EEG abnormalities respectively, which had the best consistency with clinical grading and head MRI grading (P<0.05).@*CONCLUSIONS@#The new EEG background scoring method can quantitatively reflect the severity of brain injury and can be used for the judgment of brain function in neonates with HIE.

The rules of acupoint selection of acupuncture and moxibustion for scrofula in ancient times / 中国针灸

Based on data mining technology, the rules of acupoint selection of acupuncture-moxibustion for scrofula in ancient times were analyzed. The relevant articles of acupuncture and moxibustion for scrofula were searched in the Chinese Medical Code, and the original article, acupoint name, acupoint characteristic, and acupoint meridian tropism, etc. were screened and extracted. The Microsoft Excel 2019 was used to establish a acupoint prescription database, and the frequency of acupoints as well as their meridian tropism and characteristics were analyzed. The SPSS21.0 was applied to perform cluster analysis of acupuncture prescriptions; the SPSS Modeler 18.0 was used to perform the association rules analysis of the neck and the chest-armpit acupoints, respectively. As a result, 314 acupuncture prescriptions were extracted, including 236 single-acupoint prescriptions and 78 multiple-acupoints prescriptions (53 for neck and 25 for chest-armpit). A total of 54 acupoints were involved, with a total frequency of 530. The top 3 commonly-used acupoints were Tianjing (TE 10), Zulinqi (GB 41) and Taichong (LR 3); the most commonly-used meridians were hand shaoyang meridian, foot shaoyang meridian, hand yangming meridian and foot yangming meridian; the most commonly-used special acupoints were he-sea points and shu-stream points. The cluster analysis obtained 6 clusters, and the association rule analysis obtained that the core prescriptions of the neck were Quchi (LI 11), Jianyu (LI 15), Tianjing (TE 10) and Jianjing (GB 21), while the core prescriptions of the chest-armpit were Daling (PC 7), Yanglingquan (GB 34), Danzhong (CV 17), Jianjing (GB 21), Waiguan (TE 5), Zhigou (TE 6), Yuanye (GB 22) and Zhangmen (LR 13). The core prescriptions obtained from association rule analysis by difference areas were basically consistent with those by cluster analysis of total prescriptions.

Betulinic Acid Improves Cardiac Function in Septic Rats Through AKT / mTOR and AKT / AMPK -modulated Autophagy / 中国生物化学与分子生物学报

Betulinic acid (BA) exerts protective effects on organs in septic animals. However, whether BA can improve cardiac function in sepsis and the underlying mechanism remain unclear. Here, male Sprague-Dawley rats were pretreated with BA (25 mg/ kg/ d, i. g.) for 5 days and then intraperitoneally injected with lipopolysaccharide (LPS, 10 mg/ kg). The rats were anesthetized to determine transthoracic echocardiography using a high-resolution imaging system for small animals after they were treated with LPS for 6 h. Histopathologic alterations were examined by HE staining. Myocardial injury markers (cTnI and CK-MB) and inflammatory factors (TNF-α, IL-1β and IL-6) in the serum were measured by the enzyme-linked immunosorbent assay. Autophagy-related proteins (p62 and LC3 Ⅱ) and AKT-modulated autophagy pathways in the myocardium were determined by Western blotting. Pretreatment with BA markedly improved left ventricular ejection fraction (EF) and fraction shortening (FS) (P<0. 05), improved myocardial histomorphology, and significantly inhibited cTnI, CK-MB, TNF-α, IL-1β and IL-6 (P<0. 05) in the septic rat serum. BA markedly decreased p62 (P<0. 01), increased LC3 Ⅱ (P< 0. 001), and significantly down-regulated p-AKT (Thr308), p-AMPKα (Ser485/ 491), p-mTOR (Ser2448) and p-S6K (Thr389) (P<0. 05), while markedly up-regulated p-AMPKα (Thr172) and pULK1 (Ser317) (P<0. 01) in septic rat hearts. The findings indicate that BA can attenuate sepsis-induced myocardial dysfunctions associated with down-regulating autophagy inhibiting pathways mediated by AKT/ mTOR and AKT/ AMPK pathways.

ADAR1 regulates vascular remodeling in hypoxic pulmonary hypertension through N1-methyladenosine modification of circCDK17

Pulmonary hypertension (PH) is an extremely malignant pulmonary vascular disease of unknown etiology. ADAR1 is an RNA editing enzyme that converts adenosine in RNA to inosine, thereby affecting RNA expression. However, the role of ADAR1 in PH development remains unclear. In the present study, we investigated the biological role and molecular mechanism of ADAR1 in PH pulmonary vascular remodeling. Overexpression of ADAR1 aggravated PH progression and promoted the proliferation of pulmonary artery smooth muscle cells (PASMCs). Conversely, inhibition of ADAR1 produced opposite effects. High-throughput whole transcriptome sequencing showed that ADAR1 was an important regulator of circRNAs in PH. CircCDK17 level was significantly lowered in the serum of PH patients. The effects of ADAR1 on cell cycle progression and proliferation were mediated by circCDK17. ADAR1 affects the stability of circCDK17 by mediating A-to-I modification at the A5 and A293 sites of circCDK17 to prevent it from m1A modification. We demonstrate for the first time that ADAR1 contributes to the PH development, at least partially, through m1A modification of circCDK17 and the subsequent PASMCs proliferation. Our study provides a novel therapeutic strategy for treatment of PH and the evidence for circCDK17 as a potential novel marker for the diagnosis of this disease.

Efficiency and safety analysis of Plerixafor combined with granulocyte colony-stimulating factor on autologous hematopoietic stem cell mobilization in lymphoma / 中华血液学杂志

Objective: To evaluate the advantages and safety of Plerixafor in combination with granulocyte colony-stimulating factor (G-CSF) in autologous hematopoietic stem cell mobilization of lymphoma. Methods: Lymphoma patients who received autologous hematopoietic stem cell mobilization with Plerixafor in combination with G-CSF or G-CSF alone were obtained. The clinical data, the success rate of stem cell collection, hematopoietic reconstitution, and treatment-related adverse reactions between the two groups were evaluated retrospectively. Results: A total of 184 lymphoma patients were included in this analysis, including 115 cases of diffuse large B-cell lymphoma (62.5%) , 16 cases of classical Hodgkin's lymphoma (8.7%) , 11 cases of follicular non-Hodgkin's lymphoma (6.0%) , 10 cases of angioimmunoblastic T-cell lymphoma (5.4%) , 6 cases of mantle cell lymphoma (3.3%) , and 6 cases of anaplastic large cell lymphoma (3.3%) , 6 cases of NK/T-cell lymphoma (3.3%) , 4 cases of Burkitt's lymphoma (2.2%) , 8 cases of other types of B-cell lymphoma (4.3%) , and 2 cases of other types of T-cell lymphoma (1.1%) ; 31 patients had received radiotherapy (16.8%) . The patients in the two groups were recruited with Plerixafor in combination with G-CSF or G-CSF alone. The baseline clinical characteristics of the two groups were basically similar. The patients in the Plerixafor in combination with the G-CSF mobilization group were older, and the number of recurrences and third-line chemotherapy was higher. 100 patients were mobilized with G-CSF alone. The success rate of the collection was 74.0% for one day and 89.0% for two days. 84 patients in the group of Plerixafor combined with G-CSF were recruited successfully with 85.7% for one day and 97.6% for two days. The success rate of mobilization in the group of Plerixafor combined with G-CSF was substantially higher than that in the group of G-CSF alone (P=0.023) . The median number of CD34(+) cells obtained in the mobilization group of Plerixafor combined with G-CSF was 3.9×10(6)/kg. The median number of CD34(+) cells obtained in the G-CSF Mobilization group alone was 3.2×10(6)/kg. The number of CD34(+) cells collected by Plerixafor combined with G-CSF was considerably higher than that in G-CSF alone (P=0.001) . The prevalent adverse reactions in the group of Plerixafor combined with G-CSF were grade 1-2 gastrointestinal reactions (31.2%) and local skin redness (2.4%) . Conclusion: The success rate of autologous hematopoietic stem cell mobilization in lymphoma patients treated with Plerixafor combined with G-CSF is significantly high. The success rate of collection and the absolute count of CD34(+) stem cells were substantially higher than those in the group treated with G-CSF alone. Even in older patients, second-line collection, recurrence, or multiple chemotherapies, the combined mobilization method also has a high success rate of mobilization.

Treatment of neovascular glaucoma by anti-vascular endothelial growth factor combined with ultrasonic ciliary plasty / 国际眼科杂志(Guoji Yanke Zazhi)

AIM: To investigate the clinical efficacy and safety of ultrasonic ciliary plasty(UCP)combined with injection of anti-vascular endothelial growth factor(VEGF)in the treatment of neovascular glaucoma(NVG).METHODS: A total of 30 NVG patients(30 eyes)admitted to the First Affiliated Hospital of Bengbu Medical College from September 2020 to September 2021 were selected. After admission, all the eyes of the patients were injected with anti-VEGF drug(ranibizumab). After surgery, 15 patients were randomly selected for UCP treatment(UCP group), and the other 15 patients received trabeculectomy(trabeculectomy group). During the 10mo postoperative follow-up, the decrease of intraocular pressure was compared between the two groups and the changes of the degree of ocular pain and the occurrence of related complications were evaluated at each follow-up visit.RESULTS: The intraocular pressure and pain degree of the UCP and trabeculectomy groups were significantly lower than those before operation, and the complication probability of the UCP group was less than that of the trabeculectomy group.CONCLUSION: With fewer complications and high safety, UCP combined with anti-VEGF injection can effectively control intraocular pressure and pain in NVG patients.

Recent advances in small molecule inhibitors of interleukin‑1 receptor-associated kinase / 药学学报

Interleukin-1 receptor associated kinase 4 (IRAK-4), acting as a serine threonine kinase, is considered as a key signal node for the transduction of IL-1R family and TLRs signal pathway. Studies have found that IRAK-4 has a hand in many signal pathways, involving the inflammatory response of human joints, intestines, liver and nervous system, as well as other autoimmune diseases. It is also one of the causes of drug resistance of some cancer cells. Therefore, IRAK-4 tends to be an effective therapeutic target for inflammatory diseases and cancer. The prospects for the development of drugs in this pathway is to develop novel IRAK-4 small molecule inhibitors and investigate their safety and effectiveness, enrich the clinical treatment of inflammatory and cancer diseases finally. This paper classified and summarized the latest research progress on small molecule inhibitors of IRAK-4 signaling pathway according to structures of the compounds, in order to provide assistances and references for the research and development of related drugs.

Possible mechanisms of toxic effects of per-and polyfluoroalkyl substances exposure on thyroid / 环境与职业医学

Per- and polyfluoroalkyl substances (PFASs) are persistent organic pollutants (POPs). They are widely used in food packaging, tableware coating, stain resistant furniture, and other industrial production. Humans are exposed to PFASs on a daily basis through drinking water and intaking food, use of consumer products containing PFASs, and occupational exposure during the production of PFASs or related products. A growing body of toxicological studies has shown that PFASs exposure disrupts the thyroid hormone (TH) system and causes hypothyroidism, which is further supported by population epidemiological studies. PFASs can damage thyroid follicular cells and sodium/iodine transporters to impair iodine uptake by thyroid cells. They interfere with the synthesis of thyroglobulin, reduce the activity of thyroid peroxidase, and affect the synthesis and secretion of TH. They interfere with TH transportation and biological effects via TH competitive binding thyroid transporter or thyroid hormone receptor. They suppress TH signaling pathway and deiodinase activity, interfere negative feedback mechanism, and accelerate TH metabolism and excretion. The processes of TH synthesis, transport, degradation, and biological effects may all be affected by PFASs exposure. This paper described possible toxic mechanisms of PFASs on the thyroid from four aspects: TH biosynthesis, transport, action on target cells, and metabolic excretion stage, and summarized the thyroid toxicity associated with PFASs exposure.

To explore the quality markers of Huangqin Qingre Chubi capsule in the treatment of rheumatoid arthritis based on network pharmacology combined with pharmacokinetics and target verification / 药学学报

As an effective prescription for the treatment of rheumatoid arthritis (RA), Huangqin Qingre Chubi capsule (HQC) is still blank in quality control. This study aims to explore quality markers (Q-markers) for HQC in the treatment of RA by integrating network pharmacology and pharmacokinetics. By constructing the visualization network of "pharmacodynamic ingredient-target-pathway", the potential Q-Marker of HQC treatment for RA was preliminatively predicted. A rat model of rheumatic heat obstruction syndrome collagene-induced arthritis (CIA) was established to elucidate the dynamic quantification law of pharmacodynamic components of HQC in the disease state of rats. To establish the inflammatory model of RA synovial fibroblasts (MH7A) induced by tumor necrosis factor-α (TNF-α) in vitro. The effects of active ingredients on protein expression of sphingosin kinase-1 (Sphk1) and p-SphK1 were detected. The network pharmacological results showed that baicalin, geniposide, luteolin, coixol and amygdalin were the important active components of HQC treatment for RA. Quantitative analysis results further verified the measurability of these five components. The expression of Sphk1 and p-SphK1 was significantly inhibited by geniposide and baicalin by Western blotting. The above studies determined that the above 5 components could be used as Q-markers in the treatment of RA by HQC. This experiment was approved by the Experimental Animal Ethics Committee of Anhui University of Chinese Medicine (approval number: AHUCM-rats-2021049). All procedures were conducted in strict accordance with the principles of animal use and care.

Effect of Zishenwan on Intestinal Barrier and Transcriptome of Skeletal Muscle of db/db Diabetic Mice / 中国实验方剂学杂志

ObjectiveTo explore the effect of Zishenwan on glucose and lipid metabolism in spontaneous type 2 diabetes （db/db） mice and investigate the underlying mechanism for improving diabetes based on intestinal barrier function and skeletal muscle transcriptome sequencing results. MethodLiquid chromatography-tandem mass spectrometry （LC-MS/MS） was used to analyze the components of Zishenwan. Sixteen 6-week-old db/db mice were divided into a model group and a Zishenwan group， while eight wild-type mice were assigned to the normal group. The Zishenwan group received oral administration of drugs for six weeks， during which fasting blood glucose， body weight， and food intake were measured. Serum total cholesterol （TC） and triglyceride （TG） levels were determined， and fasting insulin levels were measured to calculate the homeostatic model assessment of insulin resistance （HOMA-IR）. After the treatment， skeletal muscle and ileum tissues were collected， followed by hematoxylin-eosin （HE） staining. Immunohistochemistry was used to detect the expression of tight junction proteins occludin and zonula occludens-1 （ZO-1） in the ileum. Transcriptome sequencing was performed to detect the skeletal muscle transcriptome， and enrichment analysis was conducted for differentially expressed genes. ResultMultiple active components were identified in Zishenwan. Compared with the normal group， the model group showed increased fasting blood glucose， body weight， TC， TG， and HOMA-IR （P<0.01）. Compared with the model group， Zishenwan significantly reduced fasting blood glucose， body weight， TC， TG， and HOMA-IR in db/db mice （P<0.01）， while there was no statistically significant difference in food intake. Compared with the normal group， the model group exhibited lipid deposition in skeletal muscle， as well as structural changes in the ileum， with significant decreases in the protein expression levels of intestinal occludin and ZO-1 （P<0.01）. Compared with the model group， Zishenwan improved the pathological changes in skeletal muscle and ileum， and increased the protein expression of occludin and ZO-1 in the ileum （P<0.01）. Transcriptome analysis suggested that Zishenwan might improve skeletal muscle metabolism and increase insulin sensitivity in mice. ConclusionZishenwan can improve glucose and lipid metabolism in db/db mice， and this effect may be related to its protection of intestinal barrier function and transcriptional regulation of skeletal muscle metabolism-related genes.

A case of neonatal-onset type I hyperlipoproteinemia with bloody ascites / 中国当代儿科杂志

This report presents a case of a male infant, aged 32 days, who was admitted to the hospital due to 2 days of bloody stools and 1 day of fever. Upon admission, venous blood samples were collected, which appeared pink. Blood biochemistry tests revealed elevated levels of triglycerides and total cholesterol. The familial whole genome sequencing revealed a compound heterozygous variation in the LPL gene, with one variation inherited from the father and the other from the mother. The patient was diagnosed with lipoprotein lipase deficiency-related hyperlipoproteinemia. Acute symptoms including bloody stools, fever, and bloody ascites led to the consideration of acute pancreatitis, and the treatment involved fasting, plasma exchange, and whole blood exchange. Following the definitive diagnosis based on the genetic results, the patient was given a low-fat diet and received treatment with fat-soluble vitamins and trace elements, as well as adjustments to the feeding plan. After a 4-week hospitalization, the patient's condition improved and he was discharged. Follow-up showed a decrease in triglycerides and total cholesterol levels. At the age of 1 year, the patient's growth and psychomotor development were normal. This article emphasizes the multidisciplinary diagnosis and treatment of familial hyperlipoproteinemia presenting with symptoms suggestive of acute pancreatitis, including bloody ascites, in the neonatal period.

Research progress in mechanism of puerarin in treating vascular dementia / 中国中药杂志

Vascular dementia(VD) is a condition of cognitive impairment due to acute and chronic cerebral hypoperfusion. The available therapies for VD mainly focus on mitigating cerebral ischemia, improving cognitive function, and controlling mental behavior. Achievements have been made in the basic and clinical research on the treatment of VD with traditional Chinese medicine(TCM) active components, including Ginkgo leaf extract, puerarin, epimedium, tanshinone, and ginsenoside. Most of these components have anti-inflammatory, anti-apoptotic, anti-oxidant, and neuroprotective effects, and puerarin demonstrates excellent performance in mitigating cholinergic nervous system disorders and improving synaptic plasticity. Puerarin, ginkgetin, and epimedium are all flavonoids, while tanshinone is a diterpenoid. Puerariae Lobatae Radix, pungent in nature, can induce clear Yang to reach the cerebral orifices and has the wind medicine functions of ascending, dispersing, moving, and scurrying. Puerariae Lobatae Radix entering collaterals will dredge blood vessels to promote blood flow, and that entering the sweat pore will open the mind, which is in line with the TCM pathogenesis characteristics of VD. This study reviews the progress in the mechanism of puerarin, the main active component of Puerariae Lobatae Radix, in treating VD. Puerarin can ameliorate cholinergic nervous system disorders, reduce excitotoxicity, anti-inflammation, inhibit apoptosis, alleviate oxidative stress injury, enhance synaptic plasticity, up-regulate neuroprotective factor expression, promote cerebral circulation metabolism, and mitigate Aβ injury. The pathways of action include activating nuclear factor erythroid 2-related factor 2(Nrf2)/antioxidant response element(ARE), vascular endothelial growth factor(VEGF), extracellular regulated protein kinases(ERK), phosphatidylinositol-3-kinase(PI3K)/protein kinase B(Akt), Janus-activating kinase 2(JAK2)/signal transducer and activator of transcription 3(STAT3), AMP-activated protein kinase(AMPK), as well as inhibiting the tumor necrosis factor α(TNF-α), transient receptor potential melastatin 2(TRPM2)/N-methyl-D-aspartate receptor(NMDAR), p38 mitogen-activated protein kinase(p38 MAPK), Toll-like receptor 4(TLR4)/nuclear factor-kappaB(NF-κB), early growth response 1(Egr-1), and matrix metalloproteinase 9(MMP-9). By reviewing the papers about the treatment of VD by puerarin published by CNKI, Wanfang, VIP, PubMed, and Web of Science in the last 10 years, this study aims to support the treatment and drug development for VD.

Remifentanil Down-regulates GIRK2 Expression in Rat Dorsal Root Ganglion and Spinal Dorsal Horn / 中山大学学报(医学科学版)

ObjectiveTo observe the changes in the expression and distribution of G protein-gated inwardly rectifying potassium channel subunit 2 （GIRK2） in the dorsal root ganglion （DRG） and spinal cord dorsal horn of rats with remifentanil-induced hyperalgesia. MethodsHyperalgesia was induced by intravenous infusion of remifentanil 4 μg/kg/min for 2 h in adult male SD rats. At 6th hour and on days 1， 3 and 5 following remifentanil treatment， we used immunofluorescence to examine the changes in the GIRK2 distribution and expression. Immunoblotting was used to detect GIRK2 expression of the total protein and membrane protein in DRG and spinal dorsal horn of rats. Behavioral testing was applied to evaluate the effect of intrathecal injection of GIRK2-specific agonist ML297 on thermal nociceptive threshold on day 1 after remifentanil infusion. Resultsmmunofluorescence results showed that GIRK2 was mainly co-localized with IB4-positive small neurons in DRG and nerve fibers in spinal dorsal horn. GIRK2 expression was significantly downregulated following remifentanil treatment. Immunoblotting results revealed that on day 1 following intravenous infusion of remifentanil， compared with those in the control group， GIRK2 expression levels of the total protein and membrane protein in DRG （0.47 ± 0.10 vs. 1.01 ± 0.17， P < 0.001； 0.47 ± 0.11 vs. 1.06 ± 0.12， P < 0.001） and spinal dorsal horn （0.52 ± 0.09 vs. 1.10 ± 0.08， P < 0.001； 0.54 ± 0.10 vs. 1.01 ± 0.13， P < 0.001） were all significantly decreased. The behavioral results showed that intrathecal ML297 effect on thermal withdrawal latency was significantly reduced following remifentanil treatment （P < 0.001）. ConclusionsRemifentanil might induce hyperalgesia via down-regulating GIRK2 expression in rat DRG and spinal cord dorsal horn.

Clinical symptoms and distribution characteristics traditional Chinese medicine syndromes of pulmonary nodules / 中国中药杂志

A cross-sectional study method combined with two types of traditional Chinese medicine(TCM) syndrome differentiation methods was adopted to investigate the clinical symptoms and distribution characteristics of TCM syndromes in patients with pulmonary nodules from the perspectives of number, size, nature, and stability of pulmonary nodules by using the χ~2 test, systematic clustering and Apriori algorithm correlation analysis. The common clinical symptoms of pulmonary nodules were fatigue(77.35%) and irritability(75.40%), and 40 symptoms were clustered into 3 groups(digestive system symptoms, respiratory system symptoms, and emotional and systemic symptoms) and 8 major symptom categories. The proportion of cold and heat in complexity syndrome(63.43%) was higher based on cold-heat syndrome differentiation. The top two syndromes were Qi deficiency syndrome(88.03%) and Qi depression syndrome(83.17%) based on disease syndrome differentiation. Yang deficiency syndrome(60.52%) was more than Yin deficiency syndrome(50.16%). There were higher proportions of phlegm syndrome(78.67%) and Yang deficiency syndrome(69.33%) of so-litary pulmonary nodules in terms of the number of pulmonary nodules. In terms of size, the proportion of phlegm syndrome decreased as the mean diameter of pulmonary nodules increased, while the proportions of Yang deficiency syndrome and blood stasis syndrome increased. The distribution of Qi depression syndrome was more in those with mean diameter<10 mm(85.02%, P=0.044) and cold syndrome was more in those with mean diameter ≥10 mm(16.67%, P=0.024). In terms of the nature of pulmonary nodules, the proportions of Qi depression syndrome and heat syndrome decreased with the increase in solid components of pulmonary nodules, while the proportions of Yin deficiency syndrome and cold and heat in complexity syndrome increased. The blood stasis syndrome accounted for a higher proportion of pulmonary nodules with solid components. In terms of the stability of pulmonary nodules, dampness syndrome(72.97%), blood stasis syndrome(37.84%), and cold and heat in complexity syndrome(70.27%) accounted for higher proportions. In addition, patients with new nodules presented higher proportions in Qi inversion syndrome(52.00%, P=0.007) and cold and heat in complexity syndrome(66.00%, P=0.008). Meanwhile, 11 syndromes were associated and 4 common compound syndromes were obtained(Qi deficiency and depression syndrome, Qi depression and phlegm coagulation syndrome, Qi deficiency and phlegm coagulation syndrome, and Qi deficiency and dampness obstruction syndrome). Qi deficiency syndrome and Qi depression syndrome could be associated with other syndromes. The results show that the main clinical symptoms of pulmonary nodules are fatigue and irritability. The main TCM syndromes of pulmonary nodules are Qi deficiency syndrome, Qi depression syndrome, Yang deficiency syndrome, and cold and heat in complexity syndrome. The distribution of TCM syndromes is significantly correlated with the size of pulmonary nodules and the presence or absence of new nodules. The common compound syndromes are Qi deficiency and depression syndrome, Qi depression and phlegm coagulation syndrome, Qi deficiency and phlegm coagulation syndrome, and Qi deficiency and dampness obstruction syndrome.