Mechanism of cleft palate in C57BL/6N mice induced by 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin / 中华口腔医学杂志

Objective: To explore the molecular mechanism of cleft palate in mice induced by 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD). Methods: The pregnant mice were randomly divided into TCDD-treated group (n=42) and control group (n=42). TCDD-treated group was given by gavage a single dose of TCDD (64 μg/kg) at 8: 00 AM on gestation day 10 (GD10) and the control group was given by gavage the isopyknic corn oil. At GD13-GD15, the fetal mice palate development was observed by HE staining. The mouse embryonic palatal mesenchymal cell proliferation was detected by 5-bromo-2-deoxyuridine (BrdU) immunofluorescence. The localization and expression of maternally expressed gene3 (MEG3) in mouse embryonic palatal mesenchymal cells was detected by situ hybridization and real-time PCR (RT-PCR). The key protein expressions of transforming growth factor-β (TGF-β)/Smad signaling pathway in mouse embryonic palatal mesenchyme were analyzed by Western blotting. The interaction of MEG3 and TGF-β receptor Ⅰ (TGF-βRⅠ) was examined by RNA binding protein immunoprecipitation (RIP). Results: At GD13 and GD14, compared with the control group, the ratio of BrdU-positive cells in the palatal mesenchyme of TCDD-treated fetuses decreased significantly (GD13, t=6.66, P=0.003; GD14, t=6.56, P=0.003). However, at GD15, the ratio of BrdU-positive cells was significantly increased (t=-5.98, P=0.004). MEG3 was mainly expressed in the nuclei of fetal mouse palatal mesenchymal cells, and the expression of MEG3 in TCDD group was significantly increased at GD13, GD14 and GD15(GD13, t=39.28, P=0.012; GD14, t=18.75, P=0.042; GD15, t=28.36, P=0.045). At GD14, TCDD decreased the levels of p-Smad2 and Smad4 in embryonic palate mesenchymal cells (p-Smad2, t=9.48, P=0.001;Smad4, t=63.10, P=0.001), whereas the expression of Smad7 was significantly increased at GD14 (t=30.77, P<0.001). The results of the RIP experiment showed that the amount of TGF-βRⅠ-bound MEG3 in mouse embryonic palatal mesenchymal cells in the TCDD group (23.940±1.301) was higher than that in the control group (8.537±1.523)(t=24.55, P<0.001). Conclusions: MEG3 is involved in the suppression of mouse embryonic palatal mesenchymal cell proliferation, functioning at least in part via interacting with the TGF-βRⅠ protein and thereby suppressing Smad signaling in the context of TCDD induced cleft palate.

Feasibility and safety of bridge therapy with active fixed electrodes connected to external permanent pacemakers for patients with infective endocarditis after lead removal and before permanent pacemaker implantation / 中华心血管病杂志

Objective: To analyze the feasibility and safety of bridge therapy with active fixed electrodes connected to external permanent pacemakers (AFLEP) for patients with infective endocarditis after lead removal and before permanent pacemaker implantation. Methods: A total of 44 pacemaker-dependent patients, who underwent lead removal due to infective endocarditis in our center from January 2015 to January 2020, were included. According to AFLEP or temporary pacemaker option during the transition period, patients were divided into AFLEP group or temporary pacemaker group. Information including age, sex, comorbidities, indications and types of cardial implantable electionic device (CIED) implantation, lead age, duration of temporary pacemaker or AFLEP use, and perioperative complications were collected through Haitai Medical Record System. The incidence of pacemaker perception, abnormal pacing function, lead perforation, lead dislocation, lead vegetation, cardiac tamponade, pulmonary embolism, death and newly infection of implanted pacemaker were compared between the two groups. Pneumothorax, hematoma and the incidence of deep vein thrombosis were also analyzed. Results: Among the 44 patients, 24 were in the AFLEP group and 20 in the temporary pacemaker group. Age was younger in the AFLEP group than in the temporary pacemaker group (57.5(45.5, 66.0) years vs. 67.0(57.3, 71.8) years, P=0.023). Male, prevalence of hypertension, diabetes mellitus, chronic renal dysfunction and old myocardial infarction were similar between the two groups (all P>0.05). Lead duration was 11.0(8.0,13.0) years in the AFLEP group and 8.5(7.0,13.0) years in the temporary pacemaker group(P=0.292). Lead vegetation diameter was (8.2±2.4)mm in the AFLEP group and (9.1±3.0)mm in the temporary pacemaker group. Lead removal was successful in all patients. The follow-up time in the AFLEP group was 23.0(20.5, 25.5) months, and the temporary pacemaker group was 17.0(14.5, 18.5) months. In the temporary pacemaker group, there were 2 cases (10.0%) of lead dislocation, 2 cases (10.0%) of sensory dysfunction, 2 cases (10.0%) of pacing dysfunction, and 2 cases (10.0%) of death. In the AFLEP group, there were 2 cases of abnormal pacing function, which improved after adjusting the output voltage of the pacemaker, there was no lead dislocation, abnormal perception and death. Femoral vein access was used in 8 patients (40.0%) in the temporary pacemaker group, and 4 patients developed lower extremity deep venous thrombosis. There was no deep venous thrombosis in the AFLEP group. The transition treatment time was significantly longer in the AFLEP group than in the temporary pacemaker group (19.5(16.0, 25.8) days vs. 14.0(12.0, 16.8) days, P=0.001). During the follow-up period, there were no reinfections with newly implanted pacemakers in the AFLEP group, and reinfection occurred in 2 patients (10.0%) in the temporary pacemaker group. Conclusions: Bridge therapy with AFLEP for patients with infective endocarditis after lead removal and before permanent pacemaker implantation is feasible and safe. Compared with temporary pacemaker, AFLEP is safer in the implantation process and more stable with lower lead dislocation rate, less sensory and pacing dysfunction.

A comparative study on the application of different methods of occupation health risk assessment in small furniture manufacturing industry / 预防医学

Objective To compare the applicability of different occupational health risk assessment methods in small furniture manufacturing industry. Methods American EPA inhalation risk model, Singapore semi-quantitative risk assessment model of occupational exposure to chemical substances and Australian Occupational Health and Safety Risk Assessment model, were used to assess the occupational health risk in a small furniture manufacturing industry from a city of Zhejiang Province. Results The results of American EPA model showed that the workers who exposed to benzene and formaldehyde had low risk of carcinogens, and who exposed to benzene and xylene had very high risk of non-carcinogens. According to Singapore semi-quantitative risk assessment model, there were low and medium health risk caused by toluene and xylene, and high risk caused by wood dust in preparation and polishing jobs. Similar to the results of other models, Australia qualitative risk assessment model showed that there were medium health risk caused by toluene and xylene, and high risk caused by benzene, wood dust and noise. All of the three methods could found the key risk control point in furniture manufacturing industry. The risk ratios of the three methods were higher than the toxic work classification ratio (P<0.01), and the risk ratio of EPA model were higher than the results of Singapore model and Australia model (P<0.05) . Conclusion All of the three methods can be applied to assess the occupational health risk in furniture manufacturing industry, and the combined application of multiple risk assessment methods can be used as one of the risk assessment strategies.

Maternal Lead Exposure Induces Down-regulation of Hippocampal Insulin-degrading Enzyme and Nerve Growth Factor Expression in Mouse Pups / 生物医学与环境科学（英文）

Lead exposure is a known potential risk factor for neurodegenerative diseases such as Alzheimer's disease (AD). Exposure to lead during the critical phase of brain development has been linked with mental retardation and hypophrenia in later life. This study was aimed to investigate the effects of lead exposure of pregnant mice on the expressions of insulin-degrading enzyme (IDE) and nerve growth factor (NGF) in the hippocampus of their offspring. Blood samples were collected from the tail vein, and after anesthetizing the pups, the brain was excised on postnatal day 21. Lead concentrations were determined by graphite furnace atomic absorption spectrophotometry, and the expressions of IDE and NGF were determined by immunohistochemistry and Western blotting. Results showed that the reduction in IDE and NGF expression in the hippocampus of pups might be associated with impairment of learning and memory and dementia induced by maternal lead exposure during pregnancy and lactation.

A study on the health status of empty nesters with type 2 diabetes living in mountain area / 预防医学

Objective TolearnthehealthstatusofemptynesterswithdiabetesinthemountainssouthwestofZhejiangand toexploretheinfluencingfactors.Methods Usingthemethodofstratified-random-clustersampling,78emptynesters with diabetes and 1 56 non -empty nesters with diabetes who come from five streets and 1 0 towns of 30 community (or village)were selected and investigated by questionnaire and physical examination were conducted.Univariate analysis were conducted to compare the differences about lifestyle,biochemical indicators and health status between the two groups and multivariateunconditionallogisticregressionanalysiswereconductedtoanalyzetheinfluencingfactors.Results The prevalence of hypertension of empty nest group was 70.51%,and the prevalence of hypertension of non-empty nest group was 58.97%.Fasting blood glucose level of empty nest group was 9.39 ±5.73 mmol/L,higher than that of the non-empty nest group(P<0.05 ).There was significant difference between the two groups in other indicators,such as drinking rate,high -salt diet rate,obesity rate,triglyceride levels,regular exercise rate,vegetables/fruits ≥4 days/week proportion,fish/meat≥4 days/week,awareness of their own blood pressure and blood sugar awareness (P<0.05).After adjustment for age,the obesity rate,abnormal rate of triglycerides,fish/meat(≥4 days/week)intake,regular exercise rate,blood pressure and blood sugar awareness rate were lower among non-empty nesters with diabetes,and overweight rate,systolic blood pressure abnormal rate,fasting glucose ratio,alcohol and high salt diet were higher in empty nest group patientswithdiabetes.Conclusion Emptynesterswithdiabeteshavearelativelyhighproportionoflackofexercise, inadequate nutrition intake,alcohol consumption,high-salt diet and lack of health knowledge and other unhealthy factors. The community health services and individual guidance for the empty nesters should be strengthened to improve the health status of empty nesters with diabetes.

Patients with cervical Ureaplasma Urealyticum and Chlamydia Trachomatis infection undergoing IVF/ICSI-ET: The need for new paradigm / 华中科技大学学报（医学）（英德文版）

Genital tract infections with ureaplasma urealyticum (UU) and chlamydia trachomatis (CT) are the most frequent sexually-transmitted disease worldwide. UU and CT infections are considered to be the leading cause for infertility and adverse pregnancy outcomes. However, little is known about the specific effect of cervical UU and CT infections on the etiology of female infertility, as well as the pregnancy outcomes of the patients undergoing in vitro fertilization/intracytoplasmic sperm injection-embryo transfer (IVF/ICSI-ET). In order to find the association between cervical UU and/or CT infection and pregnancy outcomes, we conducted a retrospective case-control study on the patients undergoing IVF/ICSI-ET with cervical UU and/or CT infection. A total of 2208 patients who received IVF/ICSI-ET were enrolled in this study. Data on the general conditions, pregnancy history and clinical pregnant outcomes were analyzed in terms of the cervical UU and CT detection. Our results revealed that cervical UU and CT infections were the risk factors for ectopic pregnancy and tubal factor-induced infertility. Moreover, the pregnancy rate, abortion rate, ectopic pregnancy rate and premature birth rate in patients with UU and/or CT infections showed no significant difference when compared with the control group. We recommend that cervical UU and CT detection should be an optional item for infertility patients and clinical UU detection should differentiate the subtypes of cervical UU. Positive cervical UU and CT infections should not be taken as strict contraindications for IVF/ICSI-ET.

Biodistribution and preparation of technetium-99m-labeled D-D₃ monoclonal antibody against pro-gastrin-releasing peptide (₃₁₋₉₈) in mice / 中华医学杂志(英文版)

<p><b>BACKGROUND</b>We previously reported that iodine-131((131)I)-labeled anti-pro-gastrin-releasing peptide (ProGRP(31-98)) monoclonal antibody D-D3 could selectively accumulate in the tumor sites of nude mice bearing small cell lung cancer (SCLC) xenografts. However, (131)I-D-D3 was cleared slowly from the body, and the best radioimmunoimaging time for SCLC was 72 - 96 hours after injection. The aims of this study were to radiolabel anti-ProGRP(31-98) D-D3 monoclonal antibody with technetium-99m ((99m)Tc) and to investigate the biodistribution of this antibody in healthy ICR mice.</p><p><b>METHODS</b>D-D3 was labeled with (99m)Tc via the 2-mercaptoethanol reduction method. (99m)Tc-D-D3 was purified by the gel column separation method. The labeling efficiency and radiochemical purity were measured by thin-layer chromatography. The immunological activity of (99m)Tc-D-D3 was determined with cell conjugation assays. (99m)Tc-D-D3 was injected into healthy ICR mice via a tail vein, and all the healthy ICR mice were sacrificed by cervical dislocation at a designated time. Then, the blood and major organs were removed and weighed, and counted in a gamma scintillation counter to determine the percentage of the injected dose per gram (%ID/g).</p><p><b>RESULTS</b>The labeling rate and the radiochemical purity of (99m)Tc-D-D3 were (73.87 ± 2.89)% and (94.13 ± 4.49)%, respectively. The immunobinding rates of (99m)Tc-D-D3 to the human small cell lung cancer NCI-H446 cell line and lung adenocarcinoma A549 cell line were (81.2 ± 2.37)% and (24.3 ± 1.46)%, respectively. The distribution data of normal ICR mice demonstrated that (99m)Tc-D-D3 was mainly distributed in the liver, kidney and lung, and less in the brain tissue and muscle.</p><p><b>CONCLUSIONS</b>(99m)Tc-D-D3 antibody not only had high radiochemical purity, but also had good stability both in vitro and in vivo, and maintained good immunological activity. (99m)Tc-D-D3 was metabolized mainly in the kidney and liver, and the blood radioactivity decreased rapidly. Thus, (99m)Tc-D-D3 is conducive to the radioimmunoimaging of SCLC.</p>

Association between chronic obstructive pulmonary disease and lung cancer: the missing link / 中华医学杂志(英文版)

<p><b>OBJECTIVE</b>This review focuses on current knowledge of specific processes that drive chronic airway inflammation which are important in the pathogenesis of both chronic obstructive pulmonary disease (COPD) and lung cancer.</p><p><b>DATA SOURCES</b>The data used in this review were obtained mainly from studies reported in the PubMed database (1997 - 2012) using the terms of COPD and lung cancer.</p><p><b>STUDY SELECTION</b>Data from published articles about prevalence of COPD-lung cancer overlap and mechanism involved in lung cancer development in COPD were identified, retrieved and reviewed.</p><p><b>RESULTS</b>COPD prevalence, morbidity and mortality vary and are directly related to the prevalence of tobacco smoking except in developing countries where air pollution resulting from the burning of biomass fuels is also important. COPD is characterized by a chronic inflammation of lower airway and, importantly, the presence of COPD increases the risk of lung cancer up to 4.5 fold among long-term smokers. COPD is by far the greatest risk factor for lung cancer amongst smokers and is found in 50% - 90% of patients with lung cancer.</p><p><b>CONCLUSIONS</b>Both COPD and lung cancer are tobacco smoking-associated chronic diseases that cluster in families and aggravate with age, and 50% - 70% of patients diagnosed with lung cancer have declined spirometric evidence of COPD. Understanding and targeting common pathogenic mechanisms for lung cancer and COPD would have potential diagnostic and therapeutic implications for patients with these lung diseases and for people at risk.</p>

Effect of soluble PD-L1 released by lung cancer cells in regulating the function of T lymphocytes / 中华肿瘤杂志

<p><b>OBJECTIVE</b>To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes.</p><p><b>METHODS</b>Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation.</p><p><b>RESULTS</b>Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes.</p><p><b>CONCLUSIONS</b>Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.</p>

Acute pulmonary embolism: the clinical conundrum / 中华医学杂志(英文版)

Despite important advances in the diagnosis and treatment of acute pulmonary embolism (APE), assessment of risk and appropriate management of patients remains a difficult task in clinical practice. In addition to hemodynamic instability and critically clinical condition, acute right ventricular dysfunction (RVD) is a major determinant of in-hospital outcomes. The purpose of this review is to discuss the results of these recent developments. Some outcome evaluation, clinical assessment, and therapeutic implications are also included.

The experimental study of radionuclide imaging and treatment of cervical cancer mediated by hNIS gene transfection / 中华核医学杂志

Objective To explore the feasibility of imaging and treatment of cervical cancer xenograft model using 131I mediated by hNIS gene transfection. Methods The cervical cancer xenograft models were established with Hela-NIS( +) cells and Hela cells, respectively. Five Hela-NIS( +) xenograft models and five Hela xenograft models were dynamically imaged at 0.5, 1, 2, 4, 8, 16 and 20 h postinjection of 131I(7.4 MBq). Five Hela-NIS( +) xenograft models were imaged at 0. 5,1,2,4,8,16, 20 and 25 h postinjection of 99TcmO4-(11.1 MBq). Twenty Hela-NIS( +) cervical cancer xenograft models were randomly divided into four groups: Three 131I treating groups and one control group. The therapeutic effects of 131I at threelevels (74,111,148 MBq) were investigated following intraperitoneal injection. Results Hela-NIS( +)human cervical cancer xenografts were established successfully in nude mice. The Hela-NIS( +) xenografts significantly accumulated radioactivity after intraperitoneal injection of 131I, and the radioactivity was persistently present until 20 h postinjection, but Hela xenografts had no radioactive accumulation. The T/B value of the Hela-NIS( +) xenografts reached 17.34 at 8 h postinjection. The imaging with 99TcmO4- showed that the radioactivity was persistently present in Hela-NIS( +) xenografts for almost 25 h. The Hela-NIS( +)xenografts shrinked after 131I treatment. The inhibition ratios of tumor growth in 111 MBq and 148 MBq groups were both significantly higher than that of 74 MBq group (t: 2.74-5.75, P ＜0.05). Conclusions Hela-NIS( +) cervical cancer xenografts in nude mice could persistently accumulate 131I and 99TcmO4- and could be treated successfully with 131 I. 131 I treatment mediated by hNIS gene transfection could be a promising cancer treatment method.

Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells / 中华肿瘤杂志

<p><b>OBJECTIVE</b>To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.</p><p><b>METHODS</b>PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.</p><p><b>RESULTS</b>The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.</p><p><b>CONCLUSION</b>Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.</p>

Adenovirus-mediated and tumor-specific transgene expression of the sodium-iodide symporter from the human telomerase reverse transcriptase promoter enhances killing of lung cancer cell line in vitro / 中华医学杂志(英文版)

<p><b>BACKGROUND</b>The sodium-iodide symporter (NIS) protein can mediate the active radioiodine uptake. The human telomerase reverse transcriptase (hTERT) promoter is known to be selectively reactivated in majority of tumors and hence could be used for tumor targeting. We constructed a recombinant adenovirus containing the human sodium iodide symporter (hNIS) gene directed by the hTERT promoter, characterized the ability of infected cells in uptaking iodide, and explored the therapeutic efficacy of (131)I in a lung cancer cell line in vitro.</p><p><b>METHODS</b>The hTERT promoter was amplified by PCR from DNA isolated from log-phase HepG2 cells, subcloned into lineralized FL*-hNIS/pcDNA3, and then the hTERT-hNIS sequence was subcloned into the shuttle plasmid pAdTrack. The recombinant adenovirus Ad-hTERT-hNIS was constructed by AdEasy system. A positive control adenovirus Ad-CMV-hNIS and a negative control adenovirus Ad-CMV were created similarly. A549 cells were transduced with recombinant adenoviruses. (125)I uptake studies and sodium perchlorate suppression studies were used to confirm hNIS expression and function. Toxic effects of (131)I on tumor cells were studied by in vitro clonogenic assay.</p><p><b>RESULTS</b>We first successfully constructed an adenovirus mediated transgene expression system of the hNIS under the control of hTERT promoter. When infected with recombinant adenovirus constructs expressing hNIS directed by hTERT- and CMV-promoters (Ad-hTERT-hNIS and Ad-CMV-hNIS, respectively), the lung cancer cell line A549 had increased ability to uptake radioiodide up to 23- and 30-fold compared to the control parental cells, respectively. The radioiodide uptake ability of both the Ad-CMV-hNIS and Ad-hTERT-hNIS transduced cell lines were repressed 11-fold by sodium perchlorate (NaClO4). The subsequent in vitro clonogenic assay of the infected A549 cell line was further repressed to 23% (Ad-CMV-hNIS) and 30% (Ad-hTERT-hNIS) of the control group after receiving radioiodide for 7 hours (P < 0.001).</p><p><b>CONCLUSION</b>Our preliminary study indicates that an adenovirus mediated transgene expression system of the hNIS under the control of hTERT promoter has the potential to become an effective wide-spectrum yet highly specific anti-cancer strategy.</p>

Biodistribution and radioimmunoimaging of 131 I-Herceptin in healthy KM mice and nude mouse models bearing human ovarian cancer xenografts / 中华核医学杂志

Objective To study the biodistribution of anti-HER-2/neu monoclonal antibody Herceptin labeled by 131I(131I-Herceptin) in healthy KM mice and nude mice bearing human ovarian cancer xenografts and radioimmunoimaging (RII) of the nude xenografts-bearing mice.Methods 131I-Herceptin was prepared using Iodogen method.The labeling efficiency, radiochemical purity, stability and immunocompetence were measured.The percentage activity of injection dose per gram of tissue (%ID/g) and the radioactivity ratio of tumor to non-tumor tissue (T/NT) were calculated for each time point.The optimal time for imaging was investigated by comparing the 131I-Herceptin SPECT for the nude mouse models bearing ovarian cancer xenografts at different time points.Results The labeling efficiency and radiochemical purity of 131I-Herceptin were 89.8% and 98.4%, respectively.The labeling was stable and had good immunocompetence.131 I-Herceptin was cleared rapidly mainly through liver, spleen and kidneys, consistent with first order two-compartment model.The uptake of 131I-Herceptin in the tumors bearing human SKOV-3 xenografts was much higher than that in nontumor tissue.The% ID/g was 18.08 in the tumor at 24 h post injection.The T/NT ratio increased with time and was 27.27 at 72 h post injection.The tumors in nude mice bearing SKOV-3 xenografts could be visualized on 131I-Herceptin SPECT imaging 2 h post injection; definitely identiffed 48 h post injection and the radioactivity ratio of tumor to contralateral tissue was 11.44 at 120 h post injection.However, the tumor in nude mice bearing HO-8910 xenografts did not show abnormal uptake of 131 I-Herceptin at each time point.Conclusions 131 I-Herceptin is a good radiopharmaceutical targeting SK-OV-3 xeuografts and it may be useful in imaging carcinoma of ovary and target therapy of its metastases with high HER-2/neu expression.

Present situation and prospects of acupuncture and moxibustion in United Kingdom / 中国针灸

The present paper reviews the development courses of acupuncture and moxibustion and gives an introduction to the present situation, education and legislation of acupuncture and moxibustion in United Kingdom. Acupuncture and moxibustion have been developed in United Kingdom since 1960s, the London College of TCM was established by Beijing University of Chinese Medicine join forced with Acu-medic Foundation in 1993, and so far, acupuncture has been taught as an undergraduate program in four United Kingdom universities. Since 2002, the British government and Ministry of Health have begun on the legislation of Chinese Medicine and acupuncture and moxibustion, the lawmaking group of Ministry of Health in British submitted a bill about the legislation of acupuncture and herbal medicine as well as Chinese Medicine to the British government in 2008. Clinical levels of acupuncture workers are quite different and the therapy of acupuncture and moxibustion for nearly 20 diseases displays certain effect. The government or one's own can pay the expenses for acupuncture and moxibustion treatment.

Treatment of 23 Cases of Supraorbital Neuralgia by Acupuncture plus Semi-conductive Laser / 针灸推拿医学（英文版）

23 cases of the patients with supraorbital neuralgia were treated by puncturing Yangbai (GB 14) toward Yuyao (Extra), Zanzhu (BL 2), Taiyang (Extra), Touwei (ST 8),Zhongzhu (TE 3) and Neiting (ST 44) on the sick side, plus laser radiation on a site about 1 cm apart from the midpoint of the eyebrow of the sick side. After 10 treatments, the results showed cure in 19 cases and remarkable effect in 4 cases.

The effects of serum calcium and 1 alpha hydroxylase on the expression of 24-hydroxylase gene / 中国应用生理学杂志

<p><b>AIM</b>To investigate the effects of 1 alpha hydroxylase and serum calcium on the expression of 24-hydroxylase gene in mice kidney.</p><p><b>METHODS</b>Mice with targeted deletion of the 25-hydroxyvitamin D 1 alpha hydroxylase gene(1alpha (OH)ase-/-), and the vitamin D receptor gene (VDR-/-) were used. The study of each mutant had two groups which were (1) mutant with high calcium diet, which maintained fertility but left mice hypocalcaemia; (2) mutant with high lactose diet, which normalized calcium in two mutant. Mice in same litter were as control. There were six groups in total and each group had five mice. All mice were killed at 10-week-old. Serum calcium was determined by an autoanalyzer. RNA was isolated from mouse kidney and the express of 1 alpha hydroxylase gene and 24-Hydroxylase gene were studied by RT-PCR.</p><p><b>RESULTS</b>On the high calcium intake, all mutant animals were hypocalcaemia (1alpha (OH)ase-/- (78 +/- 10.4) mg/L, P < 0.05; VDR-/- (68 +/- 9.8) mg/L, P < 0.05. WT (111 +/- 16.5 mg/L), but when the high lactose diet was administered, serum calcium levels in two mutant mice rose to wild-type levels. The 1 alpha hydroxylase gene was expressed at very higher levels in the vitamin D receptor mutant mice than in wild-type mice when animals received a high calcium intake; This was reduced by eliminating hypocalcaemia with the high lactose diet. Expression of the 24(OH)ase gene was extremely down-regulated in two mutant mice on the high calcium diet but was restored to wild-type levels on the high lactose diet.</p><p><b>CONCLUSION</b>The express of 24-hydroxylase gene was directly regulated by serum calcium rather than 1 alpha-hydroxylase. These studies indicate that both the serum calcium and 1 alpha-hydroxylase exert effects on the expression of 24-hydroxylase gene, but 1 alpha-hydroxylase take the effects by elevated the concentration of serum calcium. There are no direct interaction between 1 alpha-hydroxylase gene and 24-hydroxylase gene.</p>

Exogenous estrogen improved calcium homeostasis and skeletal mineralization in vitamin D receptor gene knockout female mice / 生理学报

It is well known that estrogen can inhibit bone absorption, decrease bone turnover and preserve bone mass. Some studies indicated that the effect of estrogen on calcium and bone is relative to vitamin D system, while others also reported that this effect of estrogen is independent of vitamin D. The genomic effect of 1alpha, 25(OH)(2)D(3)is mediated by the nuclear vitamin D receptor (VDR) in a ligand-dependent manner. Hypocalcemia, hyperparathyroidism and osteomalacia are developed in VDR gene knockout mice. To determine whether the effect of estrogen on calcium and bone is dependent on VDR, this study examined the effect of exogenous estrogen on calcium and bone homeostasis in VDR gene knockout mice. Male and female wild type (WT) and VDR gene knockout heterozygous mice were mated each other and the genotyping of their offsprings were determined by PCR. At age of 21-day, WT and knockout mice were weaned and treated by one of three different regimens: (1) WT-vehicle group: the WT mice were injected with normal saline; (2) VDR KO-vehicle group: the VDR gene knockout mice were injected with normal saline; (3) VDR KO-E group: the VDR gene knockout mice were subcutaneously injected with estradiol, 0.2 mug per mouse, once daily for 1 month. The bone mineral density (BMD) of mice was measured using dual-energy X-ray absorptiometry. All mice were sacrificed at age of 50-day. Blood was taken by heart puncture under anesthesia and serum calcium was measured by autoanalyser.Tibiae were removed, fixed and embedded with the methylmethacrylate (MMA), and undecalcified sections were cut. These sections were stained for mineral with the von Kossa staining procedure and counterstained with toluidine blue. Static histomorphometric analyses were performed on those stained sections. The results showed that the serum calcium level was (2.10+/-0.37) mmol/L in the VDR KO-vehicle mice and rose to (2.80+/-0.41) mmol/L in the VDR KO-E mice although it was still lower than WT-vehicle mice [(3.10+/-0.48) mmol/L]. BMD and mineralized trabeculer volume were increased significantly in VDR KO-E group compared with that in VDR KO-vehicle group. These results suggest that exogenous estrogen can improve calcium absorption and skeletal mineralization in a VDR-independent manner.

Effects of Astragalus membranaceus in promoting T-helper cell type 1 polarization and interferon-gamma production by up-regulating T-bet expression in patients with asthma / 中国结合医学杂志

<p><b>OBJECTIVE</b>To explore the effect of Astragalus membranaceus (AM) on T-helper cell type 1 (Thl) specific transcription factor T-box expressed in T cells (T-bet) expression and Thl/Th2 equilibrium.</p><p><b>METHODS</b>The levels of T-bet mRNA in peripheral blood mononuclear cells (PBMCs) from 15 patients with asthma and 15 healthy subjects were determined by reverse transcription-polymerase chain reaction (RT-PCR). PBMCs in asthma patients were incubated with AM and then the concentration of interferon gamma (IFN-gamma) and interleukin-4 (IL-4) in the supernate before and after AM intervention were determined by ELISA. The numbers of CD4 + CCR3 + and CD4 + CCR5 + cells were counted by flow cytometry.</p><p><b>RESULTS</b>The expression of T-bet mRNA and the level of IFN-gamma were lower, but level of serum IL-4 was higher in asthma patients when compared with those in healthy subjects respectively. After AM (60 microg/ml) intervention, the former two parameters raised and showed a positive correlation between them, while the level of IL-4 was decreased. The mean percentage of CD4 + CCR3 + cells in asthma patients was significantly higher but that of CD4 + CCR5 + cells was lower when compared with those in healthy subjects respectively. After AM intervention, the abnormal change in the two indexes was improved to certain extent, showing a reversing status of Th2 polarization.</p><p><b>CONCLUSION</b>AM could increase the expression of T-bet mRNA and Thl cytokines such as IFN-Y, and might reverse the Th2 predominant status in asthma patients.</p>

Voltage-activated potassium channel blockers inhibit anisodamine-induced relaxation of rabbit aortic smooth muscles precontracted with noradrenaline / 生理学报

Anisodamine, which is originally extracted from scopolia tangutica and is currently produced in China, is a tropane alkaloid and a muscarinic cholinoceptor blocker. Our previous study found that anisodamine did not alter high K(+)-evoked contraction of rabbit aortic rings using isometric tension recording methods, but could attenuate noradrenaline (NA)-, histamine- or 5-hydroxytryptamine-induced contraction in an endothelium-independent manner. Since the high K(+)-elicited depolarization non-selectively inhibits potassium channels in vascular smooth muscle cell (VSMC) membrane, the vasodilation effect of some potassium channel activators may be inhibited or abolished in high K(+) solution. We hypothesized that some potassium channels in VSMC membrane might play a role in the anisodamine-induced relaxation of blood vessels. The present experiment was designed to investigate whether potassium channel blockers inhibit anisodamine-induced relaxation of the rabbit isolated aortic rings. In a 8-min period, 1, 3 and 10 micromol/L of anisodamine, significantly relaxed the 0.01 micromol/L NA precontracted aortic ring by (19.1+/-3.1)%, (30.1+/-3.8)% and (38.3+/-4.2)%, respectively, compared with the controls [by (4.8+/-2.4)%, (5.1+/-1.8)% and (5.6+/-2.5)%, respectively] (P<0.01). 10 mmol/L of CsCl (a non-selective potassium channel blocker), 1 mmol/L of 4-aminopyridine [a selective voltage-activated potassium channel (K(V)) blocker], 10 mumol/L BaCl2 (a selective inwardly-rectifying potassium channel blocker), 10 micromol/L of glibenclamide (a selective ATP-sensitive potassium channel blocker), 3 micromol/L of charybdotoxin (a large- and intermediate-conductance Ca(2+)-activated potassium channels blocker) and 3 micromol/L of apamin (a selective small conductance Ca(2+)-activated potassium channel blocker) significantly increased the NA-induced contraction by (14.4+/-3.2)%, (16.3+/-5.8)%, (12.7+/-4.2)%, (13.6+/-2.0)%, (11.1+/-5.5)% and (13.4+/-4.3)%, respectively, compared with the control [by (5.6 +/-1.2)%] (P<0.01). In the presence of 10 and 30 mmol/L CsCl or 1 and 3 mmol/L 4-aminopyridine, anisodamine-induced relaxation of the 0.01 micromol/L NA contracted rabbit aortic rings [(28.8+/-3.0)% and (15.9+/-3.7)% or (29.7+/-3.9)% and (19.0+/-5.0)%] significantly deceased, compared with that in the absence of any potassium channel blocker [(38.3+/-4.2)% (P<0.01)] in a 8-min period. However, in the presence of 10, 30 micromol/L of BaCl2, 10, 30 micromol/L of glibenclamide, 3 micromol/L of charybdotoxin, or 3 micromol/L apamin, 10 micromol/L anisodamine-induced relaxation [(37.1+/-3.8)%, (36.2+/-4.7)%, (36.1+/-2.7)%, (35.6+/-3.3)%, (37.8+/-2.0)% and (39.3 +/-4.7) %, respectively] did not decrease, compared with the control [(38.3+/-4.2)%] (P>0.05). This study suggests that K(V) blockers inhibit anisodamine-induced relaxation of the rabbit aortic smooth muscle precontracted with NA and implies that the K(V) in VSMC membrane plays a role in anisodamine-induced relaxation of blood vessels.