Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 448
Filter
1.
Acta Pharmaceutica Sinica ; (12): 374-381, 2024.
Article in Chinese | WPRIM | ID: wpr-1016650

ABSTRACT

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

2.
Chinese journal of integrative medicine ; (12): 203-212, 2024.
Article in English | WPRIM | ID: wpr-1010330

ABSTRACT

OBJECTIVE@#To investigate a new noninvasive diagnostic model for nonalcoholic fatty liver disease (NAFLD) based on features of tongue images.@*METHODS@#Healthy controls and volunteers confirmed to have NAFLD by liver ultrasound were recruited from China-Japan Friendship Hospital between September 2018 and May 2019, then the anthropometric indexes and sampled tongue images were measured. The tongue images were labeled by features, based on a brief protocol, without knowing any other clinical data, after a series of corrections and data cleaning. The algorithm was trained on images using labels and several anthropometric indexes for inputs, utilizing machine learning technology. Finally, a logistic regression algorithm and a decision tree model were constructed as 2 diagnostic models for NAFLD.@*RESULTS@#A total of 720 subjects were enrolled in this study, including 432 patients with NAFLD and 288 healthy volunteers. Of them, 482 were randomly allocated into the training set and 238 into the validation set. The diagnostic model based on logistic regression exhibited excellent performance: in validation set, it achieved an accuracy of 86.98%, sensitivity of 91.43%, and specificity of 80.61%; with an area under the curve (AUC) of 0.93 [95% confidence interval (CI) 0.68-0.98]. The decision tree model achieved an accuracy of 81.09%, sensitivity of 91.43%, and specificity of 66.33%; with an AUC of 0.89 (95% CI 0.66-0.92) in validation set.@*CONCLUSIONS@#The features of tongue images were associated with NAFLD. Both the 2 diagnostic models, which would be convenient, noninvasive, lightweight, rapid, and inexpensive technical references for early screening, can accurately distinguish NAFLD and are worth further study.


Subject(s)
Humans , Non-alcoholic Fatty Liver Disease/diagnostic imaging , Ultrasonography , Anthropometry , Algorithms , China
3.
Chinese journal of integrative medicine ; (12): 3-9, 2024.
Article in English | WPRIM | ID: wpr-1010284

ABSTRACT

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.


Subject(s)
Calcium , Acupuncture Therapy , Acupuncture , Acupuncture Analgesia/methods , Acupuncture Points , Technology
4.
Chinese Journal of Laboratory Medicine ; (12): 203-208, 2023.
Article in Chinese | WPRIM | ID: wpr-995719

ABSTRACT

Objective:To analyze 12 antithrombins (AT) gene mutations that cause AT deficiency and discuss the relationship between the SERPINC1 gene. mutations and venous thrombotic events.Methods:This study belongs to case series of observational studies. Collected the clinical data of 12 AT deficiency cases in the First Affiliated Hospital of Wenzhou Medical University from April 2014 to April 2021 and collected the blood samples before treatment. The AT activity (AT: A) and AT antigen (AT: Ag) was detected by chromogenic substrate and immunoturbidimetry, respectively. The 7 exons and flanking sequences of the SERPINC1 gene were sequenced directly by PCR, the suspected mutations were validated by reverse sequencing. Analyzed the correlation between the SERPINC1 gene. mutations and venous thrombotic events and figured out the proportion.Results:The AT: A of the 12 patients all decreased significantly, ranging from 30% to 66%, and the AT: Ag of the 7 patients decreased accordingly, showing type Ⅰ AT deficiency, and the AT: Ag of the other 5 patients were normal, presented type Ⅱ AT deficiency. 12 mutations were found including 6 heterozygous mutations which were discovered for the first time: c.456_458delCTT(p.phe121del), c.318_319insT(p.Asn75stop), c.922G>T(p.Gly276Cys), c.938T>C (p.Met281Thr), c.1346T>A(p.Leu417Gln)and c.851T>C(p.Met252Thr). All 12 patients had venous thrombosis, and 3 cases including 2 compound heterozygotes and 1 single heterozygote all suffered from deep venous thrombosis (DVT) when they were younger without obvious triggers. The other 9 patients all combined with the other thrombotic factors including old age, hypertensive, smoking, pregnancy, and prolonged immobilization.Conclusion:Patients with AT deficiency caused by SERPINC1 gene defects are prone to venous thrombosis, especially combined with other thrombotic factors.

5.
Chinese Journal of Applied Clinical Pediatrics ; (24): 457-460, 2023.
Article in Chinese | WPRIM | ID: wpr-990060

ABSTRACT

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

6.
International Journal of Cerebrovascular Diseases ; (12): 197-204, 2023.
Article in Chinese | WPRIM | ID: wpr-989212

ABSTRACT

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

7.
Journal of Sun Yat-sen University(Medical Sciences) ; (6): 893-900, 2023.
Article in Chinese | WPRIM | ID: wpr-988739

ABSTRACT

ObjectiveTo explore the risk factors of hypogonadism in male hyperuricemia (HUA) patients in Xinjiang. MethodsClinical data of 217 male patients with HUA admitted to the Department of Endocrinology and Metabolism of the People's Hospital of Xinjiang Uygur Autonomous Region from June 2021 to December 2022 were collected. Patients meeting the diagnostic criteria for hypogonadism were included in the case group (98 cases), and patients with normal gonadism were included in the control group (119 cases). The differences of different metabolic indexes between the two groups and the correlation of male hypogonadism were analyzed. ResultsCompared with those in normal gonadal function group, in hypogonadism group, age, waist circumference (WC), body mass index (BMI), the levels of fasting blood glucose (FPG), fasting insulin (FINS), insulin resistance index assessed by homeostasis model (HOMA-IR), alanine aminotransferase (ALT), blood uric acid (SUA) and sex hormone binding globulin (SHBG) were significantly increased; the levels of γ-glutamyltransferase (GGT), 25-hydroxyvitamin D [25(OH)D], progesterone (P), estradiol (E2), dehydroepiandrosterone (DHEA) and serum free triiodothyronine (FT3) were significantly decreased (P < 0.05); and the proportion of patients with obesity (OB), non-alcoholic fatty liver (NAFLD), hyperlipidemia (HLP), hypertension (HBP), coronary heart disease (CHD) and use of angiotensin receptor antagonist (ARB) and aspirin was significantly increased (P < 0.05). Correlation analyses showed that free testosterone (FT) was negatively correlated with age, WC, BMI, FPG, FINS, HOMA-IR, SUA, SHBG and ALT, but positively correlated with 25(OH)D, P, E2, DHEA and FT3 (P < 0.05). Logistic regression analysis showed that age, hypertension, BMI, SUA, ALT, 25(OH)D, HOMA-IR and WC were independent risk factors for hypogonadism (P < 0.05). After multivariate adjustment, SUA remained an independent risk factor for hypogonadism [OR = 1.009, 95%CI (1.004, 1.015), P = 0.001]. ConclusionsMale HUA patients are often accompanied with hypogonadism. Age, hypertension, BMI, SUA, ALT, 25(OH)D, HOMA-IR and WC are independent risk factors of hypogonadism.

8.
Chinese Journal of Biotechnology ; (12): 4004-4028, 2023.
Article in Chinese | WPRIM | ID: wpr-1008008

ABSTRACT

T cells play central roles in anti-tumor immune responses. Immune checkpoint therapy, which is based on modulation of T cell reactivity, has achieved breakthrough in clinical treatment of multiple tumors. Moreover, adoptive T cell therapy, which includes mainly genetically engineered T cells, has shown substantial treatment efficacy in hematoma. Immune therapy has tremendously changed the scenario of clinical tumor treatment and become critical strategies for treating multiple tumors. T cell receptor (TCR) is the fundamental molecule responsible for the specificity of T cell recognition. TCRs could recognize peptides, which are derived from intracellular or extracellular tumor antigens, presented by major histocompatibility complex (MHC) and are therefore highly sensitive to low antigen level. Thereby, TCRs are broadly recognized as promising molecules for the development of anti-tumor drugs. The approval of the first TCR drug in 2022 has initiated a new era for TCR-based therapeutics and since then, multiple TCR drugs have shown substantial treatment efficacy in multiple tumors. This review summarizes the progress of TCR-based immune therapeutic strategies, including T cell receptor-engineered T cell (TCR-T), TCR-based protein drugs, and other cell therapies based on TCR signaling, providing useful information for future design of immune therapeutics based on TCR.


Subject(s)
Humans , Receptors, Antigen, T-Cell/metabolism , T-Lymphocytes/metabolism , Neoplasms/metabolism , Immunotherapy , Antigens, Neoplasm
9.
Chinese Journal of Biochemistry and Molecular Biology ; (12): 840-847, 2023.
Article in Chinese | WPRIM | ID: wpr-1015604

ABSTRACT

Betulinic acid (BA) exerts protective effects on organs in septic animals. However, whether BA can improve cardiac function in sepsis and the underlying mechanism remain unclear. Here, male Sprague-Dawley rats were pretreated with BA (25 mg/ kg/ d, i. g.) for 5 days and then intraperitoneally injected with lipopolysaccharide (LPS, 10 mg/ kg). The rats were anesthetized to determine transthoracic echocardiography using a high-resolution imaging system for small animals after they were treated with LPS for 6 h. Histopathologic alterations were examined by HE staining. Myocardial injury markers (cTnI and CK-MB) and inflammatory factors (TNF-α, IL-1β and IL-6) in the serum were measured by the enzyme-linked immunosorbent assay. Autophagy-related proteins (p62 and LC3 Ⅱ) and AKT-modulated autophagy pathways in the myocardium were determined by Western blotting. Pretreatment with BA markedly improved left ventricular ejection fraction (EF) and fraction shortening (FS) (P<0. 05), improved myocardial histomorphology, and significantly inhibited cTnI, CK-MB, TNF-α, IL-1β and IL-6 (P<0. 05) in the septic rat serum. BA markedly decreased p62 (P<0. 01), increased LC3 Ⅱ (P< 0. 001), and significantly down-regulated p-AKT (Thr308), p-AMPKα (Ser485/ 491), p-mTOR (Ser2448) and p-S6K (Thr389) (P<0. 05), while markedly up-regulated p-AMPKα (Thr172) and pULK1 (Ser317) (P<0. 01) in septic rat hearts. The findings indicate that BA can attenuate sepsis-induced myocardial dysfunctions associated with down-regulating autophagy inhibiting pathways mediated by AKT/ mTOR and AKT/ AMPK pathways.

10.
Acta Pharmaceutica Sinica B ; (6): 4840-4855, 2023.
Article in English | WPRIM | ID: wpr-1011215

ABSTRACT

Pulmonary hypertension (PH) is an extremely malignant pulmonary vascular disease of unknown etiology. ADAR1 is an RNA editing enzyme that converts adenosine in RNA to inosine, thereby affecting RNA expression. However, the role of ADAR1 in PH development remains unclear. In the present study, we investigated the biological role and molecular mechanism of ADAR1 in PH pulmonary vascular remodeling. Overexpression of ADAR1 aggravated PH progression and promoted the proliferation of pulmonary artery smooth muscle cells (PASMCs). Conversely, inhibition of ADAR1 produced opposite effects. High-throughput whole transcriptome sequencing showed that ADAR1 was an important regulator of circRNAs in PH. CircCDK17 level was significantly lowered in the serum of PH patients. The effects of ADAR1 on cell cycle progression and proliferation were mediated by circCDK17. ADAR1 affects the stability of circCDK17 by mediating A-to-I modification at the A5 and A293 sites of circCDK17 to prevent it from m1A modification. We demonstrate for the first time that ADAR1 contributes to the PH development, at least partially, through m1A modification of circCDK17 and the subsequent PASMCs proliferation. Our study provides a novel therapeutic strategy for treatment of PH and the evidence for circCDK17 as a potential novel marker for the diagnosis of this disease.

11.
Chinese Journal of Industrial Hygiene and Occupational Diseases ; (12): 528-533, 2023.
Article in Chinese | WPRIM | ID: wpr-986063

ABSTRACT

Objective: To investigate the predictive value of serum lactate dehydrogenase (LDH) in the prognosis of patients with paraquat (PQ) poisoning, and to provide evidence for early prognosis assessment. Methods: In February 2022, 50 patients with PQ poisoning who completed serum LDH detection admitted to the Department of Emergency Medicine, the First Affiliated Hospital of Wenzhou Medical University from January 2012 to December 2021 were selected as the observation group, and 50 healthy physical examination personnel were randomly selected as the control group. Patients with PQ poisoning were divided into survival group and death group according to the prognosis, and the differences of blood routine routine, liver and kidney function and other indicators in the first admission between the two groups were compared. Multivariate logisitic regression model was established, ROC curve was drawn, and the influencing factors of prognosis of patients with PQ poisoning were analyzed. Results: Compared with the control group, the white blood cell count (WBC), total bilirubin (TBil), alanine aminotransferase (ALT), aspartate aminotransferase (AST), LDH, glucose (GLU) and creatinine (Cr) in observation group were significantly increased, while albumin (ALB) and total cholesterol (TC) were significantly decreased (P<0.05). Univariate analysis showed that WBC, elevated LDH (>247 U/L), TBil, ALT, AST and Cr were significantly different between PQ poisoning survival group and death group (P<0.05). Multivariate logisitic regression analysis showed that elevated serum LDH was an independent risk factor for the prognosis of PQ poisoning patients (OR=9.95, 95%CI: 1.34-73.82, P=0.025). The area under the ROC curve of LDH was 0.811 (95%CI: 0.692-0.930). When the cut-off value was 340 U/L, the sensitivity was 0.889 and the specificity was 0.719. Log-rank test showed that there was a statistically significant difference in survival rate between the normal LDH group and the elevated LDH group (P=0.001) . Conclusion: Serum LDH has a good predictive value in evaluating the prognosis of patients with PQ poisoning. Elevated LDH is a risk factor for poor prognosis of patients with PQ poisoning.

12.
Chinese Journal of Epidemiology ; (12): 885-890, 2023.
Article in Chinese | WPRIM | ID: wpr-985608

ABSTRACT

Objective: To determine the causal association between long-term Nitrogen dioxide (NO2) exposure and the risk of cardiovascular hospitalization. Methods: Based on a sub-cohort of a community-based prospective cohort study, a total of 36 271 participants were recruited from 35 communities randomly selected in Guangzhou in 2015. The annual average exposure of NO2, demographic characteristics, lifestyle factors, and information on the causes of hospitalization was collected. We applied marginal structural Cox models to investigate the effect of NO2 on cardiovascular hospitalization. Demographic and behavioral factors also stratified results. Results: The mean age of participants in the present study was (50.9±17.8) years, and the cardiovascular admission rate was 8.7%, with 203 822 person-years of follow-up. The annual mean NO2 concentration was 48.7 μg/m3 during 2015-2020. For each 10 μg/m3 increase in NO2 concentrations, the HRs (95%CIs) of total cardiovascular hospitalization, cardiovascular hospitalization, and cerebrovascular hospitalization were 1.33 (1.16-1.52), 1.36 (1.16-1.60) and 1.25 (1.00-1.55), respectively. Participants who were never married/married, with secondary education, high exercise frequency, or non-smokers/current smokers may be more susceptible than their counterparts. Conclusion: Long-term exposure to NO2 significantly increased hospitalization risk for cardiovascular disease.


Subject(s)
Humans , Adult , Middle Aged , Aged , Nitrogen Dioxide , Prospective Studies , Cardiovascular Diseases/epidemiology , Causality , Hospitalization
13.
Chinese Journal of Epidemiology ; (12): 689-693, 2023.
Article in Chinese | WPRIM | ID: wpr-985548

ABSTRACT

A crucial lesson gained through the pandemic preparedness and response to COVID-19 is that all measures for epidemic control must be law-based. The legal system is related not only to public health emergency management per se but also to all aspects of the institutional supporting system throughout the lifecycle. Based on the lifecycle emergency management model, this article analyses the problems of the current legal system and the potential solutions. It is suggested that the lifecycle emergency management model shall be followed to establish a more comprehensive public health legal system and to gather the intelligence and consensus of experts with different expertise, including epidemiologists, sociologists, economists, jurist and others, which will collaboratively promote the science-based legislation in the field of epidemic preparedness and response for the establishment of a comprehensive legal system for public health emergency management and with Chinese characteristics.


Subject(s)
Humans , China , Pandemics/prevention & control , Public Health , Emergencies , Disaster Planning
14.
Chinese Journal of Hematology ; (12): 395-400, 2023.
Article in Chinese | WPRIM | ID: wpr-984635

ABSTRACT

Objective: To compare the predictive efficacy of the two thrombosis risk assessment scores (Padua and IMPEDE scores) in venous thromboembolism (VTE) within 6 months in patients with newly diagnosed multiple myeloma (NDMM) in China. Methods: This study reviewed the clinical data of 421 patients with NDMM hospitalized in Beijing Jishuitan Hospital from April 2014 to February 2022. The sensitivity, specificity, accuracy, and Youden index of the two scores were calculated to quantify the thrombus risk assessment of VTE by the Padua and IMPEDE scores. The receiver operating characteristics curves of the two evaluation scores were drawn. Results: The incidence of VTE was 14.73%. The sensitivity, specificity, accuracy, and Youden index of the Padua score were 100%, 0%, 14.7%, and 0% and that of the IMPEDE score was 79%, 44%, 49.2%, and 23%, respectively. The areas under the curve of Padua and IMPEDE risk assessment scores were 0.591 and 0.722, respectively. Conclusion: IMPEDE score is suitable for predicting VTE within 6 months in patients with NDMM.


Subject(s)
Humans , Venous Thromboembolism/etiology , Multiple Myeloma/diagnosis , Risk Assessment , Risk Factors , ROC Curve , Retrospective Studies
15.
Journal of Sun Yat-sen University(Medical Sciences) ; (6): 361-368, 2023.
Article in Chinese | WPRIM | ID: wpr-973231

ABSTRACT

ObjectiveTo observe the changes in the expression and distribution of G protein-gated inwardly rectifying potassium channel subunit 2 (GIRK2) in the dorsal root ganglion (DRG) and spinal cord dorsal horn of rats with remifentanil-induced hyperalgesia. MethodsHyperalgesia was induced by intravenous infusion of remifentanil 4 μg/kg/min for 2 h in adult male SD rats. At 6th hour and on days 1, 3 and 5 following remifentanil treatment, we used immunofluorescence to examine the changes in the GIRK2 distribution and expression. Immunoblotting was used to detect GIRK2 expression of the total protein and membrane protein in DRG and spinal dorsal horn of rats. Behavioral testing was applied to evaluate the effect of intrathecal injection of GIRK2-specific agonist ML297 on thermal nociceptive threshold on day 1 after remifentanil infusion. Resultsmmunofluorescence results showed that GIRK2 was mainly co-localized with IB4-positive small neurons in DRG and nerve fibers in spinal dorsal horn. GIRK2 expression was significantly downregulated following remifentanil treatment. Immunoblotting results revealed that on day 1 following intravenous infusion of remifentanil, compared with those in the control group, GIRK2 expression levels of the total protein and membrane protein in DRG (0.47 ± 0.10 vs. 1.01 ± 0.17, P < 0.001; 0.47 ± 0.11 vs. 1.06 ± 0.12, P < 0.001) and spinal dorsal horn (0.52 ± 0.09 vs. 1.10 ± 0.08, P < 0.001; 0.54 ± 0.10 vs. 1.01 ± 0.13, P < 0.001) were all significantly decreased. The behavioral results showed that intrathecal ML297 effect on thermal withdrawal latency was significantly reduced following remifentanil treatment (P < 0.001). ConclusionsRemifentanil might induce hyperalgesia via down-regulating GIRK2 expression in rat DRG and spinal cord dorsal horn.

16.
Chinese Journal of Medical Genetics ; (6): 276-281, 2023.
Article in Chinese | WPRIM | ID: wpr-970918

ABSTRACT

OBJECTIVE@#To retrospectively analyze the clinical phenotypes and genetic variants in two Chinese pedigrees affected with Hereditary hypofibrinemia (IFD) and explore their molecular pathogenesis.@*METHODS@#Two probands and their pedigree members were admitted to the First Affiliated Hospital of Wenzhou Medical University on March 30, 2021 and May 27, 2021, respectively. Clinical phenotypes of the probands were collected, and blood clotting indexes of the probands and their pedigree members were determined. Variants of the FGA, FGB and FGG genes were analyzed by Sanger sequencing, and candidate variants were verified by sequence comparison. Bioinformatic software was used to analyze the conservation of the amino acids and pathogenicity of the proteins. Alteration in protein structure and intermolecular force before and after the variant was analyzed by simulating the protein model.@*RESULTS@#Proband 1, a 18-year-old male, had significantly low plasma fibrinogen activity (Fg:C) and plasma fibrinogen antigen (Fg:Ag), respectively at 0.80 g/L and 1.00 g/L. Proband 2, a 43-year-old male, had slightly low Fg:C and Fg:Ag at 1.35 g/L and 1.30 g/L, respectively. The Fg:C and Fg:Ag of proband 1's father, proband 2's father and son were also below the normal level. Genetic testing showed that proband 1 had harbored a heterozygous missense variant of c.688T>G (p.Phe230Val) in exon 7 of the FGG gene, which was inherited from his father. Proband 2, his father and son all had harbored a heterozygous variant of c.2516A>C (p.Asn839Thr) in exon 6 of the FGA gene. Homology analysis showed that the Phe230 and Asn839 residues were highly conserved among homologous species. Bioinformatic analysis predicted that both p.Phe230Val and p.Asn839Thr were pathogenic variants.@*CONCLUSION@#Analysis of protein simulation model showed that the p.Asn839Thr variant has changed the hydrogen bo`nd between the amino acids, thus affecting the stability of the protein structure. The heterozygous missense variants of p.Phe230Val and p.Asn839Thr probably underlay the IFD in the two pedigrees.


Subject(s)
Humans , Male , Amino Acids , East Asian People , Exons , Pedigree , Retrospective Studies , Afibrinogenemia/genetics , Mutation, Missense , Fibrinogen/genetics
17.
Chinese Journal of Hematology ; (12): 112-117, 2023.
Article in Chinese | WPRIM | ID: wpr-969685

ABSTRACT

Objective: To evaluate the advantages and safety of Plerixafor in combination with granulocyte colony-stimulating factor (G-CSF) in autologous hematopoietic stem cell mobilization of lymphoma. Methods: Lymphoma patients who received autologous hematopoietic stem cell mobilization with Plerixafor in combination with G-CSF or G-CSF alone were obtained. The clinical data, the success rate of stem cell collection, hematopoietic reconstitution, and treatment-related adverse reactions between the two groups were evaluated retrospectively. Results: A total of 184 lymphoma patients were included in this analysis, including 115 cases of diffuse large B-cell lymphoma (62.5%) , 16 cases of classical Hodgkin's lymphoma (8.7%) , 11 cases of follicular non-Hodgkin's lymphoma (6.0%) , 10 cases of angioimmunoblastic T-cell lymphoma (5.4%) , 6 cases of mantle cell lymphoma (3.3%) , and 6 cases of anaplastic large cell lymphoma (3.3%) , 6 cases of NK/T-cell lymphoma (3.3%) , 4 cases of Burkitt's lymphoma (2.2%) , 8 cases of other types of B-cell lymphoma (4.3%) , and 2 cases of other types of T-cell lymphoma (1.1%) ; 31 patients had received radiotherapy (16.8%) . The patients in the two groups were recruited with Plerixafor in combination with G-CSF or G-CSF alone. The baseline clinical characteristics of the two groups were basically similar. The patients in the Plerixafor in combination with the G-CSF mobilization group were older, and the number of recurrences and third-line chemotherapy was higher. 100 patients were mobilized with G-CSF alone. The success rate of the collection was 74.0% for one day and 89.0% for two days. 84 patients in the group of Plerixafor combined with G-CSF were recruited successfully with 85.7% for one day and 97.6% for two days. The success rate of mobilization in the group of Plerixafor combined with G-CSF was substantially higher than that in the group of G-CSF alone (P=0.023) . The median number of CD34(+) cells obtained in the mobilization group of Plerixafor combined with G-CSF was 3.9×10(6)/kg. The median number of CD34(+) cells obtained in the G-CSF Mobilization group alone was 3.2×10(6)/kg. The number of CD34(+) cells collected by Plerixafor combined with G-CSF was considerably higher than that in G-CSF alone (P=0.001) . The prevalent adverse reactions in the group of Plerixafor combined with G-CSF were grade 1-2 gastrointestinal reactions (31.2%) and local skin redness (2.4%) . Conclusion: The success rate of autologous hematopoietic stem cell mobilization in lymphoma patients treated with Plerixafor combined with G-CSF is significantly high. The success rate of collection and the absolute count of CD34(+) stem cells were substantially higher than those in the group treated with G-CSF alone. Even in older patients, second-line collection, recurrence, or multiple chemotherapies, the combined mobilization method also has a high success rate of mobilization.


Subject(s)
Humans , Granulocyte Colony-Stimulating Factor/therapeutic use , Hematopoietic Stem Cell Mobilization/methods , Hematopoietic Stem Cell Transplantation , Heterocyclic Compounds/adverse effects , Lymphoma/drug therapy , Lymphoma, T-Cell/therapy , Multiple Myeloma/drug therapy , Retrospective Studies , Transplantation, Autologous
18.
International Eye Science ; (12): 668-671, 2023.
Article in Chinese | WPRIM | ID: wpr-965798

ABSTRACT

AIM: To investigate the clinical efficacy and safety of ultrasonic ciliary plasty(UCP)combined with injection of anti-vascular endothelial growth factor(VEGF)in the treatment of neovascular glaucoma(NVG).METHODS: A total of 30 NVG patients(30 eyes)admitted to the First Affiliated Hospital of Bengbu Medical College from September 2020 to September 2021 were selected. After admission, all the eyes of the patients were injected with anti-VEGF drug(ranibizumab). After surgery, 15 patients were randomly selected for UCP treatment(UCP group), and the other 15 patients received trabeculectomy(trabeculectomy group). During the 10mo postoperative follow-up, the decrease of intraocular pressure was compared between the two groups and the changes of the degree of ocular pain and the occurrence of related complications were evaluated at each follow-up visit.RESULTS: The intraocular pressure and pain degree of the UCP and trabeculectomy groups were significantly lower than those before operation, and the complication probability of the UCP group was less than that of the trabeculectomy group.CONCLUSION: With fewer complications and high safety, UCP combined with anti-VEGF injection can effectively control intraocular pressure and pain in NVG patients.

19.
Journal of Environmental and Occupational Medicine ; (12): 1327-1333, 2023.
Article in Chinese | WPRIM | ID: wpr-998759

ABSTRACT

Per- and polyfluoroalkyl substances (PFASs) are persistent organic pollutants (POPs). They are widely used in food packaging, tableware coating, stain resistant furniture, and other industrial production. Humans are exposed to PFASs on a daily basis through drinking water and intaking food, use of consumer products containing PFASs, and occupational exposure during the production of PFASs or related products. A growing body of toxicological studies has shown that PFASs exposure disrupts the thyroid hormone (TH) system and causes hypothyroidism, which is further supported by population epidemiological studies. PFASs can damage thyroid follicular cells and sodium/iodine transporters to impair iodine uptake by thyroid cells. They interfere with the synthesis of thyroglobulin, reduce the activity of thyroid peroxidase, and affect the synthesis and secretion of TH. They interfere with TH transportation and biological effects via TH competitive binding thyroid transporter or thyroid hormone receptor. They suppress TH signaling pathway and deiodinase activity, interfere negative feedback mechanism, and accelerate TH metabolism and excretion. The processes of TH synthesis, transport, degradation, and biological effects may all be affected by PFASs exposure. This paper described possible toxic mechanisms of PFASs on the thyroid from four aspects: TH biosynthesis, transport, action on target cells, and metabolic excretion stage, and summarized the thyroid toxicity associated with PFASs exposure.

20.
Chinese Journal of Medical Genetics ; (6): 733-736, 2023.
Article in Chinese | WPRIM | ID: wpr-981817

ABSTRACT

OBJECTIVE@#To explore the genetic basis for a Chinese pedigree with 6q26q27 microduplication and 15q26.3 microdeletion.@*METHODS@#A fetus with a 6q26q27 microduplication and a 15q26.3 microdeletion diagnosed at the First Affiliated Hospital of Wenzhou Medical University in January 2021 and members of its pedigree were selected as the study subject. Clinical data of the fetus was collected. The fetus and its parents were analyzed by G-banding karyotyping and chromosomal microarray analysis (CMA), and its maternal grandparents were also subjected to G-banding karyotype analysis.@*RESULTS@#Prenatal ultrasound had indicated intrauterine growth retardation of the fetus, though no karyotypic abnormality was found with the amniotic fluid sample and blood samples from its pedigree members. CMA revealed that the fetus has carried a 6.6 Mb microduplication in 6q26q27 and a 1.9 Mb microdeletion in 15q26.3, and his mother also carried a 6.49 duplication and a 1.867 deletion in the same region. No anomaly was found with its father.@*CONCLUSION@#The 6q26q27 microduplication and 15q26.3 microdeletion probably underlay the intrauterine growth retardation in this fetus.


Subject(s)
Female , Humans , Pregnancy , East Asian People , Fetal Growth Retardation/genetics , Karyotype , Pedigree , Prenatal Diagnosis , Sequence Deletion , Chromosome Duplication
SELECTION OF CITATIONS
SEARCH DETAIL