Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 169
Filter
1.
Article in Chinese | WPRIM | ID: wpr-934601

ABSTRACT

Objective: To evaluate the efficacy of Tuina (Chinese therapeutic massage) manipulation plus horse-riding squat exercise in treating knee osteoarthritis (KOA) and optimize the combining protocol. Methods: Based on a 2×2 factorial design, 120 eligible KOA patients were randomized into a manipulation group (group A1B2), a manipulation plus horse-riding squat group (group A1B1), a sitting knee-adjustment group (group A2B2 group), and a sitting knee-adjustment plus horse-riding squat group (group A2B1), with 30 cases in each group. The intervention was conducted three times a week, lasting for four weeks. The Western Ontario and McMaster Universities osteoarthritis index (WOMAC) was taken as the major measure for efficacy evaluation (including three component scores, pain, stiffness, and daily function, and total score). Results: The three component scores (pain, stiffness, and daily function) and the total score of WOMAC showed significant differences after the intervention in the four groups (P<0.05). There were significant inter-group differences in the WOMAC stiffness score amongst the four groups after the intervention (P<0.05). In group A1B1, the step length, stride, walking speed, and knee joint flexion angle changed significantly after treatment (P<0.05). After the intervention, the step length changed significantly in group A1B2 (P<0.05), and the walking speed changed significantly in group A2B1 (P<0.05). There were no significant differences in the step length, stride, walking speed, or knee joint flexion angle among the four groups (P>0.05). The extensor peak torque at 180 °/s changed significantly in group A1B2 after treatment (P<0.05). Neither the intra-group nor the inter-group comparisons of the four groups revealed significant differences in the other isokinetic muscle strength parameters (P>0.05). The main effect of manipulation showed significant in affecting the WOMAC pain and total scores (P<0.05). The main effect of horse-riding squat exercise showed significant in affecting the WOMAC pain and stiffness scores (P<0.05). Conclusion: The four treatment protocols all can improve the symptoms of KOA, for instance, relieving pain and stiffness, and enhancing daily function. Group A2B1 produces the most eminent effect in relieving joint stiffness. The main effects of both manipulation and horse-riding squat exercise are significant in reducing pain. Besides, the main effect of horse-riding squat exercise is significant in relieving joint stiffness.

2.
Article in Chinese | WPRIM | ID: wpr-933905

ABSTRACT

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

3.
Article in Chinese | WPRIM | ID: wpr-933684

ABSTRACT

Objective:To explore the effect of pre-transplant immunotherapy on the prognosis of transplant recipients with hepatocellular carcinoma(HCC).Methods:From June 2018 to September 2021, retrospective analysis was conducted for clinical data of 19 HCC-liver transplant recipients receiving pre-transplant immunotherapy in affiliated Huashan Hospital of Fudan University. Pre-transplant immunotherapy regimen, adverse reactions, post-transplant acute rejection, tumor recurrence and metastasis and other complications were recorded. According to the preoperative tumor imaging and the changes of alpha-fetoprotein level, tumor change during recipient waiting period was judged by the mRECIST standard. According to whether or not there was partial tumor remission, they were divided into two groups of non-remission( n=13)and remission( n=6). Postoperative conditions of two groups were compared. Kaplan-Meier method was used for calculating the survival rate of recipients after transplantation and survival curve and Log-rank test utilized for comparing the recurrence-free and overall survival rates of recipients at 1 and 2 years post-operation. Results:A total of 19 liver transplant recipients received immunotherapy plus targeted and transcatheter arterial chemoembolization(TACE) before transplant. In non-remission group, tumor was stable( n=9)and progressive( n=4); 6 cases in remission group had tumor partial remission. Two recipients in non-remission group were pathologically confirmed by liver biopsy to have acute rejection(2/19, 10.5%)and both recovered after glucocorticoid + rATG and glucocorticoid therapy. In non-remission group, 2 patients died from septic shock post-operation. Among 3 patients of tumor recurrence and metastasis post-operation, 2 cases survived with tumor and 1 died after tumor recurrence and metastasis. In remission group( n=6), none had postoperative tumor recurrence and metastasis. The recurrence-free survival rates of non-remission group recipients at 1 and 2 years post-operation were 76.9% and 76.9% and recurrence-free survival rates in remission group were 100% and 100% respectively and inter-group difference in RFS was not statistically significant( χ2=1.468, P=0.226). The overall survival rates of recipients in non-remission group at 1 and 2 years post-operation were 76.9% and 76.9% respectively. And recipients in remission group were 100% and 100% respectively and no statistically significant inter-group difference existed in OS( χ2=1.292, P=0.256). Conclusions:Without a significantly higher risk of acute rejection after transplant, immunotherapy may be an effective option for bridging treatment before liver transplantation for HCC. And it remains necessary to expand the sample size for verifications and supports.

4.
Article in Chinese | WPRIM | ID: wpr-933665

ABSTRACT

Objective:To compare the prognoses of salvage liver transplantation fulfilling the Criteria of Milan, University of California San Francisco(UCSF)and Hangzhou.Methods:Clinical data were retrospectively reviewed for 256 patients with recurrent hepatocellular carcinoma(HCC)undergoing donation after citizen death(DCD)liver transplantation(LT)from January 2015 to October 2019.They were divided into two groups of primary(PLT, n=175)and salvage(SLT, n=81). General profiles, tumor pathological characteristics and postoperative complications of two groups were compared by T-test, rank-sum or χ2 test.Kaplan-Meier method and Log rank test were employed for comparing overall survival rate(OS)and recurrence-free survival rate(RFS)between two groups.In SLT group, 31 cases fulfilled Milan criteria, 45 cases UCSF criteria and 69 cases Hangzhou criteria.OS/RFS of three groups were compared.According to there was downstaging or bridging treatment pre-LT, SLT group was divided into downstaging group(n=32)and non-downstaging group(n=49). OS/RFS of two groups were compared.According to the Rescit1.1 criteria, downstaging group were divided into remission group(n=14)and non-remission group(n=18)and OS/RFS of two groups were compared. Results:The operative durations of PLT and SLT groups were(439.5±74.9)and(475.1±83.4)min respectively.There was significant inter-group difference( P<0.05); However, no significant inter-group difference existed in amount of intraoperative bleeding, blood transfusion, postoperative hospital stay or incidence of postoperative complications(all P>0.05). No significant difference existed in OS/RFS between PLT and SLT groups( P>0.05). No significant difference existed in OS at 1/3/5 years post-SLT among Milan, UCSF and Hangzhou criteria groups(all P>0.05); However, RFS in Milan criteria group at 1/3/5 years post-SLT were 93.5%, 81.7% and 81.7% respectively.They were significantly higher than 68.9%, 59.7% and 59.7% in UCSF criteria group and 78.3%, 58.8% and 55.5% in Hangzhou criteria group(all P<0.05). For patients on downstaging therapy, OS in the Remission group at 1, 3 and 5 years post-SLT were 100%, 73% and 73% respectively, which was significantly higher than 83.3%, 49.4% and 0 in non-Remission group( P=0.042). RFS in the Remission group at 1, 3 and 5 years post-SLT were 100%, 62.5% and 46.9% respectively, which was significantly higher than 52.9%, 0 and 0 in no-Remission group( P=0.001). Conclusions:The survival outcome of SLT recipients is similar to that of PLT recipients.The overall survival of SLT recipients shows no significant difference between Milan, UCSF and Hangzhou criteria.However, SLT recipients fulfilling Milan criteria have the longest recurrence-free time.The prognosis of patients with remission after preoperative descending treatment is superior to that of patients without remission.

5.
Article in Chinese | WPRIM | ID: wpr-954829

ABSTRACT

Objective:To analyze the global research hotspots in the field of pediatrics based on the Essential Science Indicators (ESI) database and explore the inspiration to domestic editors and pediatrics researchers.Methods:The journal distribution, country (region) distribution, cooperation, organization distribution, funding, publication language, hot topic words and other data of highly cited papers in the field of pediatrics in ESI database were collected and analyzed.Results:A total of 682 highly cited pediatrics papers were collected from 77 pediatrics journals included in Science Citation Index(SCI). Most of the highly cited pediatrics papers (182) were found to be published in Pediatrics.All 682 paper were published in English and frequently, characterized by multiple authors, institutions and fund support.Of 682 highly cited pediatrics papers, 435 papers were published in the United States(the first), 123 papers in England(the second) and 86 paper in Canada(the third). Novel coronavirus pneumonia, coronavirus, SARS coronavirus, autism and multiple system inflammatory syndrome are the main frontiers of global pediatric research at present.Specifically, focal pediatric system diseases mainly include respiratory system diseases, digestive system diseases, cardiovascular diseases, etc. Conclusions:ESI-based analysis of global research hotspots in the field of pediatrics provides reference materials for domestic and foreign pediatrics researchers to understand the global academic frontiers and development trends in the field of pediatrics and select topics for future scientific research.More importantly, this analysis can help domestic editors of pediatrics journals to plan topics and organize hot papers, so as to improve the academic quality and international influence of the journals.

6.
Article in Chinese | WPRIM | ID: wpr-954589

ABSTRACT

Objective:To study the effect of miR-539-5p on apalutamide (ARN-509) sensitivity and malignant phenotype of androgen independent prostate cancer cell line C4-2B and related mechanisms.Methods:Castrated resistant prostate cancer, castrated sensitive prostate cancer and benign prostate tissue were obtained. C4-2B cell lines were divided into blank group, transfection group (miR-539-5p plasmid) and control group (control plasmid). qPCR was used to detect the expression of miR-539-5p, androgen receptor (AR) and HSBP1 in the tissues and 3 group of cells. The protein expressions of AR and HSBP1 were detected by western blot. Transwell assay was used to detect the invasion and migration ability of three groups of cells. CCK-8 assay was used to detect the proliferation ability and semi-inhibitory concentration (IC50) of AR antagonist ARN-509. The colony forming ability of the three groups of cells was detected by plate cloning experiment.Results:Tissue-qPCR indicated that, in the benign prostate tissue, tumor tissue of castration sensitive patients and tumor tissue of castration resistant patients, the expressions of miR-539-5p were 0.29 ± 0.04, 0.17 ± 0.02 and 0.07 ± 0.01, the expressions of AR were 0.13 ± 0.02, 0.28 ± 0.04 and 0.79 ± 0.11, and the expressions of HSBP1 were 0.20 ± 0.03, 0.38 ± 0.04 and 0.72 ± 0.11, respectively. Compared with benign prostate tissue and prostate cancer tissue, the expression of AR and HSBP1 gene was higher in prostate cancer tissues with castration resistance, and the expression of miR-539-5p was lower. Cell-qPCR demonstrated that the expressions of miR-539-5p in blank group, control group and transfection group were 1.00±0.09, 1.07±0.11 and 7.19±0.51, the expressions of AR were 1.00±0.10, 1.03±0.14 and 0.51±0.08, and the expressions of HSBP1 were 1.00±0.10, 0.96±0.12 and 0.97±0.11. The expression of miR-539-5p in the transfection cells was significantly higher than that in the control group and the blank group, the expression of AR gene was significantly lower than that in the control group and the blank group, and there was no significant difference in the expression of HSBP1. Western blot showed that, in blank group, control group and transfection group, the protein expressions of AR were 1.00±0.10, 1.12±0.22 and 0.72±0.16, and the expressions of HSBP1 were 1.00±0.10, 0.94±0.18 and 0.48±0.11. The protein expression of AR and HSBP1 in the transfection group was significantly lower than that in the control group and the blank group. Transwell experiment showed that the invasion and migration of cells in the transfection group were significantly lower than that in the control group and the blank group. CCK-8 assay and plate cloning experiment showed that the proliferative capacity and the number of clone formation in the transfection group were significantly lower than those in the control group and the blank group, and the expression of AR and HSBP1 in the transfection group was significantly lower than that in the control group and blank group. Compared with the control group and blank group, the IC50 value of ARN-509 decreased significantly in the transfection group.Conclusion:miR-539-5p may inhibit the malignant phenotype and castration resistance of cells via interfering with the translation level of HSBP1.

7.
Article in Chinese | WPRIM | ID: wpr-956653

ABSTRACT

Objective:To explore the correlation between preoperative echocardiography indicators and surgical prognosis of children with ventricular septal defect (VSD) and conduct verification based on significant indicators and indicator ratios.Methods:A total of 1 357 children with VSD who were admitted to the Children′s Hospital, Zhejiang University School of Medicine from June 2016 to June 2021 were selected. Various measurements including the size of the VSD, left ventricular ejection fraction (LVEF), left atrial (LA) diameter, the aortic (AO) flow rate, the tricuspid regurgitation velocity and pressure gradient were extracted from preoperative echocardiography reports. This paper explored the correlation between echocardiography reports indicators, indicator ratios and postoperative auxiliary ventilation time, respectively. The patients were divided into two groups according to whether there were complications, and the differences of echocardiography reports indicators between the two groups were compared. A linear regression model was established to predict the postoperative auxiliary ventilation time using these indicators, and the least absolute shrinkage and selection operator (LASSO) regression model was used for variable selection.Results:The VSD size and AO flow velocity were weakly correlated with the postoperative auxiliary ventilation time ( r=0.32, 0.25; all P<0.01). There was no significant correlation between VSD flow velocity and postoperative auxiliary ventilation time. The AO flow velocity/VSD flow velocity and LVEF/VSD flow velocity were strongly correlated with the postoperative auxiliary ventilation time ( r=0.67, 0.51; all P<0.01). In the significance test, there were no significant differences in tricuspid regurgitation flow velocity, tricuspid regurgitation pressure gradient, LA diameter, and LVEF between the complication group and the non-complication group(all P>0.01). However, the ratio of LVEF/tricuspid regurgitation velocity in the complication group was significantly lower than that in the non-complication group, and the ratio of tricuspid regurgitation pressure gradient/LA diameter was significantly higher than that in the non-complication group (all P<0.01). The postoperative auxiliary ventilation time of VSD patients was predicted on an independent test set, with an R2 of 0.51. Conclusions:Echocardiography report indicator ratios of AO flow velocity/VSD flow velocity and LVEF/VSD flow velocity have strong correlations with postoperative auxiliary ventilation time in children with VSD, and the ratios of LVEF/tricuspid regurgitation velocity and tricuspid regurgitation pressure gradient/LA diameter are significantly different between groups with and without postoperative complications. The ratios of indicators can significantly improve this correlation and difference, which can be used to predict the prognosis of VSD operation.

8.
Article in Chinese | WPRIM | ID: wpr-931663

ABSTRACT

Objective:To investigate the effects of nedaplatin combined with docetaxel on serum tumor markers and T lymphocyte subsets in patients with epithelial ovarian cancer.Methods:Ninety-two patients with epithelial ovarian cancer who received treatment from March 2016 to December 2017 were included in this study. They were randomly assigned to undergo nedaplatin combined with docetaxel (observation group, n = 46) or cisplatin combined with paclitaxel (control group, n = 46). Both groups received two 21-day courses of treatment. Serum tumor marker level, T lymphocyte subset level, clinical efficacy, incidence of adverse reactions, and 2-year survival rate were compared between the two groups. Results:After treatment, serum cancer antigen 125 (CA125), cancer antigen 199 (CA199), and carcinoembryonic antigen (CEA) levels were (45.84 ± 22.46) U/mL, (35.13 ± 15.03) U/mL, (16.21 ± 3.20) U/mL, respectively in the control group and they were (28.33 ± 20.11) U/mL, (14.82 ± 10.11) U/mL, (5.16 ± 1.33) U/mL, respectively in the observation group. After treatment, CA125, CA199, and CEA levels in each group were significantly decreased compared with before treatment. After treatment, CA125, CA199, and CEA levels were significantly lower in the observation group than in the control group ( t = 3.94, 7.61, 21.63, all P < 0.05). After treatment, the numbers of CD3 +, CD4 +, CD8 + cells in the control group were (16.22 ± 3.12)%, (15.20 ± 1.46)%, (29.21 ± 5.17)%, respectively, and they were (31.22 ± 4.11)%, (24.99 ± 1.71)%, (24.25 ± 4.45)% respectively in the observation group. After treatment, the numbers of CD3 + and CD4 + cells in the observation group were significantly higher than those in the control group ( t = 19.72, 29.53, both P < 0.05). After treatment, the number of CD8 + cells in the observation group was significantly lower than that in the control group ( t = 4.93, P < 0.05). Total response rate was significantly higher in the observation group than in the control group [78.26% (36/46) vs. 58.70% (27/46), χ2 = 4.08, P < 0.05]. The incidence of adverse reactions was significantly lower in the observation group than in the control group [23.91% (11/46) vs. 45.65% (21/46), χ2 = 4.79, P < 0.05]. The 2-year survival rate was significantly higher in the observation group than in the control group [43.48% (20/46) vs. 23.91% (11/46), χ2 = 3.94, P < 0.05]. Conclusion:Nedaplatin combined with docetaxel is highly effective on epithelial ovarian cancer. The combined therapy can greatly reduce serum CA125, CA199, and CEA levels but has no great effects on T lymphocyte subsets. It can increase the survival rate but has no serious adverse reactions.

9.
Article in Chinese | WPRIM | ID: wpr-934201

ABSTRACT

Objective:To evaluate the efficacy of anatomic thoracoscopic pulmonary segmentectomy in the treatment of congenital pulmonary diseases in children and infants.Methods:There were 38 cases, 21 males and 17 females, aged from 6 months to 10 years old and 2 months, mean(28.1±20.7) months, and weight 6.0-27.5 kg, mean(11.93±4.05) kg who were scheduled to undergo thoracoscopic segmental pneumonectomy from July 2019 to March 2020. Among the 38 cases, there were 27 cases of congenital pulmonary airway malformation and 11 cases of intralobar pulmonary sequestrations, including 1 case of intralobar pulmonary sequestrations with extralobar pulmonary sequestrations and 1 case of intralobar pulmonary sequestrations with bronchial cyst. 3D computed tomography bronchography and angiography(3D-CTBA) was performed before operation to identify the specific lung segment of the lesion. According to the results to plan the operation plan, determine the specific resection of the lung segment.Results:The operation was completed successfully in all groups. The operation time was(72.5±18.2)min, the bleeding volume was(17.3±2.9) ml, chest tube drainage time was(3.1±0.8) days, and the postoperative discharge time was(8.1±2.8) days. Postoperative complications included infection(1 case), atelectasis(1 case), hydropneumothorax(1 case) and pneumothorax(1 case). There was no conversion to thoracotomy and enlarged pulmonary lobectomy. There was no recurrence during the follow-up of 1-9 months.Conclusion:Lung-preserving segmentectomy is technically feasible and safe for congenital pulmonary diseases in children. The 3D-CTBA technique can be used to understand the specific pulmonary segments invaded by the lesions and the relationship between the corresponding pulmonary vessels and bronchi before operation, which is of positive significance for the resection of complex pulmonary segments and good preoperative surgical planning.

10.
Article in Chinese | WPRIM | ID: wpr-911698

ABSTRACT

Objective:To explore the relationship between CD24 expression in preoperative peripheral blood as well as cancer tissue and clinical parameters and prognosis in patients with hepatocellular carcinoma (HCC) after liver transplantation (LT).Methods:From November 2018 to November 2019, clinical data were collected for 65 HCC patients and 41 patients with benign liver disease.The preoperative peripheral blood level of CD24 was detected by enzyme-linked immunosorbent assay (ELISA) and the expression of CD24 in cancerous foci and adjacent tissues examined by immunohistochemistry.Kaplan-Meier survival curves of differential CD24 expression were plotted and survival differences compared by Log-rank method.One-way ANOVA was utilized for examining the relationship between the expression level of CD24 and various clinicopathological parameters and multivariate Cox analysis for screening independent risk factors affecting patient prognosis.Results:The concentration of CD24 in preoperative peripheral blood (p-CD24) of HCC patients (6.51±2.33 μg/L) was significantly higher than that of patients with benign liver disease (4.10±0.91) μg/L, P<0.05.The positive rate of CD24 was obviously higher in cancerous tissues than that in adjacent tissues (87.7% vs. 4.6%, P<0.05). The peripheral blood level of CD24 was positively correlated with the expression intensity of CD24 in tumor tissues (t-CD24, r=0.570, P<0.001). The expression of CD24 (both in blood and cancer foci) was significantly correlated with preoperative level of gamma-glutamyl transferase (GGT), maximal tumor diameter, microvascular invasion, portal vein tumor thrombus, vessel carcinoma embolus and satellite focus ( P<0.05). The expression of CD24 in patients exceeding the Milan/UCSF criteria was higher than those fulfilling the criteria ( P<0.005). Patients with a higher expression of CD24 had worse overall survival and recurrence-free survival rates as compared to those a lower expression of CD24 ( P<0.05). Multivariate Cox analysis indicated that t-CD24 [OS: HR=3.661(1.005-13.333)], P=0.049; recurrence-free survival (RFS): [HR=4.331(1.887-9.942), P=0.001] and preoperative level of alpha fetoprotein (AFP) [OS: HR=4.900(1.590-15.097), P=0.006]; RFS: [HR=3.414(1.614-7.221), P=0.001] were independent risk factors for overall survival and recurrence-free survival in HCC patients undergoing LT. Conclusions:The preoperative peripheral blood level of CD24 in HCC patients undergoing LT indirectly reflects the expression of CD24 in cancerous tissues to a certain extent.And the expression of CD24 in cancerous tissue is one of the independent risk factors affecting OS and RFS of LT patients.

11.
Chinese Journal of Endemiology ; (12): 540-544, 2021.
Article in Chinese | WPRIM | ID: wpr-909048

ABSTRACT

Objective:To investigate the expression of long non-coding RNA-POU3F3 (LncRNA-POU3F3) in thyroid cancer tissues and its predictive value for prognosis.Methods:Using case-control study, the thyroid cancer tissue samples and paracancerous tissue samples of 118 thyroid cancer patients who underwent surgery in Zhengzhou People's Hospital from May 2013 to August 2015 were collected, and 100 benign thyroid tumor tissue samples in the same period were selected as controls. Quantitative real-time PCR (qRT-PCR) was used to detect the expression of LncRNA-POU3F3 in thyroid tissues, receiver operating characteristic curve (ROC curve) was used to evaluate the diagnostic value of LncRNA-POU3F3 for thyroid cancer, and the correlation between LncRNA-POU3F3 level and clinicopathological characteristics and prognosis of patients was analyzed.Results:The qRT-PCR results showed that the expression level of LncRNA-POU3F3 in thyroid cancer tissues (4.02 ± 0.76) was higher than that in paracancerous tissues (3.18 ± 0.69) and benign thyroid tumor tissues (3.05 ± 0.66, P < 0.05). The area under the ROC curve of LncRNA-POU3F3 expression in the diagnosis of thyroid cancer was 0.886 [95% confidence interval (95% CI): 0.821 - 0.943, P < 0.05], the sensitivity was 83.7%, the specificity was 85.2%, and the diagnostic threshold was 3.45. High expression of LncRNA-POU3F3 (≥3.45) was found in thyroid cancer tissues with clinical stages Ⅲ - Ⅳ, tumor diameter ≥1 cm, multiple tumor foci and lymph node metastasis ( P < 0.05). Kaplan-Meier analysis showed that after 5 years of follow-up, 53 of the 118 patients with thyroid cancer survived. The 5-year survival rate of patients with low expression of LncRNA-POU3F3 ( < 3.45) was 77.42% (24/31), and that of patients with high expression of LncRNA-POU3F3 (≥3.45) was 33.33% (29/87), and there was a statistically significant difference in the 5-year survival rate between the two groups (χ 2 = 17.955, P < 0.05). Multivariate logistic regression analysis showed that clinical stage, tumor diameter, number of tumor foci, lymph node metastasis and LncRNA-POU3F3 expression were correlated with the survival time of patients with thyroid cancer ( P < 0.05). Conclusion:LncRNA-POU3F3 is highly expressed in thyroid cancer tissues, and its expression level is closely related to the clinicopathological characteristics and prognosis of thyroid cancer patients, which can be used as an important indicator for predicting the prognosis of thyroid cancer patients.

12.
Article in Chinese | WPRIM | ID: wpr-885820

ABSTRACT

Objective:To evaluate the effect of vacuum disk(VD) for non-invasive treatment of recurrent and acquired pectus excavatum(PE).Methods:From June 2017 to June 2019, 29 patients recruited from our outpatient clinic were included in this retrospective study and followed-up every 3 month according to the schedule. The patients were distributed into three groups(group 1 treated ≤6 months; group 2 treated from 6 months to 12 months; group 3 treated >12 months). The device should be applied regularly for more than 2 hours daily. The deformity chest wall was scanned by three-dimensional(3D)scanner at clinic, and the 3D-depth(3D-DE) and 3D-Haller index(3D-HI) of PE were calculated through Geomagic software.Results:In this cohort, 29 patients were eligible, 18 symmetrical PE and 11 asymmetric PE. The application time ranged from 3 months to 15 months(average 7.6 months). 4 paitents was lifted to a normal level, 23 patients were differently improved. However, 2 paitents had no improvement. The average of the depth and 3D-HI of all patients were improved from 17.7 mm to 11.6 mm and 1.739 to 1.598, respectively. It’s no statistically significant difference for the elevation of 3D-DE and 3D-HI between symmetrical and asymmetric PE( t=-2.821, P=0.558; t=0.074, P=0.068). When comparing the improvement of 3D-DE or 3D-HI of PE to the patient's treatment time, a statistically significant difference was proved between the group 2 and group 1( t=-2.261, P=0.014; t=-0.436, P=0.043), but not between the group 3 and group 2( t=-1.240, P=0.139; t=0.622, P=0.568). The main side effects include moderate subcutaneous hematoma(84%), petechial bleeding(27%), thoracalgia(32%) and chest tightness(17%), no other side effect appear till now. Conclusion:VD for treatment of recurrent and acquired PE is convenient, safe and noninvasive, which can be an alternative treatment for recurrent and acquired PE, However, long term of efficacy evaluation is still needed.

13.
Chinese Journal of Geriatrics ; (12): 319-322, 2021.
Article in Chinese | WPRIM | ID: wpr-884888

ABSTRACT

Objective:To examine the risk of long-term cognitive impairment in elderly prostate cancer patients aged 75 years and older undergoing androgen deprivation therapy(DAT), and to analyze the correlation between DAT and cognitive impairment.Methods:This was a retrospective cohort study.Elderly prostate cancer patients aged 75 years and older in the National Cancer Database(SEER)from 1996-2003 were included.According to whether ADT was received, patients were divided into the ADT group(n=82 514)and the control group(n=121 856). Baseline clinical data were compared between the two groups. Kaplan- Meier survival analysis and the Log- rank test were used to compare the incidence of cognitive impairment(dementia and Alzheimer's disease)between the two groups. Cox risk ratio regression analysis was used to assess the relationship between ADT and cognitive impairment. Results:A total of 204 370 patients were enrolled in this study.The mean age of patients was(79.2±4.6)years.Compared with the control group, the ADT group was older and had higher prostate specific antigen levels, higher proportions of poorly differentiated tumors, more complications and a higher proportion of patients receiving radiotherapy( P<0.05). During the follow-up of(12.1±3.3)years, a total of 41 661 cases of dementia were diagnosed, including 13 634 in the ADT group and 28 027 in the control group, and 28 945 cases of Alzheimer's disease were diagnosed, including 9 372 in the ADT group and 19 573 in the control group.Kaplan-Meier survival analysis and the log-rank test showed that the incidence of dementia in the ADT group was higher than that in the control group( χ2=8.10, P=0.004), and the incidence of Alzheimer's disease was also higher in the ADT group than in the control group( χ2=5.06, P=0.024). Cox regression analysis results showed that ADT significantly increased the risk of dementia( HR=1.71, 95% CI: 1.14-2.57, P=0.01)and Alzheimer's disease( HR=1.63, 95% CI: 1.08-2.46, P=0.02), compared with treatment that did not include ADT. Conclusions:The risk of dementia and Alzheimer's disease is increased in elderly prostate cancer patients aged 75 years and older after ADT.

14.
Chinese Journal of Geriatrics ; (12): 112-115, 2021.
Article in Chinese | WPRIM | ID: wpr-884852

ABSTRACT

Objective:To investigate differences in serum uric acid levels between elderly patients with prostate cancer and patients with benign prostatic hyperplasia(BPH).Methods:A total of 300 prostate cancer patients admitted to the urology department of our hospital between Feb.2010 and Jun.2019 were retrospectively analyzed.During the same period, 240 BPH patients and 400 elderly men with normal prostate size were enrolled as the control group.Serum uric acid and prostate-specific antigen(PSA)levels, C-reactive protein(CRP), neutrophil count and lymphocyte count were determined.Serum uric acid concentrations were monitored in prostate cancer patients with different clinicopathological characteristics.Results:CRP and Neu/Lym levels were higher in the prostate cancer group than in the BPH and control groups( P<0.05). The serum uric acid level was (327.0±58.3)μmol/L in the prostate cancer group, lower than in the BPH group(375.2±68.4)μmol/L and the control group(377.8±73.2)μmol/L( F=55.69, P<0.001). Multivariable Logistic regression analysis indicated that serum uric acid was a protective factor for prostate cancer( OR=0.593, 95% CI: 0.542-0.718, P=0.004). There were significant differences in serum uric acid levels between prostate cancer patients with different ages and pathological grades( t=-4.63, F=12.73, P<0.001). However, serum uric acid levels were not significantly correlated with clinical staging or lymph node metastasis( F=-2.72 and 0.77, P=0.068 and 0.460). Conclusions:Compared with BPH patients and healthy males, serum uric acid levels are reduced and inflammatory markers are increased in prostate cancer patients, indicating that serum uric acid may be a risk factor for the occurrence and progression of prostate cancer in the elderly.

15.
International Journal of Surgery ; (12): 179-184,F4, 2021.
Article in Chinese | WPRIM | ID: wpr-882464

ABSTRACT

Objective:To observe the relationship between the occurrence of symptomatic hypocalcemia (SH) and various potential influencing factors in patients after thyroidectomy, stratify according to the scope of thyroidectomy, and explore the predictive value of intact parathyroid hormone (iPTH) for postoperative SH.Methods:Among 3 379 patients with thyroidectomy who admitted into the First Affiliated Hospital of Zhengzhou University from January 2020 to February 2021, 122 patients with SH after thyroidectomy were collected retrospectively and set as SH group. 100 patients of the remaining 3 200 patients who did not suffer from SH in the same year were selected by systematic sampling method and set as control group. Pearson correlation analysis was used to analyze the potential influencing factors such as age, preoperative calcium, postoperative calcium, preoperative iPTH, postoperative iPTH, central lymph node number, blood loss, operation duration, gender, lymph node dissection method, thyroidectomy range, postoperative pathological type and other. Among them, the measurement data of normal distribution were expressed by mean±standard deviation( Mean± SD), t-test was used for the comparison between the two groups, and Chi-square test was used for count data. By drawing the receiver operating characteristic curve (ROC), the iPTH levels in patients with and without SH before/after operation (different surgical methods) were studied, and the diagnostic threshold, sensitivity and specificity of iPTH were predicted. Results:Among 3 379 patients, 122 patients suffered from SH after thyroidectomy, with the incidence rate of 3.6%. There were significant differences in gender (8 males and 114 females in SH group; 27 males and 73 females in control group), whether lateral area dissection was performed (58 cases with dissection and 64 cases without dissection in SH group; 7 cases with dissection and 93 cases without dissection in control group), thyroidectomy range (14 cases with one side and 108 cases with both sides in SH group; 73 cases with one side and 27 cases with both sides in control group), age (40.1 years old vs 43.2 years old), dissection number of central lymph nodes (8.6 vs 4.6), dissection number of cervical lymph nodes (12.3 vs 0.7), blood loss (22.8 mL vs 11.0 mL), operation duration (1.7 h vs 0.8 h), postoperative iPTH (16.4 pg/mL vs 41.9 pg/mL), preoperative iPTH (39.4 pg/mL vs 47.8 pg/mL) in SH group; and postoperative calcium level (1.9 mmol/L vs 2.2 mmol/L). There was significant differences between the two groups ( P<0.05). However, there was no significant differences between them with postoperative pathological type (4 cases with toxic goiter, 3 cases with medullary thyroid carcinoma, 1 case with thyroid follicular carcinoma, 114 cases with papillary thyroid carcinoma in SH group; 1 case with medullary thyroid carcinoma, 1 case of thyroid follicular carcinoma, 98 cases with papillary thyroid carcinoma in control group, P=0.25) and preoperative calcium (2.3 mmol/L vs 2.3 mmol/L, P=0.10). For patients with bilateral thyroidectomy, SH was easy to occur when postoperative iPTH < 20.08 pg/mL, and its sensitivity and specificity were 74.07% and 96.30%; however, for patients with unilateral thyroidectomy, SH was easy to occur when iPTH < 24.00 pg/mL after operation. Conclusions:Gender, age, postoperative calcium, preoperative iPTH, postoperative iPTH, central lymph node number, blood loss, operation duration, lymph node dissection method and thyroidectomy range are important factors affecting the occurrence of SH after thyroidectomy. With the expansion of surgical range, the postoperative iPTH level gradually decreases, which predicts the occurrence of symptomatic hypocalcemia. In order to avoid the occurrence of symptomatic hypocalcemia after operation, it is necessary to supplement calcium in time according to the range of operation and postoperative iPTH level.

16.
International Journal of Surgery ; (12): 114-119, 2021.
Article in Chinese | WPRIM | ID: wpr-882450

ABSTRACT

Objective:To investigate the difference of radiofrequency ablation combined with ethanol ablation and radiofrequency ablation in the treatment of benign cystic solid thyroid nodule.Methods:A total of 80 patients who visited the Thyroid Surgery Department of the First Affiliated Hospital of Zhengzhou University from January 2015 to July 2018 were selected. All selected patients are required to meet the following criteria: (1)Color doppler ultrasonography of the neck revealed a cystic solid thyroid nodule greater than 20 mm in diameter. (2) The results of fine needle aspiration cytology of thyroid nodules were benign. (3)The patients is to undergo radiofrequency ablation of thyroid nodule. According to the condition and patients′ wishes, radiofrequency ablation (Group A, n=40) and combined ethanol and radiofrequency ablation(Group B, n=40) were performed respectively to observe the changes of nodule volume and maximum diameter at 3, 6 and 12 months after surgery.The difference of intraoperative radiofrequency ablation energy, postoperative complications and patient satisfaction at 12 months after operation were also observed. The respective clinical effects of the two groups and the difference of curative effects between the two groups were analyzed. Two-factor repeated measurement analysis of variance or independent sample t test was used to compare the measurement data in line with normal distribution between groups. Friedman′s rank sum test was used for comparison of measurement data groups that did not conform to normal distribution, and Bonferroni correction was used for pairwise comparison. Chi-square test was used to compare the counting data between groups. Results:On the 12th months after operation, the volume reduction of of nodules in group B was greater than that of group A, and the difference was statistically significant[(7.0±5.1) mL vs (5.5±4.9) mL, P<0.05]. The maximum diameter reduction of nodules in group B was greater than that of group A and the difference was statistically significant [(1.5±0.6) cm vs (1.4±0.8) cm, P<0.05]. During the period of 6 to 12 months after operation, the trend of nodular shrinkage in group B was more obvious than that in group A ( P<0.05). The radiofrequency ablation energy of group was lower than that of group A, and the difference was statistically significant [(2.37±1.18) kJ vs (3.89±1.17) kJ, P<0.05]. Voice reduction occurred in 2 cases and recovered within 2 weeks.Local bleeding occurred in 1 case during the operation, which was stopped after ablation. There was no statistical significance in the satisfaction of patients in group A and group B (87.5% vs 90%, P>0.05). Conclusion:Compared with radiofrequency ablation, radiofrequency ablation combined with ethanol ablation for benign cystic solid thyroid nodules can achieve better nodule reduction effect and reduce the ablation energy.

17.
Article in Chinese | WPRIM | ID: wpr-881254

ABSTRACT

@#The patient, male, 1 year, was admitted to our hospital with cardiac murmur. Cardiac ultrasonography showed "complete atrioventricular septal defect (C-AVSD), secondary orifice atrial septal defect (ASD), patent ductus arteriosus (PDA), left superior vena cava, and pulmonary hypertension". The patient got follow-up at the age of 3, 6, 9 months and 1 year, with no feeding difficulties, no obvious underdevelopment and no history of repeated respiratory infections. Cardiac ultrasonography showed that the ventricular septal defect (VSD) healed spontaneously at 9 months of age. At 1 year of age, he was admitted to the hospital with "partial atrioventricular septal defect (P-AVSD)" and accepted surgery. Intraoperative exploration showed that the primary orifice ASD was 12 mm, the atrioventricular valve was divided into two groups, and the left atrioventricular valve had three leaflets: anterior, posterior, and lateral one. A cleft was between the anterior and posterior leaflets. The annulus was not enlarged with diameter of 13 mm. The right atrioventricular valve developed well, with fibrous hyperplasia and adhesion under the septal valve. No VSD was seen. The cleft was sutured intermittently. Autologous pericardial patch was used to repair the primary orifice ASD, and the coronary sinus was separated into the right atrium. Self-healing of VSD patients with C-AVSD is very rare, suggesting that patients with C-AVSD with normal range of development, and without obvious clinical symptoms and secondary damage, should be followed up and accept elective surgery in clinical practice.

18.
Article in Chinese | WPRIM | ID: wpr-876471

ABSTRACT

Objective To establish a mathematical prediction model for chronic obstructive pulmonary disease (COPD) by applying an artificial neural network (ANN) and logistic regression analysis method. Methods A cross-sectional survey was conducted in 2015 to collect epidemiological data of COPD of 2 400 residents from Hubei Province. Subjects were randomized into training group and test group at a ratio of 7:3. The prediction models of COPD were established using ANN and logistic multiple regression. The predictive performance of the two models was compared. Results Information from a total of 1 569 subjects was valid and analyzed, including 1,099 cases in the training group and 470 cases in the test group. The area under curve (AUC) of ANN for training group and test group was 0.80 and 0.78, respectively. The AUC of logistic regression for training group and test group was 0.75 and 0.74, respectively. Conclusion It is feasible to apply ANN and logistic regression models to predict COPD, which can provide scientific evidence for COPD prevention and treatment.

19.
Article in Chinese | WPRIM | ID: wpr-930353

ABSTRACT

Objective:To investigate the safety and therapeutic effect of Shakubatrivalsartan in the treatment of pediatric dilated cardiomyopathy.Methods:Clinical information, treatment and prognosis of 5 cases with dilated cardiomyopathy in the First Affiliated Hospital of Xinxiang Medical University from June 2018 to December 2020 were retrospectively analyzed, and relevant literatures were reviewed.Results:A total of 5 cases of children with dilated cardiomyopathy were analyzed, including 3 males and 2 females with age of 12-17 years.Their median left ventricular ejection fraction (LVEF), left ventricular end diastolic dimension (LVDd), N-terminal pro-B-type natriuretic peptide (NT-proBNP) levels were 37% (20%-41%), 61 mm (59-67 mm), and 13 250 ng/L (12 310-21 823 ng/L), respectively.The median conventional treatment time was 5 months (1-12 months), in which, the condition of heart failure gradually progressed, and the median LVEF, LVDd and NT-proBNP levels were reduced to 33% (19%-37%), 61 mm (60-74 mm), 13 144 ng/L (8 086-15 137 ng/L). After less than 3 months of follow-up following conventional treatment plus Shakubatrivalsartan, NT-proBNP level significantly decreased in 5 cases.Besides, 4 cases had improved cardiac function, and the other one′s improvement was not obvious.The blood pressure of 5 cases decreased at varying degrees after medication of Shakubatrivalsartan, which should be closely monitored during drug titration.No adverse reactions were reported.Conclusions:Shakubatrivalsartan for the treatment of pediatric dilated cardiomyopathy is safe and effective, which can alleviate or reverse the process of myocardial remodeling and improve cardiac ejection fraction, thus improving the prognosis.

20.
Chinese Journal of Geriatrics ; (12): 43-46, 2020.
Article in Chinese | WPRIM | ID: wpr-869322

ABSTRACT

Objective To investigate the efficacy and safety of Rivaroxaban for elderly patients with thrombotic diseases.Methods This was a retrospective study.A total of 301 elderly patients taking Rivaroxaban from October 2012 to November 2017 at the Second Medical Center of the Chinese PLA General Hospital were consecutively selected.The ages ranged from 60 to 102 years,with an average age of(86.5 ± 8.4) years.Anticoagulation regimens were developed based on comprehensive evaluation of indications,creatinine clearance,ischemia and bleeding risk.Patients were divided into a Rivaroxaban 2.5-5.0 mg/d group(n=72),a 10.0 mg/d group(n=205),and a 15.0-20.0 mg/d group (n=24).Hepatic function,renal function,and coagulation indexes were measured before and after the administration of Rivaroxaban.Fatal bleeding,cardiovascular deaths,all-cause deaths,non-fatal bleeding and thromboembolic events were recorded during the follow-up period.Results The average dose of Rivaroxaban was(9.3±3.0)mg/d,and the minimum dose was 2.5 mg/d.The average follow-up time was(14.9± 13.9)months and the longest follow-up time was 48 months.One patient had intracranial bleeding.Twenty patients (6.6%)died with a cumulative incidence of 25.2%,three (1.0%)died of cardiac events,and 55.0% died of pneumonia and multiple organ failure.Forty patients (13.3%)had non-fatal hemorrhagic events with a cumulative incidence of 42.4%.Seven patients (2.3%)had thromboembolic events with a cumulative incidence of 16.0%,including 2 cases of nonfatal myocardial infarction,3 cases of cerebral infarction and 2 cases of deep vein thrombosis.After treatment,levels of prothrombin time and fibrinogen significantly increased while levels of D-dimer significantly deceased (P < 0.05).Conclusions Compared with previous reports,low-dose Rivaroxaban is safe and effective for elderly patients with thrombotic diseases.However,the risk of bleeding and ischemia should be comprehensively evaluated,and appropriate doses of Rivaroxaban should be selected individually.

SELECTION OF CITATIONS
SEARCH DETAIL