Primary gastric Burkitt's lymphoma: a clinicopathological analysis of four cases / 临床与实验病理学杂志

Purpose To investigate the clinicopathological features,diagnosis,treatment and prognosis of primary gastric Burkitt's lymphoma. Methods The clinical and pathological features were retrospectively analyzed in 4 case of primary gastric Burkitt's lymphoma. The endoscopic features,immunophenotype and molecular pathology were also analyzed and discussed with review of the literatures. Results Primary gastric Burkitt' s lymphoma mainly occurred in children,with an average age of 8 years (3～15 years) . Endoscopic findings were tuberous protuberance with surface ulcers (3 cases) . The diffuse distribution of atypical lymphoid cells with"starry sky"phenomenon in gastric mucosa was observed under microscope,the cells were of medium size and single shape,the nucleus was round or oval and the shape was uniform,the chromatin was thicker,and there were several small nucleoli,the cytoplasm was rare and slightly basophilic,and the nuclear mitosis was more frequently noted. Immunophenotyping showed that both CD20 and CD79a were all strongly positive,and the Ki-67 proliferative index was higher than 95％. The positive intensity of CD10 and BCL-6 varied from one to another. MUM1 and CD3 were all negative. One case was positive for EBER (in situ hybridization) . Meanwhile, all of these cases showed MYC gene breakage,one of them was detected by IGH/BCL-2 fusion gene but no fusion was found. Conclusion Primary gastric Burkitt's lymphoma is rare. Its endoscopic features,histomorphology,immunophenotype and molecular pathology are relatively typical and it is mainly distinguished from high-grade B cell lymphoma,lymphoblastic lymphoma and myeloid sarcoma. Burkitt's lymphoma is a highly malignant tumor,but the current treatment is relatively mature. Early diagnosis and early treatment can significantly improve the prognosis of these patients.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis / 中华医学杂志(英文版)

BACKGROUND@#Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.@*METHODS@#The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.@*RESULTS@#The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.@*CONCLUSIONS@#The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Observation of Proliferation of Human Umbilical Vein Endothelial Cells Treated with Serum Containing Yang-warming, Blood-activating, and Toxin-removing Recipe Sampled Under Different Conditions / 广州中医药大学学报

Objective To study the influences of Yang-warming, Blood-activating, and Toxin-removing Recipe(YBTR)-containing serum sampled under different conditions on the proliferation of human umbilical vein endothelial cells(HUVECs). Methods HUVECs were cultured in vitro for the experiment. Pharmacological serum for the experiment was prepared as follows: Thirty-two SD rats (male in half) were randomly divided into 4 groups, namely normal saline group and low-, middle-, and high-dose YBTR groups (at the intragastric dosage of 10.35, 31.05, 93.15 g·kg-1 respectively, twice a day). The pharmacological serum was taken from one female rat and one male rat in various groups at 4 time points, i.e. at hour 1, 2 after first intragastric administration on the fourth feeding day, and at hour 1, 2 after first intragastric administration on the sixth feeding day(abbreviated as D3H1, D3H2, D5H1, D5H2 respectively). The effects of YBTR-containing serum on the proliferation of HUVECs were observed by CCK-8 assay method. Results The difference of proliferation-inhibition rate of HUVECs was statistically significant after treated with YBTR-containing serum prepared from rats of different genders at different time(Pgender=0.000<0.01, Ptime=0.000<0.01). The difference of interaction of time and gender was also significant (Ptime × gender=0.001<0.01), and the effect at D3H1 and D5H1 varied with the gender (PD3H2×gender = 0.000 < 0.01, PD5H1×gender = 0.002 < 0.01). The inhibitory action of YBTR-containing serum became stronger with the increase of the dosage of serum of female rat at D3H2, and the inter-group difference was statistically significant (P < 0.05), the effect showing concentration-dependent tendency. The inhibition of HUVECs proliferation reached the peak after treated by various doses of YBTR-containing serum from the female rat at D3H2, while the inhibition arrived to the peak after treated by low- and middle-dose YBTR-containing serum from the male rat at D5H1, and the inhibition arrived to the peak in the group of high-dose YBTR-containing serum from the male rat at D3H1. Conclusion The inhibitory action of YBTR-containing serum on the proliferation of HUVECs was stronger when the serum was taken from the female rat at D3H2.

A Genetic Susceptibility Study of Lung Cancer Risk Potentially Associated with Polycyclic Aromatic Hydrocarbon Inhalation Exposure / 生物医学与环境科学（英文）

To establish a genetic susceptibility assessment model of lung cancer risk potentially associated with polycyclic aromatic hydrocarbon (PAH) inhalation exposure among non-smokers in China, a total of 143 patients with lung adenocarcinoma and 143 cancer-free individuals were recruited. Sixty-eight genetic polymorphisms in 10 pathways related to PAH metabolism and tumorigenesis were selected and examined. It was observed that 3 genetic polymorphisms, along with 10 additional genetic polymorphisms via gene-gene interactions, significantly influenced lung cancer risk potentially associated with PAH inhalation exposure. Most polymorphisms were associated with PAH metabolism. According to the established genetic susceptibility score (GSS), lung cancer risk increased with a rise in the GSS level, thereby indicating a positive dose-response relationship.

Impact of pregnancy terminations before 28 weeks of gestation on the overall prevalence of neural tube defects in two counties of Shanxi province / 中华流行病学杂志

Objective To examine the impact of pregnancy termination before 28 weeks of gestation on the overall prevalence of neural tube defects (NTDs).Methods Data collected during the period of 2004 and 2010 from a birth defects surveillance system in Pingding county and Talgu county of Shanxi province were used.Number of births ≥28 weeks of gestation and number of cases with major birth defects among the births were collected.Terminations of pregnancies before 28 weeks of gestation due to prenatal diagnosis were also collected.The total prevalence of neural tube defects,prevalence before 28 weeks of gestation,and prevalenee of ≥28 weeks gestation were calculated using the total number of pregnancies of ≥28 weeks of gestation as denominator.The prevalence data were compared to examine the impact of pregnancy termination on the total prevalence.The proportions of pregnancy terminations before 28 weeks of gestation due to prenatal diagnosis of an NTD against the total number of NTD cases were also calculated.Results During 2004-2010,52 366 births were recorded,and 485 NTD cases were ascertained.The overall prevalence of NTDs was 92.6 per 10 000 births,with prevalence of ＜28 weeks gestation due to pregnancy terminations as 60.9 per 10 000 births,while the prevalence of ≥28 weeks of gestation was 31.7 per 10 000 births.NTD prevalence of ≥28 weeks gestation was 66.0％ lower than the total NTD prevalence.In the last two years,the proportion of NTDs ascertained ≥28 weeks gestation accounted for about 40.0％ of the total NTD cases.Conclusion A birth-defect-surveillance program that covered only tregnancies ≥28 weeks of gestation resulted in a severe underestimation of the total birth prevalence of NTDs,especially for anencephaly.We would recommend that the current national birth defects surveillance system should include pregnancy terminations before 28 weeks of gestation and the calculation of total NTD prevalence should also include these cases into the numerator,so as to better estimate true population NTD prevalence,upon which the related public health policy is based.

Maternal periconceptional consumption of pickled vegetables and risk of neural tube defects in offspring / 中华医学杂志(英文版)

<p><b>BACKGROUND</b>Maternal exposure to nitrate, nitrite, and N-nitroso compounds from drinking water or diet has been associated with an increased risk of neural tube defects (NTDs) in some studies. Pickled vegetables contain relatively large amounts of nitrite and N-nitroso compounds. We examined the association between maternal periconceptional consumption of pickled vegetables and NTDs in Shanxi Province of northern China.</p><p><b>METHODS</b>Data were derived from a population based case-control study of major external birth defects in four counties of Shanxi Province. Participants included 519 NTDs cases identified between 2003 and 2007 and 694 healthy controls. Exposure information was collected within 1 week after delivery. Multivariable non-conditional Logistic regression model was used to estimate the adjusted odds ratio (OR) controlling for potential confounding variables.</p><p><b>RESULTS</b>The risk of NTDs was positively associated with the frequency of the consumption of pickled vegetables by the mother. Compared with pickled vegetables consumption at < 1 meal/week, the adjusted OR for consumption at 1 - 3, 4 - 6, and > 6 meals/week were 1.3 (95% confidence interval (CI): 1.0, 1.8), 1.9 (1.1, 3.2), and 3.6 (1.9, 6.9), respectively. A protective effect was found for maternal meat consumption at ≥ 1 meal/week (adjusted OR: 0.6, 95%CI: 0.4, 0.7) and egg or milk consumption at ≥ 1 meal/week (adjusted OR: 0.6, 95%CI: 0.4, 0.8).</p><p><b>CONCLUSION</b>Maternal periconceptional consumption of pickled vegetables may increase the risk for NTDs in Shanxi Province.</p>

Introduction to an individual-based standardization method-propensity score weighting / 中华流行病学杂志

In this article,we presented the rationale and calculation procedures of a propensity score weighting method,with its application in epidemiological studies.The rationale for propensity score weighting method is similar to those for traditional standardization methods.Propensity score is used to estimate the weight for each individual.As the propensity score serves the function of observed covariates,the propensity score weighting can balance the distribution of the observed covariates between the comparison groups.There are two weighting methods according to the target standard populations:the Inverse probability of treatment weighting(IPTW)and the Standardized mortality ratio weighting(SMRW).Results of the example show that the distribution of the covariates tended to be consistent after weighting,and the IPTW and SMRW methods showed similar effect estimates.Propensity score weighting method can effectively balance the distribution of the confounding factors between the compared groups in non-randomized controlled trials.

Birth weight distribution among premature infants and related social factors / 中华流行病学杂志

<p><b>OBJECTIVE</b>To understand the distribution of birth weight among premature infants and the associated social factors.</p><p><b>METHODS</b>The study population consisted of 97 537 women who delivered singleton live birth of 20 to 41 gestational weeks in 4 counties/cities, Jiangsu and Zhejiang provinces, China from 1995 to 2000. Chi-square test was employed to test the difference of proportions between respective groups. One- way ANOVA was used to test the differences regarding the mean of gestational weeks at the first prenatal visit and the mean of prenatal visits between the two groups. Multivariate logistic regression was conducted to examine the factors associated with premature birth.</p><p><b>RESULTS</b>Women aged 35 years had higher (8.8%) premature incidence than those aged less than 24 years (5.6%), 25 - 29 years (4.6%), or 30 - 34 years (4.5%, P < 0.001). Women with height less than 149 cm had higher (6.8%) premature incidence than those with height taller than 150 cm (5.0%). Women whose BMI were at least 28 and 24 - 28 had higher (5.5%, 5.5%) premature incidences than those whose BMI were 18.5 - 24.0 (5.0%), < 18.5 (4.6%, P < 0.001). The incidence of premature birth was 6.0% among women without previous pregnancy, higher than that among those women with 4 times of pregnancies (5.7%), 2 times of pregnancies (4.3%), and 3 times of pregnancies (4.0%). Parous women with at least two deliveries had higher (9.3%) premature incidence than the primiparous women (5.2%) and whose women with only one delivery (4.5%, P < 0.001). Women who received early prenatal care had lower 4.7% premature incidence than those who did not receive the service (6.1%). The mean times of prenatal visits among women with premature births was 8.53, less than that of those with full term delivery (10.97). Women with less than four times of prenatal visit had higher (18.9%) premature incidence than those with at least five prenatal visits (4.9%). Multivariate logistic regression showed that premature delivery risk was associated with age, height, BMI, gravidity, parity, early prenatal care, the mean of gestational weeks at first prenatal visit and the mean number of prenatal visits etc.</p><p><b>CONCLUSION</b>Premature delivery risk was associated with factors as age, height, BMI, gravidity, parity, early prenatal care, the mean of gestational weeks at first prenatal visit, the mean number of prenatal visits etc.</p>

Application of propensity score matching in the design of an epidemiological study / 中华流行病学杂志

In this article, we presented the rationale and calculation procedures of the propcnsity score matching (PSM), and its application in the designing stage of an cpidcrniological study. Based on existing observational data, PSM can be used to select one or more comparable controls for each subject in 'treatment' group according to the propensity scores estimated by 'treatment' variable and main covariates. The results of an example analysis showed that the bias for main confounders between the treated and control samples declined more than 55% after PMS. Conclusion: PSM can reduce most of the confounding bias of the observational study, and can obtain approximate study effect to the randomized controlled trials when used in the designing of thc cpidcmiological study.

Maternal passive smoking and the risk of neural tube defects: a case-control study in Shanxi province,China / 中华流行病学杂志

Objective To explore the relationship between maternal passive smoking during early pregnancy and the risk of neural tube defects (NTDs). Methods Data was derived from a populationbased case-control study on birth defects in Shanxi province. The study subjects included 515 NTDs defects cases (236 cases of anencephaly, 237 spina bifida and 42 encephalocele) ascertained during January 2003 and June 2007 in the study areas and 682 normal controls randomly selected in the same residence during the same period as cases. Results The risk of NTDs in their offspring was 1.84 (95 % CI : 1.39-2.44) for mothers with passive smoking history during peri-conceptional period. There was a marked dose-response relation between maternal passive smoking and the risk of NTDs in offspring. Compared to the women without passive smoking, the NTDs risk in offspring was 1.51 for women with occasional passive smoking and 2.44 for women with passive smoking for almost everyday during the peri-conceptional period.Conclusion Maternal passive smoking during peri-conceptional period increased the risk of NTDs in offspring.

Prevalence of preterm birth among singletons in 10 counties (cities) of China, 1993-2005 / 中华流行病学杂志

<p><b>OBJECTIVE</b>To describe the secular trends and epidemiological characteristics of preterm birth among singletons in 10 counties (cities) of China during 1993-2005.</p><p><b>METHODS</b>We analyzed data on 542 923 women (gestational age > or =28 weeks) collected through Perinatal Healthcare Surveillance System established by the Institute of Reproductive and Child Health, Peking University. Chi-square tests were employed to test the differences in prevalence of preterm birth among different groups.</p><p><b>RESULTS</b>25 784 preterm births were identified, including 1530 stillbirths. Preterm birth rate was 4.75% (95% CI:4.69-4.81) for all births and 4.49% (95% CI:4.44-4.55) for live births. Preterm birth rate declined steadily from 1993 to 2005 and had no significant seasonal variation. Preterm birth rate from the urban areas of the Southern part of the country,was higher than that in the rural areas which was also higher than that seen in the rural areas from the northern part of the country. Relations between women's age at delivery and preterm birth appeared to be U-shaped. Increased preterm birth rates were also observed in women with lower education level,more parities,and previous history of preterm birth or abortion.</p><p><b>CONCLUSION</b>Preterm birth rate decreased steadily from 1993-2005 in 10 counties (cities) but varied by areas of the country.</p>

Plasma and red blood cell folate levels among women in their first trimester of pregnancy from rural areas with high or low prevalence of neural tube defects, China / 中华流行病学杂志

<p><b>OBJECTIVE</b>To compare plasma and red blood cell folate levels among women in their first trimester of pregnancy from rural areas with high or low prevalence of neural tube defects.</p><p><b>METHODS</b>A cross-sectional study was performed, among women in their first trimester of pregnancy from rural areas with high or low prevalence of neural tube defects in 2003. Non-fasting blood sample were collected and analyzed for plasma and red blood cell folate concentrations for 688 women.</p><p><b>RESULTS</b>The median plasma (10.53 nmol/L) and red blood cell folate (389.2 nmol/L) among women from the high prevalence rural area were lower than those of women from the low prevalence rural area (plasma folate: 30.39 nmol/L, red blood cell level folate: 926.0 nmol/L). Among women from the high prevalence area, about 50% and 43% were respectively, deficient for plasma and red blood cell folate, compared with 6% and 4% respectively, for women from the low prevalence area. The median plasma folate levels among women who took periconceptional folic acid supplements in both high and low prevalence areas were about twice higher than those who did not take the folic acid. The median red blood cell folate level of the folic acid users was 40% higher than those of the non-users. Among those who took folic acid, women in the low prevalence area had 70%-90% higher plasma folate concentration and twice higher red cell folate concentration than women in the high prevalence area.</p><p><b>CONCLUSION</b>Women from the rural area with a high prevalence of neural tube defects had low plasma and red blood cell folate levels. Periconceptional supplementation with folic acid could substantially improve folate status of reproductive-aged women. However, supplementation with 0.4 mg of folic acid per day might be inadequate for women in the high prevalence rural area.</p>

Dietary factors and the risk of neural tube defects: a case-control study in Shanxi province, China / 中华流行病学杂志

<p><b>OBJECTIVE</b>Dietary factors that could potentially be related to the risk of birth defects are still unknown in Shanxi province, a region with high prevalence of neural tube defects(NTDs) in China. The main aim of this study was to evaluate the association between NTDs and local dietary factors.</p><p><b>METHODS</b>A population-based case-control study was conducted during 2003-2005 in four selected counties of Shanxi province with 363 NTDs cases ascertained and 523 control babies without any external birth defects.</p><p><b>RESULTS</b>By multivariate logistic regression analysis, we found the NTDs risk was significantly associated with low consumption of meat and legume, high consumption of pickled vegetables, noncentralized supply of drinking water and drinking tea after adjusting for maternal education level and birth defects history. A significant dose response trend was found between the NTDs risk and the lower frequencies of meat and legume consumption and higher frequency of pickled vegetable consumption, with population attributable risks (PAR) of 69.4%, 22.0% and 18.5%, respectively. Mothers who got their drinking water from river or pond during periconceptional period were more likely to have a NTD-affected pregnancy [OR = 3.42, 95% CI: 1.44-8.09, population attributable risk (PAR) = 4.7%] compared with those who utilized tap or well water. Those who drank tea everyday had an elevated risk of having a NTD-affected pregnancy compared with those who didn't (OR = 4.65, 95% CI: 1.41-15.36, PAR = 2.6%).</p><p><b>CONCLUSION</b>Higher intake of meat and legume protects a woman from having a NTD-affected pregnancy, and consumption of pickled vegetables, drinking water from river or pond and drinking tea everyday increase the risk of having such a pregnancy in the study population.</p>

Clinical analysis of dopa-responsive dystonia and mutation analysis of the GCH I gene / 中华儿科杂志

<p><b>OBJECTIVE</b>To investigate the clinical characteristics and GCH I gene mutations in patients with dopa-responsive dystonia (DRD).</p><p><b>METHODS</b>The clinical features of 3 families with 6 affected members and 8 sporadic cases were analyzed to determine the clinical characteristics, and 2 families with 4 affected members and 2 sporadic cases were screened for mutations of the GCH I gene.</p><p><b>RESULTS</b>Age at onset was (10 +/- 3) years. Onset occurred earlier in female (9 +/- 4) years than in male (12 +/- 1) years. The initial symptom was a gait disorder, dystonia or tremor in most patients and nine patients (64%) presented with diurnal fluctuation. Thirteen patients (93%) were cured and one was improved after administration of low doses of levodopa for 3 months and no long-term side effects of levodopa had occurred. Two independent mutations were found in three patients. Gln161Pro, a new missense mutation, was found in a sporadic case, leading to a relatively severe phenotype. The two patients with mild phenotype in one family were found to have Lys224Arg mutation, as previously described.</p><p><b>CONCLUSIONS</b>DRD patients have diverse phenotypes and diurnal fluctuation is an important feature. They have dramatic and sustained response to levodopa. There may be a correlation between genotype and phenotype. The detection of GCH I mutations is helpful in early diagnosis of non-typical cases.</p>

Evaluation on birth defects surveillance system in four counties of Shanxi province, China / 中华流行病学杂志

<p><b>OBJECTIVE</b>To evaluate the reliability of the birth defects surveillance system in four counties with high prevalence of birth defects (Pingding, Xiyang, Taigu and Zezhou counties) in Shanxi province, China.</p><p><b>METHODS</b>One township was selected from each county as study site. The health workers chosen from township or village level were trained to visit families on the outcomes of each pregnancy who gave birth during year 2003 in the study site. The number of births and cases collected in the study were compared with that from the surveillance system. The number of births reported by surveillance system in four counties was also compared with the data from the local government. The criteria of evaluation were: 1) number of the missing report of births should < or = 5%, 2) the number of missing report on major external birth defects cases should < or = 10%. Researchers from the Peking University were responsible for examining the quality of surveillance in some terminal units of surveillance system.</p><p><b>RESULTS</b>The numbers of births reported in the study and from the surveillance system for four-township were 1043 and 997, respectively. 46 births were missing and the rate of misreporting for births was 4.4%. The numbers of birth defects cases reported in the study and from the surveillance system were 30 and 29, respectively. 1 case of birth defect as missed, and rate of misreporting for birth defects cases was 3.3%. The total number of births reported from surveillance was similar to that in the study in four counties, with a difference of 1.2%. Birth registry data was rather readable and special health workers responsible for surveillance work were present in all the terminal units of the surveillance system.</p><p><b>CONCLUSION</b>The misreporting of births and cases existed in the birth defects surveillance system of the four counties in Shanxi province, but were lower than the allowable criteria. The surveillance units had better registration, reporting and administration of births and birth defect cases. Hence, the quality of the data from the surveillance system in these four counties was reliable.</p>

Interaction between maternal periconceptional supplementation of folic acid and reduced folate carrier gene polymorphism of neural tube defects / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To search the interaction between reduced folate carrier gene (RFC1 A80G) polymorphism of children with neural tube defects (NTDs) and maternal periconceptional no supplementation of folic acid. The purpose is to provide the epidemiological evidence for finding genetic marker of NTDs.</p><p><b>METHODS</b>RFC1 (A80G) genotype was detected using PCR-restricted fragment length polymorphism for the blood DNA of 104 trios with NTDs-affected child, and 100 control families with non-malformed control children. The authors investigated the gene-environment interactions between the offspring RFC1 genotype and maternal periconceptional folic acid supplementation through a case-control study.</p><p><b>RESULTS</b>It was observed that the offspring with the GG genotype were associated with a 2.56-fold increased risk of NTDs when compared to those with the AA genotype (OR = 2.56; 95% CI = 1.04-6.36) in this population under investigation. The risk of mothers who did not take folic acid for having an NTDs-affected infants was 7.69 (95% CI = 2.86-21.75). Among the mothers who did not utilize folic acid supplements, the NTDs risk was 3.30 (95% CI = 1.15-9.65) for offspring with the GG genotype, compared to the reference (AA) genotype. Children who had the GG genotype and whose mothers did not take folic acid had an elevated risk for NTDs (OR = 8.80, 95% CI = 2.86 - 29.82), compared to "offspring with AA or GA genotype" and "maternal folic acid use", the interactive coefficient being 1.45.</p><p><b>CONCLUSION</b>The above findings indicate that the RFC1 genotype (GG) is a possible susceptible gene marker for an increased NTDs risk in Chinese population, and there is a potential gene-nutrient interaction between offspring RFC1 GG genotype and maternal periconceptional intake of folic acid on the risk of NTDs. However,the sample size of this study was limited, a larger sample of population-based study is required to pursue the initial observation.</p>

A parental case control study on the association between reduced folate carrier gene polymorphism and neural tube defects / 中华流行病学杂志

<p><b>OBJECTIVE</b>To study the association between reduced folate carrier gene (RFC1 A80G) polymorphism and the risk for child with neural tube defects (NTDs), and to provide epidemiological evidence for the existence of NTDs genetic marker.</p><p><b>METHODS</b>RFC1 (A80G) genotypes were detected using RFLP-PCR for blood DNA of 104 families with NTDs-affected children and 100 control families with no history of child-affected birth defects. Case-control study and transmission/disequilibrium test(TDT) for the RFC1 genotype of NTDs pedigree were carried out.</p><p><b>RESULTS</b>The G allele frequency of children with NTDs was higher than that of controls when compared to A allele( OR = 1. 64, 95% CI :1.08-2.49). The offspring of the GG genotype were associated with a 2.56-fold increased risk of NTDs when compared to the AA genotype (OR = 2.56, 95% CI: 1.04-6.36) in our study population. There was evidence of association between G allele and the risk of parent having a child with NTDs (OR = 1.56, 95% CI: 1.07-2.28) in the TDT analysis.</p><p><b>CONCLUSION</b>Our findings indicated that there was potential association between offspring RFC1 GG genotype and the risk of NTDs, and the G allele was a possible susceptible gene marker for an increased NTDs risk in the Chinese population.</p>

Prevalence of major external birth defects in high and low risk areas in China, 2003 / 中华流行病学杂志

<p><b>OBJECTIVE</b>To study the prevalence rates of birth defects in high and low risk areas in China.</p><p><b>METHODS</b>A population-based surveillance system on birth defects was used to obtain the prevalence rates of 24 kinds of major external birth defects from > or = 20 weeks of gestation to 7 days of life in selected areas in Shanxi and Jiangsu provinces.</p><p><b>RESULTS</b>The birth prevalence of birth defects (232.4 per 10,000 births) and neural tube defects (NTDs) (138.7 per 10,000 births) in four counties of Shanxi province were significantly higher than that in Taiyuan city (75.3 and 28.2 per 10,000 births, respectively). There was no significant difference for all selected birth defects between Wuxi city and Xishan counties in low risk areas. There was a 6.1-fold of higher prevalence for NTDs in Taiyuan city compared with that in Wuxi areas (4.6 per 10,000 births). In four counties of Shanxi province, the prevalence rates of anencephaly, spina bifida, hydrocephaly, cleft palate alone and polydactyly were significantly higher than in Wuxi areas. The NTDs prevalence rate in four counties of Shanxi was 30.2 times higher than in Wuxi areas. When compared with previous surveillance data, the NTDs prevalence rate did not present obvious declining trend in high risk areas. The birth prevalence rate had a 31.8% decrease when births were calculated after 28 gestational weeks and compared with those from 20 gestational weeks.</p><p><b>CONCLUSION</b>NTDs remained to be the most common birth defect seen in Shanxi province. The birth prevalence rate of NTDs in some areas of Shanxi province was among the highest that ever reported in the world in comparison with data from other countries and regions. The current prevalence rate in high risk areas in Shanxi province did not clearly show a declining trend. Programs on surveillance and prenatal diagnosis were proved to have made big impact on the rates of major external birth defects.</p>