Mutations in the bone morphogenetic protein 15 gene causing defective protein secretion in Cholistani infertile sheep / Mutações no gene da proteína morfogenética óssea 15 causadoras de defeitos na secreção proteica em ovelhas inférteis Cholistani

Naturally occurring mutations in morphogenetic protein 15 (BMP15) are associated with decreased ovulation rate (OR), litter size (LS), and sterility. It is of a great interest to elucidate BMP15 gene in Cholistani sheep breed to uplift socio-economic status and the knowledge of Cholistani sheep breeding in Southern Punjab, Pakistan. In our study, a total of 50 infertile Cholistani sheep aged between 2-6 years and having no blood relation were screened for BMP15 mutations. For this purpose, a high-quality DNA was extracted from the blood of sheep followed by primer designing, Polymerase Chain Reaction (PCR) amplification, DNA sequencing, and in silico analyses. Out of total 50 samples, 9 samples including case 1 (T3), case 2 (T8), case 3 (T17), case 4 (T22), case 5 (T25), case 6 (T33), case 7 (T40), case 8 (T44), and case 9 (T47) were found positive for a variety of already reported and novel BMP15 mutations. Further in silico analyses of the observed mutations have shown the functional impact of these mutations on different characteristics (molecular weight, theoretical PI, estimated half-life, instability index, sub-cellular localization, and 3D confirmation) of the encoded proteins, possibly altering the normal functionality. In a nutshell, findings of this study have confirmed the possible essential role of the BMP15 mutations in the infertility of the Cholistani sheep.

Mutações de ocorrência natural na proteína morfogenética 15 (BMP15) estão associadas à diminuição da taxa de ovulação (TO), tamanho da ninhada (TN) e esterilidade. Estudar a BMP15 na raça Cholistani para elevar o status socioeconômico e o conhecimento da criação de ovinos Cholistani no sul de Punjab, Paquistão. Em nosso estudo, 50 ovelhas Cholistani inférteis sem parentesco sanguíneo foram rastreadas para mutações BMP15. Para tanto, um DNA de alta qualidade foi extraído do sangue dessas ovelhas, seguido de concepção do primer, amplificação da reação em cadeia da polimerase (PCR), sequenciamento de DNA e análises in silico. Do total de 50 amostras, 9, incluindo caso 1 (T3), caso 2 (T8), caso 3 (T17), caso 4 (T22), caso 5 (T25), caso 6 (T33), caso 7 (T40), caso 8 (T44) e caso 9 (T47), foram consideradas positivas para uma variedade de mutações BMP15 novas e já relatadas. Mais análises in silico das mutações observadas mostraram o impacto funcional dessas mutações em diferentes características (peso molecular, PI teórico, meia-vida estimada, índice de instabilidade, localização subcelular e confirmação 3D) das proteínas codificadas, possivelmente alterando a funcionalidade normal. Nossos achados confirmaram o possível papel essencial das mutações BMP15 na infertilidade de ovelhas Cholistani.

Glycogen synthase kinase-3 (GSK-3) a magic enzyme: it's role in diabetes mellitus and glucose homeostasis, interactions with fluroquionlones. A mini-review / Glicogênio sintase quinase-3 (GSK-3), uma enzima mágica: seu papel no diabetes mellitus e na homeostase da glicose: interações com fluoroquinolonas. Uma mini-revisão

Abstract Diabetes mellitus (DM) is a non-communicable disease throughout the world in which there is persistently high blood glucose level from the normal range. The diabetes and insulin resistance are mainly responsible for the morbidities and mortalities of humans in the world. This disease is mainly regulated by various enzymes and hormones among which Glycogen synthase kinase-3 (GSK-3) is a principle enzyme and insulin is the key hormone regulating it. The GSK-3, that is the key enzyme is normally showing its actions by various mechanisms that include its phosphorylation, formation of protein complexes, and other cellular distribution and thus it control and directly affects cellular morphology, its growth, mobility and apoptosis of the cell. Disturbances in the action of GSK-3 enzyme may leads to various disease conditions that include insulin resistance leading to diabetes, neurological disease like Alzheimer's disease and cancer. Fluoroquinolones are the most common class of drugs that shows dysglycemic effects via interacting with GSK-3 enzyme. Therefore, it is the need of the day to properly understand functions and mechanisms of GSK-3, especially its role in glucose homeostasis via effects on glycogen synthase.

Resumo O diabetes mellitus (DM) é uma doença não transmissível em todo o mundo, na qual existe nível glicêmico persistentemente alto em relação à normalidade. O diabetes e a resistência à insulina são os principais responsáveis ​​pelas morbidades e mortalidades de humanos no mundo. Essa doença é regulada principalmente por várias enzimas e hormônios, entre os quais a glicogênio sintase quinase-3 (GSK-3) é uma enzima principal e a insulina é o principal hormônio que a regula. A GSK-3, que é a enzima-chave, normalmente mostra suas ações por vários mecanismos que incluem sua fosforilação, formação de complexos de proteínas e outras distribuições celulares e, portanto, controla e afeta diretamente a morfologia celular, seu crescimento, mobilidade e apoptose do célula. Perturbações na ação da enzima GSK-3 podem levar a várias condições de doença que incluem resistência à insulina que leva ao diabetes, doenças neurológicas como a doença de Alzheimer e câncer. As fluoroquinolonas são a classe mais comum de drogas que apresentam efeitos disglicêmicos por meio da interação com a enzima GSK-3. Portanto, é necessário hoje em dia compreender adequadamente as funções e mecanismos da GSK-3, principalmente seu papel na homeostase da glicose via efeitos na glicogênio sintase.

Death caused by covid-19 in top ten countries in Asia affected by covid-19 pandemic with special reference to Pakistan / Morte causada por covid-19 nos dez principais países da Ásia afetados pela pandemia de covid-19, com referência especial ao Paquistão

Abstract The COVID-19 is a contagious viral disease, was first emerged in Wuhan, China in December 2019 and became the whole world on alert. The mortality rate in top most countries in Asia with special reference to Pakistan has been focused. Since February 26 to September 2020 the total confirmed cases and mortality rate was measured through Wikipedia and the notable journals. Iran is the only country having highest number of deaths (5.73%) followed by Indonesia (3.77%) while Saudi Arabia shows the lowest number of deaths as 1.39%. In Pakistan the first case was confirmed in 26th February, 2020. The nCov-19 has closely related to severe acute respiratory syndrome (SARS) hence SARS COV-2 was named. This virus is responsible for more than 33.9 million deaths in over all the world as of 20th September, 2020. The number of new cases is increasing time to time. Sindh province of Pakistan has reported the highest number of cases till September, 20, 2020 as compared to other parts of the country and has the highest number of death followed by Khyber Pakhtunkhwa. Because of the person to person contact the disease is spreading rapidly. The individuals who has already infected with other diseases like cancer or diabetic etc. are vulnerable. The nCOV-19 is the most contagious due to its mode of transmission. There is still no vaccine is available for the treatment of disease caused by nCoV-2019. It is therefore the only option to control this pandemic is to adopt effective preventive measures.

Resumo A covid-19 é uma doença viral contagiosa, que surgiu pela primeira vez em Wuhan, China, em dezembro de 2019, e deixou o mundo todo em alerta. A taxa de mortalidade na maioria dos principais países da Ásia, com referência especial ao Paquistão, foi enfocada. De 26 de fevereiro a setembro de 2020, o total de casos confirmados e a taxa de mortalidade foram medidos por meio da Wikipedia e de periódicos notáveis. O Irã é o único país com maior número de mortes (5,73%), seguido pela Indonésia (3,77%), enquanto a Arábia Saudita mostra o menor número de mortes, 1,39%. No Paquistão, o primeiro caso foi confirmado em 26 de fevereiro de 2020. O nCov-19 está intimamente relacionado à síndrome respiratória aguda grave (SARS), daí o nome SARS COV-2. Esse vírus é responsável por mais de 33,9 milhões de mortes em todo o mundo em 20 de setembro de 2020. O número de novos casos está aumentando de tempos em tempos. A província de Sindh, no Paquistão, registrou o maior número de casos até 20 de setembro de 2020, em comparação com outras partes do país, e tem o maior número de mortes, seguida por Khyber Pakhtunkhwa. Por causa do contato pessoa a pessoa, a doença está se espalhando rapidamente. Indivíduos que já foram diagnosticados com outras doenças, como câncer ou diabetes, etc. são mais vulneráveis. O nCOV-19 é o mais contagioso devido ao seu modo de transmissão. Ainda não há vacina disponível para o tratamento da doença causada pelo nCoV-2019. Portanto, a única opção para controlar essa pandemia é a adoção de medidas preventivas eficazes.

Prevalence and determinants of stunting among preschool and school-going children in the flood-affected areas of Pakistan / Prevalência e determinantes da baixa estatura entre crianças em idade pré-escolar e em idade escolar nas áreas afetadas pelas enchentes do Paquistão

Abstract Stunting is a significant public health problem in low- and middle-income countries. This study assessed the prevalence of stunting and associated risk factors of stunting among preschool and school-going children in flood-affected areas of Pakistan. A cross-sectional study was conducted by visiting 656 households through multi-stage sampling. Respondent's anthropometric measurements, socio-demographic information and sanitation facilities were explored. A logistic regression model was used to determine determinants of stunting, controlling for all possible confounders. The overall prevalence of stunting in children was 40.5%, among children 36.1% boys and 46.3% of girls were stunted. The prevalence of stunting in under-five children was 50.7%. Female children (OR=1.35, 95% CI:0.94-2.0), children aged 13-24 months (OR=6.5, 95% CI: 3.0-13.9), mothers aged 15-24 years (OR=4.4, 95% CI: 2.6-7.2), joint family (OR=2.1, 95% CI: 1.4-3.0) did not have access to improved drinking water (OR=3.3, 95% CI: 1.9-5.9), and the toilet facility (OR=2.8, 95% CI, 1.9-4.3), while the children from district Nowshera (OR=1.7, 95% CI: 0.9-3.2) were significantly (P<0.05) associated in univariate analysis. The regression model revealed that child age, maternal age, family type, quality of water, and toilet facility, were the significant (P<0.05) factors contributing to child stunting in the flood-hit areas. Identification of key factors might be helpful for policymakers in designing comprehensive community-based programs for the reduction of stunting in flood-affected areas. In disasters such as flood, the detrimental consequences of the stunting problem could be even more on children. Evidence-based education and care must be provided to the families in the flood-affected regions to reduce the stunting problem. The determinants of stunting should be targeted by making comprehensive policies regarding proper nutrition, livelihood, clean water, and sanitation facilities in flood-hit regions.

Resumo A baixa estatura é um problema significativo de saúde pública em países de baixa e média renda. Este estudo avaliou a prevalência de nanismo e os fatores de risco associados de nanismo entre crianças em idade pré-escolar e em idade escolar em áreas afetadas por inundações do Paquistão. Foi realizado um estudo transversal visitando 656 domicílios por meio de amostragem em múltiplos estágios. As medidas antropométricas do entrevistado, informações sociodemográficas e instalações de saneamento foram exploradas. Um modelo de regressão logística foi usado para determinar os determinantes do nanismo, controlando todos os possíveis fatores de confusão. A prevalência geral de baixa estatura em crianças foi de 40,5%, entre as crianças 36,1% dos meninos e 46,3% das meninas com baixa estatura. A prevalência de baixa estatura em crianças menores de 5 anos foi de 50,7%. Crianças do sexo feminino (OR = 1,35, IC de 95%: 0,94-2,0), crianças de 13-24 meses (OR = 6,5, IC de 95%: 3,0-13,9), mães de 15-24 anos (OR = 4,4, IC de 95%: 2,6-7,2), família conjunta (OR = 2,1, IC 95%: 1,4-3,0) não tiveram acesso a água potável de qualidade (OR = 3,3, IC 95%: 1,9-5,9) e a banheiro (OR = 2,8, IC de 95%, 1,9-4,3), enquanto as crianças do distrito de Nowshera (OR = 1,7, IC de 95%: 0,9-3,2) foram significativamente (P < 0,05) associadas na análise univariada. O modelo de regressão revelou que a idade da criança, idade materna, tipo de família, qualidade da água e banheiro foram os fatores significativos (P < 0,05) que contribuíram para a baixa estatura infantil nas áreas afetadas pelas enchentes. A identificação de fatores-chave pode ser útil para os formuladores de políticas no planejamento de programas comunitários abrangentes para a redução da baixa estatura em áreas afetadas pelas enchentes. Em desastres como enchentes, as consequências prejudiciais do problema de baixa estatura podem ser ainda maiores para as crianças. Educação baseada em evidências e cuidados deve ser fornecida às famílias nas regiões afetadas pelas enchentes para reduzir o problema de nanismo. Os determinantes do retardo de crescimento devem ser almejados pela formulação de políticas abrangentes sobre nutrição adequada, meios de subsistência, água potável e instalações de saneamento nas regiões afetadas pelas enchentes.

Escherichia coli expression and characterization of α-amylase from Geobacillus thermodenitrificans DSM-465 / Expressão e caracterização de Escherichia coli de alfa-amilase de Geobacillus thermodenitrificans DSM-465

Abstract Alpha amylase, catalyzing the hydrolysis of starch is a ubiquitous enzyme with tremendous industrial applications. A 1698 bp gene coding for 565 amino acid amylase was PCR amplified from Geobacillus thermodenitrificans DSM-465, cloned in pET21a (+) plasmid, expressed in BL21 (DE3) strain of E. coli and characterized. The recombinant enzyme exhibited molecular weight of 63 kDa, optimum pH 8, optimum temperature 70°C, and KM value of 157.7µM. On pilot scale, the purified enzyme efficiently removed up to 95% starch from the cotton fabric indicating its desizing ability at high temperature. 3D model of enzyme built by Raptor-X and validated by Ramachandran plot appeared as a monomer having 31% α-helices, 15% β-sheets, and 52% loops. Docking studies have shown the best binding affinity of enzyme with amylopectin (∆G -10.59). According to our results, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276, and Arg175 constitute the potential active site of enzyme.

Resumo A alfa-amilase, que catalisa a hidrólise do amido, é uma enzima ubíqua com imensas aplicações industriais. Um gene de 1698 pb que codifica a amilase de 565 aminoácidos foi amplificado por PCR, a partir de Geobacillus thermodenitrificans DSM-465, clonado no plasmídeo pET21a (+), expresso na cepa BL21 (DE3) de E. coli e caracterizado. A enzima recombinante exibiu peso molecular de 63 kDa, pH ótimo igual a 8, temperatura ótima de 70° C e valor KM de 157,7 µM. Em escala piloto, a enzima purificada removeu com eficiência até 95% de amido do tecido de algodão, indicando sua capacidade de desengomagem em alta temperatura. O modelo 3D da enzima construída por Raptor-X e validada por Ramachandran plot apareceu como um monômero com 31% de hélices alfa, 15% de folhas beta e 52% de loops. Os estudos de docking mostraram melhor afinidade de ligação da enzima com amilopectina (∆G: - 10,59). De acordo com nossos resultados, Asp 232, Glu274, Arg448, Glu385, Asp34, Asn276 e Arg175 constituem o sítio ativo potencial da enzima.

Studies on the recombinant production and anticancer activity of thermostable L- asparaginase I from Pyrococcus abyssi / Estudos sobre a produção recombinante e atividade anticancerígena da L-asparaginase I termoestável de Pyrococcus abyssi

Abstract L-Asparaginase catalysing the breakdown of L-Asparagine to L-Aspartate and ammonia is an enzyme of therapeutic importance in the treatment of cancer, especially the lymphomas and leukaemia. The present study describes the recombinant production, properties and anticancer potential of enzyme from a hyperthermophilic archaeon Pyrococcus abyssi. There are two genes coding for asparaginase in the genome of this organism. A 918 bp gene encoding 305 amino acids was PCR amplified and cloned in BL21 (DE3) strain of E. coli using pET28a (+) plasmid. The production of recombinant enzyme was induced under 0.5mM IPTG, purified by selective heat denaturation and ion exchange chromatography. Purified enzyme was analyzed for kinetics, in silico structure and anticancer properties. The recombinant enzyme has shown a molecular weight of 33 kDa, specific activity of 1175 U/mg, KM value 2.05mM, optimum temperature and pH 80°C and 8 respectively. No detectable enzyme activity found when L-Glutamine was used as the substrate. In silico studies have shown that the enzyme exists as a homodimer having Arg11, Ala87, Thr110, His112, Gln142, Leu172, and Lys232 being the putative active site residues. The free energy change calculated by molecular docking studies of enzyme and substrate was found as ∆G - 4.5 kJ/mole indicating the affinity of enzyme with the substrate. IC50 values of 5U/mL to 7.5U/mL were determined for FB, caco2 cells and HepG2 cells. A calculated amount of enzyme (5U/mL) exhibited 78% to 55% growth inhibition of caco2 and HepG2 cells. In conclusion, the recombinant enzyme produced and characterized in the present study offers a good candidate for the treatment of cancer. The procedures adopted in the present study can be prolonged for in vivo studies.

Resumo A L-asparaginase, que catalisa a degradação da L-asparagina em L-aspartato e amônia, é uma enzima de importância terapêutica no tratamento do câncer, especialmente dos linfomas e da leucemia. O presente estudo descreve a produção recombinante, propriedades e potencial anticancerígeno da enzima de Pyrococcus abyssi, um archaeon hipertermofílico. Existem dois genes que codificam para a asparaginase no genoma desse organismo. Um gene de 918 bp, que codifica 305 aminoácidos, foi amplificado por PCR e clonado na cepa BL21 (DE3) de E. coli usando o plasmídeo pET28a (+). A produção da enzima recombinante foi induzida sob 0,5mM de IPTG, purificada por desnaturação seletiva por calor e cromatografia de troca iônica. A enzima purificada foi analisada quanto à cinética, estrutura in silico e propriedades anticancerígenas. A enzima recombinante apresentou peso molecular de 33 kDa, atividade específica de 1.175 U / mg, valor de KM 2,05 mM, temperatura ótima de 80º C e pH 8. Nenhuma atividade enzimática detectável foi encontrada quando a L-glutamina foi usada como substrato. Estudos in silico mostraram que a enzima existe como um homodímero, com Arg11, Ala87, Thr110, His112, Gln142, Leu172 e Lys232 sendo os resíduos do local ativo putativo. A mudança de energia livre calculada por estudos de docking molecular da enzima e do substrato foi encontrada como ∆G - 4,5 kJ / mol, indicando a afinidade da enzima com o substrato. Valores de IC50 de 5U / mL a 7,5U / mL foram determinados para células FB, células caco2 e células HepG2. Uma quantidade de enzima (5U / mL) apresentou inibição de crescimento de 78% a 55% das células caco2 e HepG2, respectivamente. Em conclusão, a enzima recombinante produzida e caracterizada no presente estudo é uma boa possibilidade para o tratamento do câncer. Os procedimentos adotados na presente pesquisa podem ser aplicados para estudos in vivo.

In vitro detection of pathogenic Listeria monocytogenes from food sources by conventional, molecular and cell culture method

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.

Left Atrial Myxoma in a Child: An Uncommon Presentation of a Rare Tumour in Early Age.

Myxomas are rare tumours but are the most common benign tumours of the heart. They can arise from any heart chamber. However, they arise more frequently from the left atrium. They have rarely been described as originating in early age. A case of left atrial myxoma successfully removed using cardiopulmonary bypass in a 8-year-old child is presented. Review of the literature emphasizes the rarity and clinically aggressive behavior of this tumor in this age group. The object of this case report is to present myxoma in children and to evaluate possible differences between young and adult patients.

Left Atrial Myxoma in a Child: An Uncommon Presentation of a Rare Tumour in Early Age.

Myxomas are rare tumours but are the most common benign tumours of the heart. They can arise from any heart chamber. However, they arise more frequently from the left atrium. They have rarely been described as originating in early age. A case of left atrial myxoma successfully removed using cardiopulmonary bypass in a 8-year-old child is presented. Review of the literature emphasizes the rarity and clinically aggressive behavior of this tumor in this age group. The object of this case report is to present myxoma in children and to evaluate possible differences between young and adult patients.

Calculation of Costs of Pregnancy- and Puerperiumrelated Care: Experience from a Hospital in a Low-income Country.

Calculation of costs of different medical and surgical services has numerous uses, which include monitoring the performance of service-delivery, setting the efficiency target, benchmarking of services across all sectors, considering investment decisions, commissioning to meet health needs, and negotiating revised levels of funding. The role of private-sector healthcare facilities has been increasing rapidly over the last decade. Despite the overall improvement in the public and private healthcare sectors in Bangladesh, lack of price benchmarking leads to patients facing unexplained price discrimination when receiving healthcare services. The aim of the study was to calculate the hospital-care cost of disease-specific cases, specifically pregnancy- and puerperium-related cases, and to indentify the practical challenges of conducting costing studies in the hospital setting in Bangladesh. A combination of micro-costing and step-down cost allocation was used for collecting information on the cost items and, ultimately, for calculating the unit cost for each diagnostic case. Data were collected from the hospital records of 162 patients having 11 different clinical diagnoses. Caesarean section due to maternal and foetal complications was the most expensive type of case whereas the length of stay due to complications was the major driver of cost. Some constraints in keeping hospital medical records and accounting practices were observed. Despite these constraints, the findings of the study indicate that it is feasible to carry out a large-scale study to further explore the costs of different hospital-care services.

Prevalence and chemotherapy of babesiosis among Lohi sheep in the Livestock Experiment Station, Qadirabad, Pakistan, and environs

A total of 310 blood smears were collected from sheep of the Livestock Experiment Station, Qadirabad, Sahiwal district, Pakistan, and surrounding areas. The samples were examined microscopically and 30 (9.67 percent) were positive for babesiosis. The animals were divided into two groups (A and B) for chemotherapy. Group A sheep were treated with diminazene diaceturate while group B animals received imidocarb dipropionate. Drug efficacy was determined by negative blood smear examination. Diminazene diaceturate effectiveness against babesiosis was 80 percent while that of imidocarb dipropionate was 100 percent. Hematological studies revealed a significant decrease in hemoglobin concentrations and hematocrit values for Babesia-positive animals compared to healthy controls.(AU)

Non-invasive Diagnosis in Clinically Suspected ASD Secundum.

Background: The non-invasive tests like X-ray, ECG and Echocardiography are viewed as an extension of clinical art in cardiology and have become an integral part of history taking, physical examination and other diagnostic method.Atrial Septal Defect (ASD) of secundum type is defined as a through and through communication at atrial level. Previously the diagnosis and decision of surgery for ASD, mandatorily advocate cardiac catherization.Now cardiologist and cardiac surgeon very hardly asked for cardiac catheterization. Non-invasive diagnosis with the help of ECG, X-ray and Echo is sufficient for its diagnosis and treatment for surgery. In Bangladesh there is no study upon it. Considering this ground the study is perform on Bangladeshi patients. Methods: Forty six consecutive patients with clinical (auscultatory and electrocardiographic) signs of uncomplicated atrial septal defect of secundum type were examined by chest x-ray, ECG and echocardiography, before right heart catheterisation. Result: Thirty four (74%) had ASD, four patients (9%) had insignificant pulmonary stenosis, and eight subjects (17%) were normal. No false positive diagnosis of atrial septal defect was made by chest x-ray examination, whereas increased vascular markings were incorrectly interpreted as pulmonary congestion in one case. Eight patients had x-ray films showing questionable signs of left-to-right shunt. Twelve of 30 patients with a large left-to-right shunt were correctly selected for surgery based on radiological findings. Conclusion: Analysis of non invasive diagnosis and management of ASD secundum conform the usually described pattern in western literature.

Bony hydatid disease of superior pubic ramus with extension into pelvis and proximal thigh.

Hydatid disease is caused by the tapeworm of genus ;Echinococcus. Genus Echinococcus has different species including Echinococcus vogeli, Echinococcus granulosus and Echinococcus multilucularis. Echinococcus granulosus is the most common cause of hydatid disease in humans. This disease can take place either directly through ingestion of parasite eggs from contact with infected dogs or indirectly from the ingestion of contaminated water or food. Infestation of hydatid disease in humans most commonly occurs in the liver (55-70%), followed by the lungs (18-35%). Bone hydatidosis however is very rare,whenever it occurs; it is usually secondary to visceral involvement. We present herein a case of primary hydatid cyst involving superior pubic ramus in a 43 years male patient, which is not a common site for the occurrence of this disease. Diagnosis is usually delayed if high index of suspicion is not there. MRI is a good tool for reaching diagnoses.

Outcome of supracondylar fractures of the humerus in children treated by closed reduction and percutaneous pinning.

Supracondylar fractures of humerus in children are common injuries. Displaced fractures are inherently unstable. Conservative treatment results in malunion. Open reduction and internal fixation (ORIF) is more invasive and recovery is prolonged. From September 2004 to September 2005, 102 displaced supracondylar fractures of humerus, aged between one and half year to 13 years, were treated using close reduction and percutaneous Kirschner (K) wire fixation under c-arm fluoroscopy. Seventy nine patients were treated by cross K-wires and in twenty three cases lateral two K-wires were put. Above elbow plaster of paris back slab was applied in all cases for at least four weeks. Back slab, K-wires were removed after four weeks and elbow range of motion exercise was started. Results were analyzed using Flynn's criteria. All patients were followed up to 14th week postoperatively. In cross K-wire group(N=79) 70.8% had excellent, 22.7% good, 3.8% fair and 2.5% had poor results at eight weeks follow up which was improved to 91.1% excellent, 6.3 good, 1.2% fair and 1.26% poor results at 14 weeks follow up. In lateral K-wire group (N=23) 70% had excellent, 21.7% good, 4.3% fair and 4.3% had poor result at eighth week which was improved to 91.3% excellent, 4.3% good, 4.3% fair and no poor result at 14th week follow up. Eight patients got superficial pin tract infection and seven patients sustained ulnar nerve injury post operatively. We recommend this procedure for displaced supracondylar fractures in children as it is safe and cost effective procedure with acceptable complication rates.

Surgical treatment of isthmic spondylolisthesis with radicular pain in adults.

A common consensus has not yet been reached on surgical management of isthmic Spondylolisthesis especially regarding the optimal surgical procedure. This prospective study was carried to see the outcome of Posterolateral fusion with instrumentation without decompression. Eight consecutive patients, aged between 43 to 55 years, underwent primary surgery for isolated L4, L5 lumbar isthmic Spondylolisthesis of less than grade II that presented with radicular pain and exhibited instability on dynamic radiograph. The surgical procedure consisted of instrumentation with pedicle screws and rods (Moss Miami System) and posterolateral fusion in situ by placement of autogeneous bone graft, harvested from posterior iliac crest. Postoperatively Clinical and Radiological status were assessed and were graded according to Stauffer and Coventry method. The patients were followed up for one to three years. Radiological evidence of fusion was clearly evident by six months in all cases. Symptomatically all were relieved of radicular pain completely. One patient had recurrent backache due to causes unrelated to the illness of surgical procedure requiring occasional analgesic. No serious complication was encountered. This lead to conclusion that in adults of our population with low grade isthmic spondylolisthesis and radicular pain Instrumentation with Posterolateral fusion without decompression was sufficient to relieve symptoms.

Diagnostic and Therapeutic Value of Cardiac Scan: First Experience of Utility and Prosfect of MPI in Bangladesh.

Background: Cardiac Scan (MP-SPECT) is a widely utilized noninvasive imaging modality for diagnosis, prognosis, and risk stratification of coronary artery disease. In Bangladesh it is a recently introduced test and there is no study upon it. Considering this ground the study is perform on Bangladeshi patients. Methods: 100 referral patients underwent MPI for evaluation of perfusion status of myocardium. The patients either of suspected IHD or diagnosed case of IHD were referred from different cardiology unit or surgery unit of NICVD. Technetium 99m (99"Tc) isotopes and tetrofosmin used in the same day stress and rest protocol. Result: The commonest findings observed in this present analysis were the early age group patients mostly of female having DCM, but the later age group of patients are of both male and female having Angina Pectoris, OMI and ICM. The referral patients by cardiologists or cardiac surgeons are mostly limited to the pre therapeutic evaluation rather than diagnostic indication. The most common indication is the evaluation of myocardial viability and aim of subsequent treatment. Conclusion: Analysis of perfusion status, decision of subsequent treatment either by medicine or CABG, conform the usually described pattern in western literature.

An uncommon case of neck fistula.

Congenital fistulae of the neck are branchial in origin and of these 2nd arch fistula is by far the most common, 3rd and 4th arch fistulae being very rare. Here, a case of fistula present since birth and extending from the neck, near the midline to the alveololingual sulcus, considered very rare, is presented. The patient was a 32-year-old male having sticky discharge through an opening in the upper part of the neck. Examination revealed an opening of approximately 1 mm diameter about 1 cm to the left of the midline just above the hyoid bone. A sinogram revealed a fistulous linear tract communicating with the oral cavity. Surgery was undertaken and the fistulous tract was excised.

Detection of tomato leaf curl geminivirus in its vector Bemisia tabaci.

Geminiviruses are single-stranded DNA plant infecting viruses that cause major losses in important crops in tropical and subtropical countries. Tomato leaf curl virus (TLCV) belonging to the genera Begomovirus, is a whitefly-transmitted geminivirus that causes a severe leaf curl disease in tomato (Lycopersicon esculentum). The importance of this disease has prompted a great need for a rapid identification of TLCV in its hosts and vector. Polymerase chain reaction (PCR) is the most sensitive approach to detect a minute amount of viral nucleic acid. It is the most ideal method to amplify geminiviruses as they replicate via a double-stranded, circular DNA form. In this study, geminivirus specific degenerated primers were employed to detect TLCV occurring in its vector whitefly Bemisia tabaci by PCR based approach. One primer pair, amplified TLCV DNA fragment of about 1.1 Kb representing partly replicase gene, intergenic region and partly coat protein gene was used. When a set of primer targeted to the core region of the coat protein gene of geminivirus was used, a PCR amplified fragment of about 0.5 Kb was obtained. This approach is highly useful for an early detection of TLCV occurring in very small amount in the vector B. tabaci. Its implications in geminivirus management strategies and their differentiation and being discussed.