ABSTRACT
Objective:To analyze the mutation types and distribution characteristics of thalassemia gene among high-risk populations in Sanya City, and to evaluate the effectiveness of blood routine screening, in order to provide scientific basis for formulating measures for prevention and control of thalassemia in Sanya City.Methods:Retrospective analysis was used to collect detection results and clinical data from high-risk individuals who completed genetic screening for thalassemia at Sanya Materal and Child Health Hospital from January 2019 to August 2021. Mutation types and distribution characteristics of thalassemia gene were analyzed, and the missed detection rate and sensitivity of blood routine indicators [mean corpuscular volume (MCV) and mean corpuscular hemoglobin (MCH)] were evaluated based on the results of genetic screening for thalassemia.Results:A total of 5 760 high-risk individuals were included in the screening results of thalassemia genes, and 3 868 samples of thalassemia gene mutations were detected, with a detection rate of 67.15%. Among them, there were 2 979 samples with α-thalassemia genetic mutations, with a detection rate of 51.72%; including 2 966 common genotype samples (99.56%), the main genotype was αα/-α 3.7 (20.14%, 600/2 979); 13 rare genotype samples (0.44%), 4 cases of αα/-- THAI, 3 cases of α CD40(AAG>AA-)α/αα, 2 cases of α PPα/αα, and 1 case of Fusion gene/αα, Fusion gene/α WSα, α WSα/α PPα, and α CD40(AAG>AA-)α/α WSα each. There were 340 samples with β-thalassemia gene mutations, with a detection rate of 5.90%; including 336 common genotype samples (98.82%). The β CD41/42/β N genotype was dominant (57.65%, 196/340); 4 rare genotype samples (1.18%), β CD5(-CT)/β N, β IVS-Ⅱ-2(-T)/β N, β IVS-Ⅱ-761(-T)/β N and β Initiation(ATG>AGG)/β N 1 case each. There were 549 samples of αβ-compound type thalassemia, with a detection rate of 9.53%. The α missing recombination β CD41/42 genotype was dominant (61.02%, 335/549). There were a total of 4 226 samples that could be traced back to MCV and MCH. Among them, 3 007 samples were found to have mutations in thalassemia genes through screening, 2 584 cases were found to have abnormalities in the combination of MCV and MCH indicators, and 423 samples were missed in blood routine screening, with a missed detection rate of 14.07% (423/3 007). The missed samples were mainly α static type, accounting for 89.13% (377/423) of the total missed samples. The screening sensitivity of MCV combined with MCH for α-, β- and αβ-compound type thalassemia was 82.65%, 98.07% and 98.15%, respectively. Conclusion:The types of genetic mutations in thalassemia in Sanya City are complex and diverse, and there are certain omissions in the blood routine screening of MCV combined with MCH.
ABSTRACT
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
ABSTRACT
OBJECTIVE@#To explore the genetic etiology of a neonate with suggestive features of Cornelia de Lange Syndrome (CdLS).@*METHODS@#Chromosome karyotyping, copy number variation sequencing (CNV-seq) and whole exome sequencing (WES) were carried out for the child. Meanwhile, peripheral venous blood samples were taken from his parents for verifying the suspected pathogenic variants detected in the child.@*RESULTS@#The child has exhibited developmental delay, microcephaly, ptosis, micrognathia, and low ear setting, and was suspected as CdLS. No abnormality was found by karyotyping and CNV-seq analysis. WES has detected 5 heterogeneous variants and 1 hemizygous variant on the X chromosome. Combining the genetic pattern and result of family verification, a hemizygous C.3500T>C (p.ile1167thr) of the SMC1A gene was predicted to underlay the clinical manifestations of the patient. This variant was not recorded in the dbSNP and gnomAD database. PolyPhen2, Provean, SIFT all predicted the variant to be harmful, and PhastCons conservative prediction is was a conservative mutation. ACMG variant classification standard evidence supports are PM2, PP2, and PP3.@*CONCLUSION@#The novel c.3500T>C (p.Ile1167Thr) missense mutation of the SMC1A gene probably underlay the genetic etiology of CdLS in this child. Above results has enriched the mutation spectrum of CdLS type II, and facilitated clinical counseling for this family.
Subject(s)
Child , Humans , Infant, Newborn , Cell Cycle Proteins/genetics , DNA Copy Number Variations , De Lange Syndrome/genetics , Mutation , Phenotype , Exome SequencingABSTRACT
OBJECTIVE@#To retrospectively analyze non-invasive prenatal screening (NIPS) data from two centers.@*METHODS@#The NIPS results of 10 840 samples were analyzed, including 21/18/13 trisomies (T21/T18/T13), sex chromosome and other autosomal aneuploidies, and copy number variants (CNVs). The maternal age, gestational week, body mass index and concentration of free fetal DNA (cffDNA) were also analyzed.@*RESULTS@#The average gestational age of the 10 840 pregnant women was (32.34±5.04) year old, and the average gestational week for NIPS was (17.60±3.55) week. The overall false positive rate for T21/T18/T13 was 0.11%, sensitivity was 100%, specificity was 99.89%, and positive predictive value was 81.5%. The positive predictive values for sex chromosome and other autosomal aneuploidies and CNVs were 56.67%, 11.76% and 83.33%, respectively. The incidence of T21/T18 in the elder women (35 years or elder) was 2.12 times(P 0.05) that of young women. cffDNA was in proportion to gestational week (r = 0.207) and in inverse proportion to body mass index (r = -0.177). It has increased slowly before 15 weeks of gestation and thereafter at a rate of 0.5% per week after the 16th week.@*CONCLUSION@#The performance of NIPS in this study is by large close to the reported in the literature, and the results can provide a reference for further study.
ABSTRACT
[ Abstract]Objective To investigate the effect of two-tage skin grafting with artificial dermis for perianal hidradenitis suppurativa. Methods A total of 20 cases diagnosed as perianal hidradenitis suppu-rativa in our hospital were selected from 2011 to 2013. In the first-stage operation,all diseased skin inclu-ding the superficial subcutaneous fatty tissue was excised,and normal deep subcutaneous fatty tissue was preserved. Then,artificial dermis was grafted to the preserved fatty tissue. After two weeks,split-hickness skin grafts were used for the skin defects as the second-tage operation. Graft success,recurrence and post-operative appearance were evaluated in these patients who were followed up for 9 to 28 months. Results Skin grafts of all 19 patients were successfully survived. The recurrence of hidradenitis suppurativa oc-curred in only one patient. This patient was treated with reoperation and the postoperative appearance was welly recovered. Conclusion Two-tage skin grafting with artificial dermis appears to be a good treatment option for perianal hidradenitis suppurativa.