Mechanism of salvianolic acid B protecting H9C2 from OGD/R injury based on mitochondrial fission and fusion / 药学学报

This study aims to investigate the effect of salvianolic acid B (Sal B), the active ingredient of Salvia miltiorrhiza, on H9C2 cardiomyocytes injured by oxygen and glucose deprivation/reperfusion (OGD/R) through regulating mitochondrial fission and fusion. The process of myocardial ischemia-reperfusion injury was simulated by establishing OGD/R model. The cell proliferation and cytotoxicity detection kit (cell counting kit-8, CCK-8) was used to detect cell viability; the kit method was used to detect intracellular reactive oxygen species (ROS), total glutathione (t-GSH), nitric oxide (NO) content, protein expression levels of mitochondrial fission and fusion, apoptosis-related detection by Western blot. Mitochondrial permeability transition pore (MPTP) detection kit and Hoechst 33342 fluorescence was used to observe the opening level of MPTP, and molecular docking technology was used to determine the molecular target of Sal B. The results showed that relative to control group, OGD/R injury reduced cell viability, increased the content of ROS, decreased the content of t-GSH and NO. Furthermore, OGD/R injury increased the protein expression levels of dynamin-related protein 1 (Drp1), mitofusions 2 (Mfn2), Bcl-2 associated X protein (Bax) and cysteinyl aspartate specific proteinase 3 (caspase 3), and decreased the protein expression levels of Mfn1, increased MPTP opening level. Compared with the OGD/R group, it was observed that Sal B had a protective effect at concentrations ranging from 6.25 to 100 μmol·L-1. Sal B decreased the content of ROS, increased the content of t-GSH and NO, and Western blot showed that Sal B decreased the protein expression levels of Drp1, Mfn2, Bax and caspase 3, increased the protein expression level of Mfn1, and decreased the opening level of MPTP. In summary, Sal B may inhibit the opening of MPTP, reduce cell apoptosis and reduce OGD/R damage in H9C2 cells by regulating the balance of oxidation and anti-oxidation, mitochondrial fission and fusion, thereby providing a scientific basis for the use of Sal B in the treatment of myocardial ischemia reperfusion injury.

Noninvasive Diagnostic Technique for Nonalcoholic Fatty Liver Disease Based on Features of Tongue Images / 中国结合医学杂志

OBJECTIVE@#To investigate a new noninvasive diagnostic model for nonalcoholic fatty liver disease (NAFLD) based on features of tongue images.@*METHODS@#Healthy controls and volunteers confirmed to have NAFLD by liver ultrasound were recruited from China-Japan Friendship Hospital between September 2018 and May 2019, then the anthropometric indexes and sampled tongue images were measured. The tongue images were labeled by features, based on a brief protocol, without knowing any other clinical data, after a series of corrections and data cleaning. The algorithm was trained on images using labels and several anthropometric indexes for inputs, utilizing machine learning technology. Finally, a logistic regression algorithm and a decision tree model were constructed as 2 diagnostic models for NAFLD.@*RESULTS@#A total of 720 subjects were enrolled in this study, including 432 patients with NAFLD and 288 healthy volunteers. Of them, 482 were randomly allocated into the training set and 238 into the validation set. The diagnostic model based on logistic regression exhibited excellent performance: in validation set, it achieved an accuracy of 86.98%, sensitivity of 91.43%, and specificity of 80.61%; with an area under the curve (AUC) of 0.93 [95% confidence interval (CI) 0.68-0.98]. The decision tree model achieved an accuracy of 81.09%, sensitivity of 91.43%, and specificity of 66.33%; with an AUC of 0.89 (95% CI 0.66-0.92) in validation set.@*CONCLUSIONS@#The features of tongue images were associated with NAFLD. Both the 2 diagnostic models, which would be convenient, noninvasive, lightweight, rapid, and inexpensive technical references for early screening, can accurately distinguish NAFLD and are worth further study.

Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Antithrombin deficiency caused by SERPINC1 gene mutations predispose to venous thrombotic events / 中华检验医学杂志

Objective:To analyze 12 antithrombins (AT) gene mutations that cause AT deficiency and discuss the relationship between the SERPINC1 gene. mutations and venous thrombotic events.Methods:This study belongs to case series of observational studies. Collected the clinical data of 12 AT deficiency cases in the First Affiliated Hospital of Wenzhou Medical University from April 2014 to April 2021 and collected the blood samples before treatment. The AT activity (AT: A) and AT antigen (AT: Ag) was detected by chromogenic substrate and immunoturbidimetry, respectively. The 7 exons and flanking sequences of the SERPINC1 gene were sequenced directly by PCR, the suspected mutations were validated by reverse sequencing. Analyzed the correlation between the SERPINC1 gene. mutations and venous thrombotic events and figured out the proportion.Results:The AT: A of the 12 patients all decreased significantly, ranging from 30% to 66%, and the AT: Ag of the 7 patients decreased accordingly, showing type Ⅰ AT deficiency, and the AT: Ag of the other 5 patients were normal, presented type Ⅱ AT deficiency. 12 mutations were found including 6 heterozygous mutations which were discovered for the first time: c.456_458delCTT(p.phe121del), c.318_319insT(p.Asn75stop), c.922G>T(p.Gly276Cys), c.938T>C (p.Met281Thr), c.1346T>A(p.Leu417Gln)and c.851T>C(p.Met252Thr). All 12 patients had venous thrombosis, and 3 cases including 2 compound heterozygotes and 1 single heterozygote all suffered from deep venous thrombosis (DVT) when they were younger without obvious triggers. The other 9 patients all combined with the other thrombotic factors including old age, hypertensive, smoking, pregnancy, and prolonged immobilization.Conclusion:Patients with AT deficiency caused by SERPINC1 gene defects are prone to venous thrombosis, especially combined with other thrombotic factors.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Endovascular treatment of ruptured lobulated anterior communicating artery aneurysms: A retrospective case series study of 24 patients / 国际脑血管病杂志

Objective:To investigate the efficacy and safety of endovascular treatment for ruptured lobulated anterior communicating artery aneurysm (ACoAA).Methods:Patients with ruptured lobulated ACoAA received endovascular treatment in Sanming First Hospital Affiliated to Fujian Medical University from June 2020 to June 2022 were retrospectively included. Their demographic, clinical and imaging characteristics, endovascular treatment methods and follow-up results were collected.Results:A total of 24 patients with ruptured lobulated ACoAA were included, including 9 males (37.5%) and 15 females (62.5%). Their age was 56.2±8.9 years old (range 39-74). The time from rupture to endovascular treatment was 10.9±12.5 h. The maximum diameter of the aneurysms was 5.1±1.0 mm and neck width was 3.0±0.7 mm. Nineteen patients (79.2%) were double-lobed and 5 (20.8%) were multilobed. Fisher's grade: grade 2 in 16 cases (66.7%), grade 3 in 6 cases (25%), and grade 4 in 2 cases (8.3%). Hunt-Hess grade: grade 0-2 in 5 cases (20.8%), grade 3-5 in 19 cases (79.2%). Glasgow Coma Scale score: 9-12 in 14 cases (58.3%), 13-15 in 10 cases (41.7%). Immediately postprocedural Raymond-Roy grade: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Raymond-Roy grade in imaging follow-up for 2 weeks to 3 months: grade 1 in 23 cases (95.8%), grade 2 in 1 case (4.2%). Follow-up for 2 to 12 months showed that 21 patients (87.5%) had good functional outcomes (modified Rankin Scale score ≤2), and there were no deaths.Conclusion:Endovascular treatment is a safe and effective treatment for ruptured lobulated AcoAA.

Risk Factors of Hypogonadism in Male Patients with Hyperuricemia in Xinjiang / 中山大学学报(医学科学版)

ObjectiveTo explore the risk factors of hypogonadism in male hyperuricemia （HUA） patients in Xinjiang. MethodsClinical data of 217 male patients with HUA admitted to the Department of Endocrinology and Metabolism of the People's Hospital of Xinjiang Uygur Autonomous Region from June 2021 to December 2022 were collected. Patients meeting the diagnostic criteria for hypogonadism were included in the case group （98 cases）， and patients with normal gonadism were included in the control group （119 cases）. The differences of different metabolic indexes between the two groups and the correlation of male hypogonadism were analyzed. ResultsCompared with those in normal gonadal function group， in hypogonadism group， age， waist circumference （WC）， body mass index （BMI）， the levels of fasting blood glucose （FPG）， fasting insulin （FINS）， insulin resistance index assessed by homeostasis model （HOMA-IR）， alanine aminotransferase （ALT）， blood uric acid （SUA） and sex hormone binding globulin （SHBG） were significantly increased； the levels of γ-glutamyltransferase （GGT）， 25-hydroxyvitamin D ［25（OH）D］， progesterone （P）， estradiol （E2）， dehydroepiandrosterone （DHEA） and serum free triiodothyronine （FT3） were significantly decreased （P < 0.05）； and the proportion of patients with obesity （OB）， non-alcoholic fatty liver （NAFLD）， hyperlipidemia （HLP）， hypertension （HBP）， coronary heart disease （CHD） and use of angiotensin receptor antagonist （ARB） and aspirin was significantly increased （P < 0.05）. Correlation analyses showed that free testosterone （FT） was negatively correlated with age， WC， BMI， FPG， FINS， HOMA-IR， SUA， SHBG and ALT， but positively correlated with 25（OH）D， P， E2， DHEA and FT3 （P < 0.05）. Logistic regression analysis showed that age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC were independent risk factors for hypogonadism （P < 0.05）. After multivariate adjustment， SUA remained an independent risk factor for hypogonadism ［OR = 1.009， 95%CI （1.004， 1.015）， P = 0.001］. ConclusionsMale HUA patients are often accompanied with hypogonadism. Age， hypertension， BMI， SUA， ALT， 25（OH）D， HOMA-IR and WC are independent risk factors of hypogonadism.

T cell receptor-based immunotherapy: a review / 生物工程学报

T cells play central roles in anti-tumor immune responses. Immune checkpoint therapy, which is based on modulation of T cell reactivity, has achieved breakthrough in clinical treatment of multiple tumors. Moreover, adoptive T cell therapy, which includes mainly genetically engineered T cells, has shown substantial treatment efficacy in hematoma. Immune therapy has tremendously changed the scenario of clinical tumor treatment and become critical strategies for treating multiple tumors. T cell receptor (TCR) is the fundamental molecule responsible for the specificity of T cell recognition. TCRs could recognize peptides, which are derived from intracellular or extracellular tumor antigens, presented by major histocompatibility complex (MHC) and are therefore highly sensitive to low antigen level. Thereby, TCRs are broadly recognized as promising molecules for the development of anti-tumor drugs. The approval of the first TCR drug in 2022 has initiated a new era for TCR-based therapeutics and since then, multiple TCR drugs have shown substantial treatment efficacy in multiple tumors. This review summarizes the progress of TCR-based immune therapeutic strategies, including T cell receptor-engineered T cell (TCR-T), TCR-based protein drugs, and other cell therapies based on TCR signaling, providing useful information for future design of immune therapeutics based on TCR.

Betulinic Acid Improves Cardiac Function in Septic Rats Through AKT / mTOR and AKT / AMPK -modulated Autophagy / 中国生物化学与分子生物学报

Betulinic acid (BA) exerts protective effects on organs in septic animals. However, whether BA can improve cardiac function in sepsis and the underlying mechanism remain unclear. Here, male Sprague-Dawley rats were pretreated with BA (25 mg/ kg/ d, i. g.) for 5 days and then intraperitoneally injected with lipopolysaccharide (LPS, 10 mg/ kg). The rats were anesthetized to determine transthoracic echocardiography using a high-resolution imaging system for small animals after they were treated with LPS for 6 h. Histopathologic alterations were examined by HE staining. Myocardial injury markers (cTnI and CK-MB) and inflammatory factors (TNF-α, IL-1β and IL-6) in the serum were measured by the enzyme-linked immunosorbent assay. Autophagy-related proteins (p62 and LC3 Ⅱ) and AKT-modulated autophagy pathways in the myocardium were determined by Western blotting. Pretreatment with BA markedly improved left ventricular ejection fraction (EF) and fraction shortening (FS) (P<0. 05), improved myocardial histomorphology, and significantly inhibited cTnI, CK-MB, TNF-α, IL-1β and IL-6 (P<0. 05) in the septic rat serum. BA markedly decreased p62 (P<0. 01), increased LC3 Ⅱ (P< 0. 001), and significantly down-regulated p-AKT (Thr308), p-AMPKα (Ser485/ 491), p-mTOR (Ser2448) and p-S6K (Thr389) (P<0. 05), while markedly up-regulated p-AMPKα (Thr172) and pULK1 (Ser317) (P<0. 01) in septic rat hearts. The findings indicate that BA can attenuate sepsis-induced myocardial dysfunctions associated with down-regulating autophagy inhibiting pathways mediated by AKT/ mTOR and AKT/ AMPK pathways.

ADAR1 regulates vascular remodeling in hypoxic pulmonary hypertension through N1-methyladenosine modification of circCDK17

Pulmonary hypertension (PH) is an extremely malignant pulmonary vascular disease of unknown etiology. ADAR1 is an RNA editing enzyme that converts adenosine in RNA to inosine, thereby affecting RNA expression. However, the role of ADAR1 in PH development remains unclear. In the present study, we investigated the biological role and molecular mechanism of ADAR1 in PH pulmonary vascular remodeling. Overexpression of ADAR1 aggravated PH progression and promoted the proliferation of pulmonary artery smooth muscle cells (PASMCs). Conversely, inhibition of ADAR1 produced opposite effects. High-throughput whole transcriptome sequencing showed that ADAR1 was an important regulator of circRNAs in PH. CircCDK17 level was significantly lowered in the serum of PH patients. The effects of ADAR1 on cell cycle progression and proliferation were mediated by circCDK17. ADAR1 affects the stability of circCDK17 by mediating A-to-I modification at the A5 and A293 sites of circCDK17 to prevent it from m1A modification. We demonstrate for the first time that ADAR1 contributes to the PH development, at least partially, through m1A modification of circCDK17 and the subsequent PASMCs proliferation. Our study provides a novel therapeutic strategy for treatment of PH and the evidence for circCDK17 as a potential novel marker for the diagnosis of this disease.

Traditional application and modern research progress on new foreign medicinal resources / 中国中药杂志

Chinese medicinal resources are the material basis for the survival and development of traditional Chinese medicine(TCM)and the sustainable development of Chinese medicinal resources is also an important project for the modernization of TCM in China. With the increasing demand for Chinese medicinal resources in China, over-exploitation has destroyed Chinese medicinal resources, resulting in a shortage of many natural medicinal resources in China and making the sustainable development of TCM in trouble. The introduced new foreign medicinal resources have become effective supplement and replacement for Chinese medicinal resources to some extent. However, the development and utilization of new foreign medicinal resources in China are different. To fully understand the development of new foreign medicinal resources in China, this paper, taking 43 new foreign medicinal resources such as Acacia nilotica as objects, sorted out the introduction forms and policies of new foreign medicinal resources, overviewed its current development status in China, summarized the application experience of new foreign medicinal resources in the place of origin, as well as the research progress and problems of new foreign medicinal resources in China and abroad, and analyzed the research situation, which can enrich Chinese medicinal resources and other uses, promote the sustainable development of Chinese medicinal resources, and provide ideas for further development and research of new foreign medicinal resources.

Effects of stereoscopic traction on photosynthetic characteristics, yield, and quality of Codonopsis pilosula under organic cultivation / 中国中药杂志

To solve the serious problem of stem and leaf shading in the middle and late stage of traditional flat planting of Codonopsis pilosula, this study analyzed the effects of different stereoscopic traction heights on the photosynthetic characteristics and growth of C. pilosula and explored the optimal traction height to improve the yield and quality of C. pilosula. The experiment designed three stereo-scopic traction heights [H1(60 cm), H2(90 cm), and H3(120 cm)] with natural growth without traction as the control(CK). The results showed that the increase in stereoscopic traction heights broadened the growth space of stems and leaves of C. pilosula, enhanced the ventilation effect, significantly increased the average daily net photosynthetic rate of C. pilosula, promoted the absorption of intercellular CO_2, decreased the transpiration rate, and reduced the evaporation of water. Moreover, it effectively avoided the problem of weakened photosynthesis, maintained the carbon balance of individual plants, and promoted the growth and development of the C. pilosula roots. In terms of the seed yield of C. pilosula, it was ranked as H2>H1>H3>CK. To be specific, H1 increased by 213.41% compared with CK, H2 increased by 282.43% compared with CK, and H3 increased by 133.95% compared with CK. The yield and quality of C. pilosula were the highest in the H3 treatment group, with the fresh yield of 6 858.33 kg·hm~(-2), 50.59% higher than CK, dry yield of 2 398.33 kg·hm~(-2), 76.54% higher than CK, and lobetyolin content of 0.56 mg·g~(-1), 45.22% higher than CK. Therefore, the stereoscopic traction height has a great influence on the photosynthetic characteristics, yield, and quality of C. pilosula. Particularly, the yield and quality of C. pilosula can be optimized and improved in the traction height treatment of H3(120 cm). This planting method is worth popularizing and applying in the cultivated management of C. pilosula.

Application of high-speed counter current chromatography in extraction and separation of alkaloids in natural products / 中国中药杂志

Alkaloids, widespread in plants, have a series of pharmacological activities and have been widely used to treat various diseases. Because alkaloids are usually presented in multicomponent mixtures and are deeply low in content, they are very difficult to extract and separate by traditional methods. High-speed counter current chromatography(HSCCC) is a kind of liquid-liquid chromatography without solid support phase, which has the advantages of large injection volume, low cost, and no irreversible adsorption. Compared with the traditional methods of extraction and separation of alkaloids, HSCCC can ensure the separation of many different alkaloids at one time, with a high recovery and large amount. In this paper, the advantages and disadvantages of HSCCC compared with traditional separation methods were discussed and the solvent system and elution mode of HSCCC used to separate alkaloids in recent years were summarized by referring to the relevant literature to provide some references for the separation of alkaloids by HSCCC.

To explore the quality markers of Huangqin Qingre Chubi capsule in the treatment of rheumatoid arthritis based on network pharmacology combined with pharmacokinetics and target verification / 药学学报

As an effective prescription for the treatment of rheumatoid arthritis (RA), Huangqin Qingre Chubi capsule (HQC) is still blank in quality control. This study aims to explore quality markers (Q-markers) for HQC in the treatment of RA by integrating network pharmacology and pharmacokinetics. By constructing the visualization network of "pharmacodynamic ingredient-target-pathway", the potential Q-Marker of HQC treatment for RA was preliminatively predicted. A rat model of rheumatic heat obstruction syndrome collagene-induced arthritis (CIA) was established to elucidate the dynamic quantification law of pharmacodynamic components of HQC in the disease state of rats. To establish the inflammatory model of RA synovial fibroblasts (MH7A) induced by tumor necrosis factor-α (TNF-α) in vitro. The effects of active ingredients on protein expression of sphingosin kinase-1 (Sphk1) and p-SphK1 were detected. The network pharmacological results showed that baicalin, geniposide, luteolin, coixol and amygdalin were the important active components of HQC treatment for RA. Quantitative analysis results further verified the measurability of these five components. The expression of Sphk1 and p-SphK1 was significantly inhibited by geniposide and baicalin by Western blotting. The above studies determined that the above 5 components could be used as Q-markers in the treatment of RA by HQC. This experiment was approved by the Experimental Animal Ethics Committee of Anhui University of Chinese Medicine (approval number: AHUCM-rats-2021049). All procedures were conducted in strict accordance with the principles of animal use and care.

Effect of Zishenwan on Intestinal Barrier and Transcriptome of Skeletal Muscle of db/db Diabetic Mice / 中国实验方剂学杂志

ObjectiveTo explore the effect of Zishenwan on glucose and lipid metabolism in spontaneous type 2 diabetes （db/db） mice and investigate the underlying mechanism for improving diabetes based on intestinal barrier function and skeletal muscle transcriptome sequencing results. MethodLiquid chromatography-tandem mass spectrometry （LC-MS/MS） was used to analyze the components of Zishenwan. Sixteen 6-week-old db/db mice were divided into a model group and a Zishenwan group， while eight wild-type mice were assigned to the normal group. The Zishenwan group received oral administration of drugs for six weeks， during which fasting blood glucose， body weight， and food intake were measured. Serum total cholesterol （TC） and triglyceride （TG） levels were determined， and fasting insulin levels were measured to calculate the homeostatic model assessment of insulin resistance （HOMA-IR）. After the treatment， skeletal muscle and ileum tissues were collected， followed by hematoxylin-eosin （HE） staining. Immunohistochemistry was used to detect the expression of tight junction proteins occludin and zonula occludens-1 （ZO-1） in the ileum. Transcriptome sequencing was performed to detect the skeletal muscle transcriptome， and enrichment analysis was conducted for differentially expressed genes. ResultMultiple active components were identified in Zishenwan. Compared with the normal group， the model group showed increased fasting blood glucose， body weight， TC， TG， and HOMA-IR （P<0.01）. Compared with the model group， Zishenwan significantly reduced fasting blood glucose， body weight， TC， TG， and HOMA-IR in db/db mice （P<0.01）， while there was no statistically significant difference in food intake. Compared with the normal group， the model group exhibited lipid deposition in skeletal muscle， as well as structural changes in the ileum， with significant decreases in the protein expression levels of intestinal occludin and ZO-1 （P<0.01）. Compared with the model group， Zishenwan improved the pathological changes in skeletal muscle and ileum， and increased the protein expression of occludin and ZO-1 in the ileum （P<0.01）. Transcriptome analysis suggested that Zishenwan might improve skeletal muscle metabolism and increase insulin sensitivity in mice. ConclusionZishenwan can improve glucose and lipid metabolism in db/db mice， and this effect may be related to its protection of intestinal barrier function and transcriptional regulation of skeletal muscle metabolism-related genes.

A novel method for electroencephalography background analysis in neonates with hypoxic-ischemic encephalopathy / 中国当代儿科杂志

OBJECTIVES@#To explore a new method for electroencephalography (EEG) background analysis in neonates with hypoxic-ischemic encephalopathy (HIE) and its relationship with clinical grading and head magnetic resonance imaging (MRI) grading.@*METHODS@#A retrospective analysis was performed for the video electroencephalography (vEEG) and amplitude-integrated electroencephalography (aEEG) monitoring data within 24 hours after birth of neonates diagnosed with HIE from January 2016 to August 2022. All items of EEG background analysis were enrolled into an assessment system and were scored according to severity to obtain the total EEG score. The correlations of total EEG score with total MRI score and total Sarnat score (TSS, used to evaluate clinical gradings) were analyzed by Spearman correlation analysis. The total EEG score was compared among the neonates with different clinical gradings and among the neonates with different head MRI gradings. The receiver operating characteristic (ROC) curve and the area under thecurve (AUC) were used to evaluate the value of total EEG score in diagnosing moderate/severe head MRI abnormalities and clinical moderate/severe HIE, which was then compared with the aEEG grading method.@*RESULTS@#A total of 50 neonates with HIE were included. The total EEG score was positively correlated with the total head MRI score and TSS (rs=0.840 and 0.611 respectively, P<0.001). There were significant differences in the total EEG score between different clinical grading groups and different head MRI grading groups (P<0.05). The total EEG score and the aEEG grading method had an AUC of 0.936 and 0.617 respectively in judging moderate/severe head MRI abnormalities (P<0.01) and an AUC of 0.887 and 0.796 respectively in judging clinical moderate/severe HIE (P>0.05). The total EEG scores of ≤6 points, 7-13 points, and ≥14 points were defined as mild, moderate, and severe EEG abnormalities respectively, which had the best consistency with clinical grading and head MRI grading (P<0.05).@*CONCLUSIONS@#The new EEG background scoring method can quantitatively reflect the severity of brain injury and can be used for the judgment of brain function in neonates with HIE.

Genetic analysis of two Chinese pedigrees affected with Hereditary hypofibrinemia due to missense variants / 中华医学遗传学杂志

OBJECTIVE@#To retrospectively analyze the clinical phenotypes and genetic variants in two Chinese pedigrees affected with Hereditary hypofibrinemia (IFD) and explore their molecular pathogenesis.@*METHODS@#Two probands and their pedigree members were admitted to the First Affiliated Hospital of Wenzhou Medical University on March 30, 2021 and May 27, 2021, respectively. Clinical phenotypes of the probands were collected, and blood clotting indexes of the probands and their pedigree members were determined. Variants of the FGA, FGB and FGG genes were analyzed by Sanger sequencing, and candidate variants were verified by sequence comparison. Bioinformatic software was used to analyze the conservation of the amino acids and pathogenicity of the proteins. Alteration in protein structure and intermolecular force before and after the variant was analyzed by simulating the protein model.@*RESULTS@#Proband 1, a 18-year-old male, had significantly low plasma fibrinogen activity (Fg:C) and plasma fibrinogen antigen (Fg:Ag), respectively at 0.80 g/L and 1.00 g/L. Proband 2, a 43-year-old male, had slightly low Fg:C and Fg:Ag at 1.35 g/L and 1.30 g/L, respectively. The Fg:C and Fg:Ag of proband 1's father, proband 2's father and son were also below the normal level. Genetic testing showed that proband 1 had harbored a heterozygous missense variant of c.688T>G (p.Phe230Val) in exon 7 of the FGG gene, which was inherited from his father. Proband 2, his father and son all had harbored a heterozygous variant of c.2516A>C (p.Asn839Thr) in exon 6 of the FGA gene. Homology analysis showed that the Phe230 and Asn839 residues were highly conserved among homologous species. Bioinformatic analysis predicted that both p.Phe230Val and p.Asn839Thr were pathogenic variants.@*CONCLUSION@#Analysis of protein simulation model showed that the p.Asn839Thr variant has changed the hydrogen bo`nd between the amino acids, thus affecting the stability of the protein structure. The heterozygous missense variants of p.Phe230Val and p.Asn839Thr probably underlay the IFD in the two pedigrees.

The rules of acupoint selection of acupuncture and moxibustion for scrofula in ancient times / 中国针灸

Based on data mining technology, the rules of acupoint selection of acupuncture-moxibustion for scrofula in ancient times were analyzed. The relevant articles of acupuncture and moxibustion for scrofula were searched in the Chinese Medical Code, and the original article, acupoint name, acupoint characteristic, and acupoint meridian tropism, etc. were screened and extracted. The Microsoft Excel 2019 was used to establish a acupoint prescription database, and the frequency of acupoints as well as their meridian tropism and characteristics were analyzed. The SPSS21.0 was applied to perform cluster analysis of acupuncture prescriptions; the SPSS Modeler 18.0 was used to perform the association rules analysis of the neck and the chest-armpit acupoints, respectively. As a result, 314 acupuncture prescriptions were extracted, including 236 single-acupoint prescriptions and 78 multiple-acupoints prescriptions (53 for neck and 25 for chest-armpit). A total of 54 acupoints were involved, with a total frequency of 530. The top 3 commonly-used acupoints were Tianjing (TE 10), Zulinqi (GB 41) and Taichong (LR 3); the most commonly-used meridians were hand shaoyang meridian, foot shaoyang meridian, hand yangming meridian and foot yangming meridian; the most commonly-used special acupoints were he-sea points and shu-stream points. The cluster analysis obtained 6 clusters, and the association rule analysis obtained that the core prescriptions of the neck were Quchi (LI 11), Jianyu (LI 15), Tianjing (TE 10) and Jianjing (GB 21), while the core prescriptions of the chest-armpit were Daling (PC 7), Yanglingquan (GB 34), Danzhong (CV 17), Jianjing (GB 21), Waiguan (TE 5), Zhigou (TE 6), Yuanye (GB 22) and Zhangmen (LR 13). The core prescriptions obtained from association rule analysis by difference areas were basically consistent with those by cluster analysis of total prescriptions.

Neonatal systemic pseudohypoaldosteronism type I / 中国当代儿科杂志

An 18-day-old male infant was admitted to the hospital due to recurrent hyperkalemia for more than 10 days. The neonate had milk refusal and dyspnea. The blood gas analysis revealed recurrent hyperkalemia, hyponatremia and metabolic acidosis. Adrenocortical hormone replacement therapy was ineffective. Additional tests showed a significant increase in aldosterone levels. Family whole exome sequencing revealed that the infant had compound heterozygous in the SCNNIA gene, inherited from both parents. The infant was diagnosed with neonatal systemic pseudohypoaldosteronism type I. The infant's electrolyte levels were stabilized through treatment with sodium polystyrene sulfonate and sodium supplement. The infant was discharged upon clinical recovery. This study provides a focused description of differential diagnosis of salt-losing syndrome in infants and introduces the multidisciplinary management of neonatal systemic pseudohypoaldosteronism type I.

Effect of procalcitonin on lipopolysaccharide-induced expression of nucleotide-binding oligomerization domain-like receptor protein 3 and caspase-1 in human umbilical vein endothelial cells / 中国当代儿科杂志

OBJECTIVES@#To study the effect of procalcitonin (PCT) on lipopolysaccharide (LPS)-induced expression of the pyroptosis-related proteins nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) and caspase-1 in human umbilical vein endothelial cells (HUVECs).@*METHODS@#HUVECs were induced by LPS to establish a model of sepsis-induced inflammatory endothelial cell injury. The experiment was divided into two parts. In the first part, HUVECs were randomly divided into four groups: normal control, LPS (1 μg/mL), PCT (10 ng/mL), and LPS+PCT (n=3 each). In the second part, HUVECs were randomly grouped: normal control, LPS, and LPS+PCT of different concentrations (0.1, 1, 10, and 100 ng/mL) (n=3 each). Quantitative real-time PCR and Western blot were used to measure the mRNA and protein expression levels of NLRP3 and caspase-1 in each group.@*RESULTS@#In the first experiment: compared with the normal control group, the PCT, LPS, and LPS+PCT groups had significantly upregulated mRNA and protein expression levels of NLRP3 and caspase-1 (P<0.05); compared with the LPS group, the LPS+PCT group had significantly downregulated mRNA and protein expression levels of NLRP3 and caspase-1 (P<0.05). In the second experiment: compared with those in the LPS group, the mRNA and protein expression levels of NLRP3 and caspase-1 in the LPS+PCT of different concentrations groups were significantly downregulated in a concentration-dependent manner (P<0.05).@*CONCLUSIONS@#LPS can promote the expression of the pyroptosis-related proteins NLRP3 and caspase-1 in HUVECs, while PCT can inhibit the LPS-induced expression of the pyroptosis-related proteins NLRP3 and caspase-1 in HUVECs in a concentration-dependent manner.