Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 17 de 17
Filter
1.
Infectio ; 25(3): 176-181, jul.-set. 2021. tab, graf
Article in English | LILACS, COLNAL | ID: biblio-1250089

ABSTRACT

Abstract Objective: To determine the mortality and survival of COVID-19 cases in Colombia between March and July 2020. Materials and methods: A retrospective cohort study in the Colombian population between March 6 to July 8, 2020, with the data reported to the National Institute of Health. Survival analysis was performed considering the real-time PCR results, died or recovered, the onset of symptoms until the date of death, or the final time of the cohort. The actuarial variation and Long-Rank test were applied for survival. Risk factors were determined by Cox regression. Results: The overall survival rate was 100%, 98%, 97%, and 95% for day 1, 10, 20 and 30, respectively. Differences were found in survival in age, sex, region, and hospitaliza tion time spending (p <0.01), the 30-day survival rate was 96% and 95% for females and males, respectively. The region with the highest survival was Antioquia with 99% and the lower Barranquilla with 93%. The age group with the lowest survival was ≥80 years of age with 60%, and being hospitalized represented a survival rate of 68%. Conclusions: This study is one of the first to estimate survival in the Colombian population diagnosed with COVID-19.


Resumen Objetivo: determinar la mortalidad y supervivencia de casos de COVID-19 en Colombia entre marzo y julio de 2020. Materiales y métodos: Estudio de cohorte retrospectivo en población colombiana entre el 6 de marzo al 8 de julio de 2020, con los datos reportados al Instituto Nacional de Salud. El análisis de supervivencia se realizó considerando los resultados de la PCR en tiempo real, fallecido o recuperado, el inicio de los síntomas hasta la fecha del fallecimiento o el momento final de la cohorte. Para la supervivencia se aplicó la variación actuarial y la prueba de rango largo. Los factores de riesgo se determinaron mediante regresión de Cox. Resultados: La tasa de supervivencia general fue del 100%, 98%, 97% y 95% para los días 1, 10, 20 y 30, respectivamente. Se encontraron diferencias en la su pervivencia en cuanto a edad, sexo, región y tiempo de hospitalización (p <0,01), la tasa de supervivencia a 30 días fue del 96% y 95% para mujeres y hombres, respectivamente. La región con mayor supervivencia fue Antioquia con 99% y la Baja Barranquilla con 93%. El grupo de edad con menor supervivencia fue el ≥80 años con 60%, y la hospitalización representó una tasa de supervivencia del 68%. Conclusiones: Este estudio es uno de los primeros en estimar la supervivencia en la población colombiana diagnosticada con COVID-19.


Subject(s)
Humans , Male , Female , Infant , Child, Preschool , Child , Adolescent , Adult , Middle Aged , Aged , Survival Analysis , COVID-19 , Survival Rate , Risk Factors , Cohort Studies , Mortality , Colombia , Survivorship , Methods
2.
Infectio ; 24(3,supl.1): 17-25, oct.-dic. 2020. tab, graf
Article in English | LILACS, COLNAL | ID: biblio-1143094

ABSTRACT

Abstract COVID-19, the new pandemic is associated to SARS-CoV-2 virus infection. Social distancing and the testing have been the principal measures that have shown to be effective for the reduction of critical cases. Although the gold standard for diagnosis of COVID-19 is the RT-PCR, rapid serological tests could also be used for prevalence studies, and for epidemiological monitoring. In order to characterize the humoral immune response, we analyzed eight immunochromatographic test and one ELISA test, as a verification or secondary validation analysis used positive and negative control serum samples. Sera from negative and positive individuals [asymptomatic or symptomatic individuals, outpatient or inpatientor (intensive care unit)] were analyzed, and the following results were found: of all these rapid tests, only 4 exhibit clear banding patterns for IgG and two of these also showed results for IgM (only in a few symptomatic patients). Instead, with an ELISA test a preferential recognition was observed for symptomatic patients who were critically ill, whereas in asymptomatic individuals it did not show more than 25% of positivity. Understanding and validating molecular and serological tests are an essential component for the design of public health measures to response to the pandemic.


Resumen COVID-19 la nueva pandemia está asociada con la infección por el virus SARS-CoV-2. La distancia social y el análisis masivo de muestras son las principales medidas que se han mostrado efectivas para la reducción de los casos críticos. Aunque el estándar de oro para el diagnóstico de COVID-19 es la RT-PCR, las pruebas serológicas rápidas podrían también ser usadas en estudios de prevalencia, así como en la vigilancia epidemiológica. Con el fin de caracterizar la respuesta inmune humoral, analizamos ocho pruebas inmunocromatográficas y una prueba de ELISA, en un proceso de verificación de desempeño o validación secundaria, usando sueros control positivos y negativos. Los sueros de pacientes positivos y negativos [individuos asintomáticos o sintomáticos, pacientes ambulatorios u hospitalizados (en cuidados intensivos)] fueron analizados, encontrando los siguientes resultados: de todas las pruebas rápidas examinadas solamente 4 mostraron un claro patrón de bandas para IgG, de éstas, dos de ellas también mostraron resultados para IgM (solamente en pocos pacientes sintomáticos). En cambio, con la prueba de ELISA un reconocimiento preferencial fue observado en pacientes sintomáticos con enfermedad crítica, mientras que los individuos asintomáticos no mostraron más de un 25 % de positividad. Comprender y validar las pruebas serológicas son componentes esenciales en el diseño de las medidas de políticas públicas como respuesta a esta pandemia.


Subject(s)
Humans , Male , Female , Adult , Middle Aged , Aged , Diagnosis , SARS-CoV-2 , COVID-19 , Enzyme-Linked Immunosorbent Assay , Cross-Sectional Studies , Serum , Epidemiological Monitoring , Physical Distancing
3.
Biomédica (Bogotá) ; 40(supl.2): 166-172, oct. 2020. graf
Article in Spanish | LILACS-Express | LILACS | ID: biblio-1142460

ABSTRACT

Resumen Introducción. La pandemia de COVID-19 ha ocasionado cerca de 25 millones de casos en el mundo. Se ha descrito que los pacientes asintomáticos pueden ser fuentes de transmisión. Sin embargo, es difícil detectarlos y no es claro su papel en la dinámica de transmisión del virus, lo que obstaculiza la implementación de estrategias para la prevención. Objetivo. Describir el comportamiento de la infección asintomática por SARS-CoV-2 en una cohorte de trabajadores del Aeropuerto Internacional El Dorado "Luis Carlos Galán Sarmiento" de Bogotá, Colombia. Materiales y métodos. Se diseñó una cohorte prospectiva de trabajadores del Aeropuerto El Dorado. El seguimiento se inició en junio de 2020 con una encuesta a cada trabajador para caracterizar sus condiciones de salud y trabajo. Cada 21 días se tomó una muestra de hisopado nasofaríngeo para detectar la presencia del SARS-CoV-2 mediante reacción en cadena de la polimerasa con transcriptasa inversa (RT-PCR). Se analizó el comportamiento del umbral del ciclo (cycle threshold) de los genes ORFlab y N según el día de seguimiento. Resultados. En los primeros tres seguimientos de la cohorte se encontró una incidencia de la infección por SARS-CoV-2 del 16,51 %. La proporción de contactos positivos fue del 14,08 %. La mediana del umbral del ciclo fue de 33,53. Conclusión. Se determinaron las características de la infección asintomática por el SARS-CoV-2 en una cohorte de trabajadores. La detección de infectados asintomáticos sigue siendo un reto para los sistemas de vigilancia epidemiológica.


Abstract Introduction: The 2019 coronavirus pandemic (COVID-19) has caused around 25 million cases worldwide. Asymptomatic patients have been described as potential sources of transmission. However, there are difficulties to detect them and to establish their role in the dynamics of virus transmission, which hinders the implementation of prevention strategies. Objective: To describe the behavior of asymptomatic SARS-CoV-2 virus infection in a cohort of workers at the El Dorado "Luis Carlos Galán Sarmiento" International Airport in Bogotá, Colombia. Materials and methods: A prospective cohort of 212 workers from the El Dorado airport was designed. The follow-up began in June, 2020. A survey was used to characterize health and work conditions. Every 21 day, a nasopharyngeal swab was taken to identify the presence of SARS-CoV-2 using RT-PCR. We analyzed the behavior of the cycle threshold (ORFlab and N genes) according to the day of follow-up. Results: In the first three follow-ups of the cohort, we found an incidence of SARS-CoV-2 infection of 16.51%. The proportion of positive contacts was 14.08%. The median threshold for cycle threshold was 33.53. Conclusion: We characterized the asymptomatic SARS-CoV-2 infection in a cohort of workers. The identification of asymptomatic infected persons continues to be a challenge for epidemiological surveillance systems.

4.
Rev. colomb. reumatol ; 26(4): 253-259, oct.-dic. 2019. tab, graf
Article in English | LILACS | ID: biblio-1138817

ABSTRACT

ABSTRACT Introduction: Post-chikungunya virus (CHIKV) chronic arthritis is a common complication of the acute infection caused by this virus, with high risk of progression to functional and quality of life sequelae. Objective: To identify the clinical and immunological characteristics, functional disabilities, and quality of life decline in a sample of Colombian patients with chronic arthropathy associated with chikungunya virus (CHIKV). Methods: A group of 94 patients was evaluated in a City in Colombia during the CHIKV epidemics from 2014 to 2015. Results: The mean age of the 94 patients was 57 years; 76% were women, and 100% came from low socioeconomic groups. Typically, the joint disease was symmetrical, with joint swelling present in 30% of the cases, mostly involving the small and large joints of the upper limbs. Rheumatoid factor was positive in 1.06% and anti-citrulline antibodies in 0%. There were detectable levels of IL6 in 64.9%, and IL 17 in 7.45% of the patients. The severity of disease activity was determined using the DAS28 score, identifying 55.3% with moderate activity, 40.4% with mild activity, and 4.2% with high activity. The HAQ-DI identified a moderate functional limitation in 45.7% of the cases, with a mean score of 1.02. The quality of life measured with the SF-36 scale showed that all of the domains evaluated were affected but pain and the physical and emotional domains were significantly more affected. Conclusions: Patients with post-chikungunya chronic arthritis, presented in most cases arthralgia, arthritis, functional impairment, and poor quality of life. It is then necessary to adopt comprehensive therapeutic measures for a sound intervention of this pathology.


RESUMEN Introducción: La artropatía por virus de chikungunya (CHIKV) es una complicación frecuente secundaria a la infección inicial por este virus con un alto riesgo de progresión a secuelas funcionales y de calidad de vida. Objetivo: Identificar las características clínicas, inmunológicas, de discapacidad funcional y de deterioro de la calidad de vida en una muestra de pacientes colombianos con artropatía crónica por CHIKV. Métodos: Se evaluó un grupo de 94 pacientes en una ciudad colombiana durante la epidemia por CHIKV en el periodo 2014-2015. Resultados: En los 94 pacientes la edad media fue de 57 años, siendo el 76% mujeres y el 100% de la población afectada perteneció a estratos socioeconómicos bajos. El cuadro articular característicamente fue simétrico con inflamación articular en el 30%, mayor compromiso de articulaciones grandes y pequeñas de miembros superiores. Se identificó positividad para factor reumatoide en el 1,06%, anticuerpos anticitrulina en el 0%, niveles detectables de IL-6 en el 64,9% y de IL-17 en el 7,45% de los pacientes. La severidad de la actividad articular se exploró con la escala DAS28, identificando un 55,3% con actividad moderada, un 40,4% actividad leve y un 4,2% con actividad alta. El HAQ-DI identificó un compromiso funcional moderado en el 45,7%, con puntaje medio de 1,02. La calidad de vida medida con la escala SF-36 mostró que todos los dominios evaluados fueron afectados con mayor compromiso de los dominios dolor, rol físico y rol emocional. Conclusiones: En los pacientes afectados por artropatía crónica por CHIKV se observó artralgias, artritis, deterioro funcional y de la calidad de vida en la mayoría de la población estudiada, por lo que es necesario adoptar medidas terapéuticas en todos estos niveles para una intervención adecuada en esta patología.


Subject(s)
Humans , Male , Female , Adult , Middle Aged , Aged , Quality of Life , Chikungunya virus , Cohort Studies , Joint Diseases , Colombia , Joints
5.
Rev. colomb. anestesiol ; 41(1): 16-19, ene.-mar. 2013. tab
Article in Spanish | LILACS, COLNAL | ID: lil-675229

ABSTRACT

Introducción: La vejiga neurogénica predispone a los pacientes con traumatismo raquimedular a incontinencia refleja, infecciones del tracto urinario, disreflexia autonómica y fallo renal, el cual es una de las principales causas de mortalidad. La neuromodulación de las raíces sacras anteriores es un tratamiento de la disfunción vesical. Es raro encontrar publicaciones en anestesiología sobre este procedimiento. Objetivos:Describir el comportamiento hemodinámico y los efectos adversos durante el intraoperatorio y post-operatorio inmediato en los pacientes que han recibido implantación de estimulador de raíces sacras anteriores. Métodos: Estudio descriptivo retrospectivo de pacientes con traumatismo raquimedular crónico que han recibido implantación de estimulador de raíces sacras anteriores. Resultados: De 50 pacientes estudiados, el 34% tenían lesión torácica alta, un 58% tenía lesión espinal secundaria a herida por proyectil de arma de fuego, el 40% con antecedente de disreflexia autonómica, el 98% empleo de monitoría con línea arterial, el 90% de los pacientes presentó hipotensión y el 86% requirió manejo vasopresor, el 34% presentó bradicardia y el 88% requirió manejo con atropina. Conclusiones: La hipotensión y la bradicardia son los principales efectos adversos durante el manejo de estos pacientes pero con adecuada respuesta al tratamiento médico. Se deben realizar estudios que evalúen la asociación entre nivel de la lesión con bradicardia e hipotensión y la monitorización ideal durante este procedimiento.


Introduction: Neurogenic bladder predispose to patients with spinal cord injuria to reflex incontinence, urinary tract infections, autonomic dysreflexia and renal failure, which is one of the key causes of mortality. Neuromodulation of the anterior sacral roots is a treatment for bladder dysfunction. The anesthesiology publications about this procedure are very rarely. Objectives: To describe the hemodynamic behavior and the adverse events during the intraoperative and immediate postoperative period of patients undergoing implantation of the sacral anterior roots stimulator. Methods: Retrospective, descriptive study of series of cases of patients with chronic spinal cord trauma implanted with the anterior sacral roots stimulator. Results: Out of 50 patients studied, 34% had an upper chest injury, 58% had a spinal injury secondary to a fire weapon bullet, 40% had a history of autonomic dysreflexia, 98% were had arterial line monitoring, 90% of the patients were hypotensive and 86% required vasopressors; 34% experienced bradycardia and 88% required atropine management. Conclusions: Hypotension and bradycardia are the major adverse events in the management of these patients, but they exhibit adequate response to medical treatment. Studies are needed to assess the association between the level of the injury versus the presence of bradycardia and hypotension and the ideal monitoring during the procedure.


Subject(s)
Humans
6.
Univ. sci ; 17(3): 291-302, Sep.-Dec. 2012. tab
Article in English | LILACS | ID: lil-669347

ABSTRACT

Durante este estudio se buscó determinar la frecuencia de uso demedicina alternativa y complementaria (CAM) basada en plantas, enpacientes con cáncer de seno. Se realizó por medio de encuestas enpacientes con cáncer de seno que asistieron a consulta externa al CentroJaveriano de Oncología del Hospital San Ignacio en Bogotá en losmeses de Junio a Diciembre del 2011. De las 404 encuestas aplicadasen mujeres con cáncer de seno, el 57% consumieron algún tipo deCAM para el cáncer de seno y de estos el 76% consumieron plantasmedicinales como el anamú, la sábila, los frutos rojos y la guanábana,entre otros. El 65% de los pacientes tuvieron una percepción positivafrente al consumo de las plantas medicinales y el 57% de los usuariosde terapias basada en plantas, la uso simultáneamente al tratamientoalopático recomendado por el médico oncólogo. Concluimos quela frecuencia de uso de CAM en pacientes con cáncer de seno delCentro Javeriano de Oncología en Bogotá, esta dentro del rangode prevalencia reportado mundialmente, aunque existen diferenciasmarcadas en los tipos y frecuencias de CAM consumidas. La altaproporción de pacientes que usan CAM basada en plantas sindiscutirlo con el médico oncólogo, tiene como consecuencia la faltade evaluación con respecto a los efectos sinérgicos o antagónicos deestas terapias frente al tratamiento alopático del cáncer de mama; asícomo el potencial antitumoral y inmunomodulador real de las plantasusadas de manera tradicional por lo pacientes oncológicos...


The present study estimates the frequencyof the use of plant-based Complementary andAlternative Medicine (CAM) by breast cancer patients.From June to December of 2011, a self-administeredquestionnaire was given to 404 breast cancer patientsreceiving outpatient therapy at the Javeriana OncologyCenter of the Hospital Universitario San Ignacio inBogotá. The prevalence of patient CAM use was 57%,out of which 76% was based on plants like anamú,aloe, red fruits and soursop. Sixty-five percent of thepatients had a positive perception of using medicinalplants and 57% used them simultaneously with theoncologist recommended allopathic treatment. Weconcluded that the frequency of CAM use in breastcancer patients at the Javeriana Oncology Centeris within the prevalence range reported worldwide,despite differences in CAM types and frequencies. Thehigh rates of plant-based CAM use without physicianconsent, brings about the lack of assessment of thesynergic or antagonistic effects of CAM therapieson the allopathic treatment of breast cancer andevaluation of the antitumor and immunomodulatorypotential of the traditionally used plants...


O presente estudo se propôs a avaliar a frequência dautilização de Medicina Alternativa e Complementar (CAM) baseadaem plantas por pacientes com câncer de mama. Um questionário autoadministradofoi dado a 404 pacientes com câncer que frequentarama terapia ambulatória no Centro Javeriano de Oncologia do HospitalUniversitário San Ignacio, em Bogotá entre junho e dezembro de2011. O consumo de algum tipo de CAM por parte dos pacientesfoi de 56%. 76% selecionaram plantas como anamú, aloé , frutosvermelhos e graviola. Os resultados foram que 65% dos pacientestiveram uma percepção positiva de usar plantas medicinais. 57%dos pacientes utilizaram o tratamento alopático simultaneamente.Conclui-se que a freqüência do uso de CAM em pacientes com câncerde mama no Centro Javeriano de Oncologia está dentro da faixade prevalência registrada no mundo, embora com diferenças nostipos de CAM e freqüências. A elevada taxa de pacientes que usamCAM baseada em plantas sem consentimento médico é o resultadoda falta de respeito ou avaliação dos efeitos sinérgicos o antagônicosde terapias CAM contra o câncer da mama, bem como o potencialtratamento alopático antitumoral e imunomoduladora das plantasreais utilizados tradicionalmente...


Subject(s)
Breast Neoplasms/classification , Breast Neoplasms/diagnosis , Complementary Therapies/methods , Complementary Therapies
7.
Biomédica (Bogotá) ; 32(3): 375-385, jul.-set. 2012. ilus, graf, tab
Article in Spanish | LILACS | ID: lil-663718

ABSTRACT

Introducción. Las enfermedades transmitidas por alimentos son un serio problema de salud pública y, el pollo, uno de los alimentos asociados con ellas. Objetivo. Determinar la distribución y frecuencia de brotes alimentarios asociados al consumo de pollo contaminado por Salmonella spp., Listeria monocytogenes y Staphylococus aureus, mediante una revisión sistemática de la literatura científica. Materiales y métodos. Se buscaron los estudios de brotes asociados a Salmonella spp., S. aureus y L. monocytogenes, en las bases de datos Medline, Pubmed, Science Direct,SciELO,Librería Cochrane (CCRT),Biblioteca Virtual en Salud (BVS), Highwire,HINARI y MedicLatina. Se obtuvieron los datos para el cálculo de odds ratios (OR) mediante la elaboración de tablas de contingencia en el programa RevMan5™. Resultados. Siete artículos cumplieron con los criterios de inclusión y no se encontraron reportes de L. monocytogenes. El OR global fue de 3,01 (IC95% 2,37-3,81), lo que se interpreta como una asociación significativa entre el consumo de pollo contaminado y la infección alimentaria. Se presentó heterogeneidad en los estudios incluidos (p=0,03), por lo que fue necesario un análisis por subgrupos de microorganismos; para el caso de Salmonella spp., el OR fue de 2,67 (IC95% 2,09-3,41). No se hizo análisis para S. aureus por reportarse un solo artículo. Conclusiones. Se encontró un OR de 2,61, lo que indica que hay una fuerte asociación entre el consumo de pollo y la adquisición de salmonelosis. El principal factor de riesgo para adquirir salmonelosis es el consumo de pollo de asadero en los restaurantes.


Introduction. Food borne diseases are a serious public health problem. Poultry are often associated with these outbreaks. Objective. A systematic review of the literature is provided concerning the distribution and frequency of food borne outbreaks associated with consumption of chicken contaminated with Salmonella spp., Listeria monocytogenes and Staphylococcus aureus. Materials and methods. The search for studies of outbreaks associated with Salmonella, S. aureus and L. monocytogenes was conducted in Medline, Pubmed, Science Direct, Scielo, Cochrane Library (CCRT), Virtual Health Library (VHL), Highwire, HINARI and MedicLatina. Data were obtained for the calculation of odds ratio (OR) by preparing contingency tables using the RevMan5 program. Results. Seven articles met the inclusion criteria; however, no reports of L. monocytogenes were obtained. The overall OR was 3.01 (95% CI: 2.37, 3.81); this was interpreted as a significant association between the consumption of contaminated chicken and food poisoning. In the included studies heterogeneity (p= 0.03) was presented, so it took a subgroup analysis of microorganisms, in the case of Salmonella OR was 2.67 (95% CI: 2.09 -3.41). No analysis was made for S. aureus reported a single article. Conclusions. The OR indicated a strong association between chicken consumption and acquisition of salmonellosis. The main risk factor for acquiring salmonellosis is the consumption of chicken from grill restaurants.


Subject(s)
Animals , Humans , Chickens/microbiology , Disease Outbreaks , Food Contamination , Food Microbiology , Foodborne Diseases/epidemiology , Listeria monocytogenes/isolation & purification , Meat/adverse effects , Salmonella/isolation & purification , Staphylococcus aureus/isolation & purification , Africa/epidemiology , Americas/epidemiology , Case-Control Studies , Cooking , Europe/epidemiology , Foodborne Diseases/microbiology , Odds Ratio , Publication Bias , Restaurants , Risk Factors , Salmonella Food Poisoning/epidemiology , Salmonella Food Poisoning/etiology , Salmonella Food Poisoning/microbiology , Staphylococcal Food Poisoning/epidemiology , Staphylococcal Food Poisoning/etiology , Staphylococcal Food Poisoning/microbiology
8.
Infectio ; 13(1): 43-57, 2009. ilus, tab
Article in Spanish | LILACS | ID: lil-526208

ABSTRACT

La aplicación de la reacción en cadena de la polimerasa (PCR) para detectar e identificar Trypanosoma rangeli y Trypanosoma rangeli presenta a menudo dificultades de interpretación. Así, algunas pruebas generan la amplificación de bandas similares provenientes de uno de los dos parásitos, fragmentos polimórficos de un mismo parásito, o la prevalencia en la detección de T. cruzi en infecciones mixtas. En este estudio se presentan y analizan los trabajos de investigación básica realizados con el objeto de diseñar y estandarizar pruebas de PCR específicas de cada parásito. Los iniciadores TcH2AF/R se diseñaron sobre la base de la región diferencial observada entre las unidades génicas que contienen los genes h2a en estos tripanosomas. Esta pareja de iniciadores amplifican un fragmento de 234 pb específico para T. cruzi (cepas I y II). Los iniciadores TrF/R2 anillan en las regiones intergénicas del fragmento génico de 801 pb codificante para seis transcritos que forman la agrupación ARNsno-Cl en T. rangeli. Estos iniciadores amplifican un fragmento de 620 pb exclusivo de las cepas KP1(-) y KP1(+) de este parásito. La aplicación de estas PCR en vectores infectados y en pacientes con enfermedad de Chagas muestra que ambas pruebas constituyen herramientas útiles para el diagnóstico y la identificación diferencial de estos tripanosomátidos.


The application of polymerase chain reaction (PCR) to detect Trypanosoma rangeli and Trypanosoma rangeli often presents interpretation challenges. For example, some tests yield the amplification of similar bands from either parasite, polymorphic fragments of the same parasite, or present deviation towards T. cruzi in mixed infections. In this study, the basic researching needed for designing and standardizating specific PCR tests for each parasite species PCR are shown and analyzed. The TcH2AF/R primers were designed on the basis of the differential gene region observed between the histone h2a genic units of these parasites. These primers amplify a specific 234 bp fragment in T. cruzi (T. cruzi I and II strains). The TrF/R2 primers anneal to the intergenic regions of an 801 bp gene fragment encoding for six transcripts that conform the snoRNA-Cl cluster in T. rangeli. These primers amplify a fragment of 620 bp exclusively in KP1(-) and KP1(+) strains of the parasite. The application of these PCR tests in infected vectors and in chagasic patients show that both tests constitute useful tools for the diagnosis and differential identification of these Trypanosomatids. Key words: histone, RNA small nucleolar (snoRNA), polymerase chain reaction (PCR), Trypanosoma.


Subject(s)
Diagnostic Tests, Routine , Histones , Polymerase Chain Reaction , RNA, Small Nuclear , Trypanosoma , Colombia
9.
Cienc. tecnol. salud vis. ocul ; (11): 41-51, jul.-dic. 2008. tab, ilus
Article in Spanish | LILACS | ID: lil-552666

ABSTRACT

De acuerdo con la definición de ojo seco dada por el Workshop Dry Eye en 2007, la sintomatología en el ojo seco es consecuencia de los cambios en la películalagrimal y daño de la superficie ocular. Sin embargo,los estudios que buscan establecer la asociación y la correlación entre los signos y síntomas son bastantecontradictorios.Objetivo: determinar la asociación entre los síntomas reportados en el cuestionario de Donate et ál. (2002), y los tests de Schirmer, BUT, citología de impresión conjuntival y expresión HLA-DR en pacientes con ojo seco.Metodología: se estudiaron 63 ojos de pacientes con ojo seco que acudieron al Instituto de Investigaciones Optométricas de la Universidad de La Salle, y 19 ojos de sujetos que no presentaron ningún tipo de patologíaocular, y que se analizaron como controles. A todos los pacientes y controles se les aplicó el cuestionariode Donate, test de Schirmer, BUT, citología de impresión conjuntival y expresión de HLA-DR en citología de impresión por inmunohistoquímica. Se aplicó X2 para establecer la asociación entre los síntomasreportados en el cuestionario y cada unos de los test clínicos y de laboratorio.Resultados: se presentó asociación estadísticamente significativa entre los síntomas y el test de Schirmer (X2= 16.9 p<0.0001), el BUT (X2= 9.10 p=0.0026), y expresión de HLA-DR (X2= 9.9 p= 0.017). No hubo asociación entre la sintomatología reportada en el cuestionario y la citología de impresión conjuntival (X2= 3.25 p= 0.07).Conclusiones: la sintomatología en los pacientes con ojo seco analizados presentó una fuerte asociación con la disminución en la cantidad y calidad de la película lagrimal. También se estableció asociación entre los síntomas y la respuesta inflamatoria evidenciadapor la expresión de HLA-DR en las células epiteliales conjuntivales.


According to the definition of dry eye given by the Workshop dry eye in 2007, the symptoms of the dry eye is the result of changes in the tear film and ocular surface damage. But the studies that seek to establish partnership and/or correlation between the signs and symptoms are quite contradictory.Objective: to determine the association between the symptoms reported in the questionnaire Donate et al (2002) and the Schirmer test, BUT, conjunctival impression cytology and HLA-DR expression in patientswith dry eye.Methods: we studied 63 eyes of patients with dry eye that Instituto de Investigaciones Optometricas of University of La Salle, with clinic suspected dry eye and 19 eyes of subjects who showed eye disease,which was analyzed as controls. All patients and controls were applied the questionnaire Donate, Schirmer test, BUT, conjunctival impression cytologyand expression of HLA-DR in impression cytology by immunohistochemistry. X2 is applied to establish the association between the symptoms reported in the questionnaire and each of the clinical and laboratorytests.Results: we present statistically significant associationbetween symptoms and Schirmer test (X2 = 16,9 p < 0,0001), BUT (X2 = 9,10 p = 0,0026), expression of HLA-DR (X2 = 9,9 p = 0,017). There was no associationbetween the symptoms reported in the questionnairewith conjunctival impression cytology (X2 = 3,25 p = 0,07).Conclusions: a strong association was found between symptoms of patients with dry eye with the decrease in the quantity and quality of the tear film. It was also established association between the symptoms and the inflammatory response evidenced by the expression of HLA-DR in the conjunctival epithelial cells.


Subject(s)
Affective Symptoms , Anterior Eye Segment
10.
Univ. sci ; 13(1): 65-74, ene.-abr. 2008. ilus
Article in Spanish | LILACS-Express | LILACS | ID: lil-637366

ABSTRACT

La influenza porcina, es una enfermedad respiratoria aguda viral altamente contagiosa, de morbilidad elevada y capaz de provocar complicaciones letales. Tiene gran importancia en la industria pecuaria debido a las cuantiosas pérdidas económicas que ocasiona su alta morbilidad. Por esta razón, en este trabajo se implementaron las pruebas de cultivo celular y RT-PCR para las proteínas M, H y N para la determinación del virus de influenza porcina. En este trabajo, se procesaron y analizaron 82 muestras de hisopos nasales, 12 lavados broncoalveolares y 12 tejidos pulmonares, dando resultados negativos para la detección del virus de influenza. Al comparar la RT-PCR de la proteína M con la de cultivo celular como "Gold Standard" se obtuvo una sensibilidad y especificidad del 100% e índice Kappa de 1, indicando una concordancia muy buena entre las dos pruebas.


The swine influenza virus, is an acute disease that affects the respiratory tract of the pig, It is highly contagious and have a raised morbility ratio also could turn into a fatal end. This disease has a very important roll into the pig production farms since it is a cause of loses of funds. For that reason, this work implemented the cell culture technique and RT-PCR for M, H and N proteins segments for the fast and accurate diagnosis of this virus. On this work, were tested 82 nasal swabs, 12 broncoalveolars washes, and 12 lung tissues, given negative results for the swine influenza virus. During the compilation of RT-PCR for M protein segment with the cell culture as a gold standard, it attained a sensibility and specificity of 100% and Kappa index of 1 indicating a good concordance between the two probes.

11.
Acta méd. colomb ; 32(3): 124-128, jul.-sept. 2007. tab, graf
Article in Spanish | LILACS | ID: lil-490158

ABSTRACT

Introducción: las células asesinas naturales (NK y NKT) son una población de linfocitos que circulan en bajos porcentajes en sangre periférica. Ambos tipos de células realizan un papel importante en la respuesta inmune en condiciones normales o en procesos patológicos como ciertos tumores,abortos espontáneos y en el rechazo a trasplantes, lo cual les confiere un gran interés clínico. Objetivo: el presente trabajo pretende establecer valores para las células NK y NKT por medio decitometría de flujo en una población adulta de donantes de un banco de sangre de Bogotá. Metodología: se recolectaron 104 muestras de donantes y se realizó un estudio con los marcadores CD3, CD16 y CD56.Resultados: de las muestras 47.2% fueron mujeres y 52.8% hombres. Para las mujeres el porcentajede células fue: NK 14.6% (μ 12.1) y NKT 3.0% (μ 2.5); para hombres NK 25.3% (μ 21.3) y NKT 3.5% (μ 2.9). Los valores absolutos de células para mujeres fueron NK 298.8 /µL (μ 253.9) y NKT 70.1 /µL (μ 47.7); para hombres NK 526.1 /µL (μ 448) y NKT 95.5 /µL (μ 77). Existe una diferencia estadística entre los valores absolutos par las células NK entre hombres y mujeres (p= 0.0004).


Introduction: the natural killer cells (NK y NKT) are a population of lymphocytes that circulate in the peripheral blood but in low percentages. Both types of cells play an important role in immuneresponse under normal conditions or in pathological processes as it is the case of certain tumors, spontaneous abortions and transplant rejections, what makes them very interesting from the clinical interest point of view.Objective: the aim of this work is to establish values for NK and NKT cells by means of flow cytometry in a group of adult population of blood donors in a blood bank in Bogotá. Methodology: 104 donor samples were collected and a study was carried out with CD3, CD56and CD16 markers. Results: 47.2% of the samples were women and 52.8% men. In the case of women the cellspercentage was: NK 14.6% (μ 12.1) and NKT 3.0% (μ 2.5); for men NK 25.3% (μ 21.3) and NKT 3.5% (μ 2.9). The absolute cells values for women were NK 298.8 /µL (μ 253.9) and NKT 70.1 /µL (μ 47.7); for men NK 526.1 /µL (μ 448) and NKT 95.5 /µL (μ 77). There is a statistical differencebetween the absolute values by the NK cells between men and women. (p= 0.0004).


Subject(s)
Flow Cytometry , Killer Cells, Natural , Lymphocytes
12.
Biomédica (Bogotá) ; 27(supl.1): 83-91, ene. 2007. ilus
Article in Spanish | LILACS | ID: lil-475384

ABSTRACT

Introducción. El diagnóstico de la enfermedad de Chagas en sus fases latente y crónica se dificulta por la baja parasitemia, razón por la cual se recurre a métodos serológicos y moleculares. Objetivo. Comparar la prueba de reacción en cadena de la polimerasa basada en la amplificación del elemento SIRE insertado en el gen que codifica para la histona H2A con las pruebas serológicas convencionales para el diagnóstico de la enfermedad de Chagas en pacientes colombianos. Materiales y métodos. Se realizó un estudio de concordancia comparando la PCR TcH2AF/R con las pruebas de inmunoensayo enzimático e inmunofluorescencia indirecta, determinándose además la sensibilidad y especificidad de la prueba. Se clasificaron y examinaron 156 individuos según los hallazgos clínicos y epidemiológicos y los resultados de las pruebas serológicas. Adicionalmente, 97 de las 156 muestras fueron comparadas con la PCR S35/S36. Resultados. De 156 muestras, 89 (57 por ciento) fueron positivas por IFI y ELISA, y 84 (53,8 por ciento) presentaron el perfil de amplificación correspondiente a la banda esperada de 234 pb, obteniéndose una sensibilidad de 88 por ciento (I.C. 95 por ciento: 75 por ciento - 95 por ciento) y especificidad de 92,5 por ciento (I.C. 95 por ciento: 87,7 por ciento - 97,2 por ciento). El índice kappa, indicador de concordancia entre las pruebas serológicas y TcH2AF/R fue de 0,8 (I.C. 95 por ciento: 73 por ciento - 86 por ciento), en tanto entre las PCR TcH2AF/R y S35/S36 fue de 0,9 (I.C. 95 por ciento: 84 por ciento - 96 por ciento), interpretados como una concordancia buena y casi perfecta, respectivamente. Conclusiones. La PCR TcH2AF/R es una prueba diagnóstica promisoria complementaria a las pruebas serológicas, para la detección de Trypanosoma cruzi.


Introduction. Diagnosis of Chagas disease in its latent and chronic phase is difficult because of the low parasitemia levels. Therefore, serological and molecular techniques are necessary to achieve an appropriate diagnosis. Objective. The polymerase chain reaction based on the amplification of the SIRE element inserted into H2A encoding genes was compared with classical serological tests for the diagnosis of Chagas disease in Colombian patients. Materials and methods. An agreement study was carried out by comparing the PCR with ELISA (enzyme linked immuno sorbent assay) and IFAT (indirect immunofluorescence) tests. In addition, the PCR sensitivity and specificity were determined. A sample of 156 individuals was tested with the H2A PCR primers after a Chagas disease classification based on clinical, epidemiological and serological data associated with each patient. In addition, 97 out of 156 samples were also compared with the S35/S36 PCR primers. Results. Eighty-nine of 156 samples (57%) were positive by both IFAT and ELISA and 84 (53.8%) presented the expected 234 bp amplification fragment. The sensitivity of the TcH2AF/ R PCR was 88% (95% C.I.: 75%--95%) and its specificity 92.5% (95% C.I.: 87.7%--97.2%). The kappa index for concordance between serological tests and TcH2AF/R PCR was 0.8 (95% C.I.: 73%--86%), and between the TcH2AF/R and S35/S36 PCR primers was 0.9 (95% C.I.: 84%-- 96%). These indices indicated a “good” and “almost perfect” agreement, respectively. Conclusions. The TcH2AF/R PCR is a promising diagnostic tool for the detection of T. cruzi and is suggested as a tool complementary to the classical serological tests.


Subject(s)
Humans , Chagas Cardiomyopathy , Chagas Disease/diagnosis , Trypanosoma cruzi , Histones , Polymerase Chain Reaction
13.
Rev. MVZ Córdoba ; 11(1): 715-724, ene.-jun. 2006. ilus, tab
Article in English | LILACS | ID: lil-621852

ABSTRACT

Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2 percent w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100 percent were found, predictive positive and negative values were of 100 percent respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method) provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.


Subject(s)
Humans , Cattle , Listeria monocytogenes , Milk/microbiology , Polymerase Chain Reaction/methods
14.
Biomédica (Bogotá) ; 26(1): 51-60, mar. 2006. ilus, graf
Article in Spanish | LILACS | ID: lil-434554

ABSTRACT

Introducción. La sangre de cordón umbilical humana es una alternativa para la obtención de células madre hematopoyéticas; sin embargo, no es clara la expresión conjunta de los antígenos CD34, CD38 y HLA-DR, ni de antígenos embrionarios asociados con este tipo de muestra. Objetivos. Determinar la expresión en membrana de los antígenos CD34, CD38 y HLA-DR, así como de los antígenos embrionarios SSEA-4 (Specific Stage Embryonic Antigen–4) y CD13. Materiales y métodos. El estudio se realizó en muestras de sangre de cordón umbilical obtenidas de ochenta mujeres en estado de gravidez normal a término que asistieron al servicio de ginecobstetricia del Hospital Universitario San Ignacio. Los antígenos se determinaron mediante citometría de flujo. Resultados. El rango de células CD34+ presentes en sangre de cordón umbilical humana fue mayor al 0,2 por ciento (p=0,0010): a partir de esta población el rango de CD34+/ CD38-/ HLA-DR- fue de 0,0153 por ciento a 0,0234 por ciento, de CD34+/CD38+/HLA-DR- fue de 0,0191 por ciento a 0,296 por ciento, de CD34+/CD38-/HLA-DR+ fue de 0,0427 por ciento a 0,0676 por ciento, y de CD34+/CD38+/HLA-DR+ fue de 0,2427 por ciento a 0,5117 por ciento. La expresión de los antígenos embrionarios SSEA-4 y CD13 se determinó con el mismo método y se encontraron ocho muestras positivas para la expresión de estos antígenos. Conclusiones. El fenotipo que se expresa con mayor frecuencia en sangre de cordón umbilical corresponde a CD34+ CD38+ HLA DR+; además, el hallazgo de antígenos embrionarios podría indicar que en sangre de cordón umbilical humana existen poblaciones celulares con fenotipos similares a los progenitores celulares adultos multipotentes (Multipotent Adult Progenitor Cells) descritos en médula ósea.


Subject(s)
Cord Blood Stem Cell Transplantation , Hematopoietic Stem Cells , Umbilical Cord , Flow Cytometry , Stem Cell Transplantation
15.
Colomb. med ; 36(4,supl.3): 6-14, out. 2005.
Article in Spanish | LILACS | ID: lil-422830

ABSTRACT

INTRODUCCIÓN: La enfermedad diarreica aguda (EDA) es un problema de salud a nivel mundial que afecta a la población infantil de distintas regiones. Casi todos los estudios epidemiológicos se han hecho en países con estaciones y poco se informa su comportamiento en países sin estaciones, donde la EDA es endémica con picos epidémicos. OBJETIVOS: Contribuir a conocer la conducta de EDA en Colombia y determinar si su comportamiento es diferente en niños menores de cinco años en dos regiones distintas entre sí en geografía y clima. MATERIALES Y MÉTODOS: Se hizo un estudio descriptivo en dos localidades colombianas. Una en la costa atlántica y otra en el centro del país. La muestra se obtuvo en menores de cinco años que consultaron por diarrea a centros asistenciales de cada región. Los microorganismos bacterianos se identificaron mediante pruebas bioquímicas y los virus con técnicas inmunoenzimáticas. En el análisis estadístico se siguieron un ensayo bivariado y pruebas Z de normalidad para verificar si el clima modifica el comportamiento de EDA y si se presenta de manera distinta en las dos regiones. RESULTADOS: En ambas zonas (Cartagena, Bolívar y Facatativa, Cundinamarca) predominó la diarrea viral, frente a la EDA bacteriana. También en ambas el rotavirus fue prevalente. Fue mucho más baja la presencia de astrovirus y adenovirus. No hubo datos con significación estadística para demostrar que las condiciones ambientales y las propias de los niños, alteran el comportamiento de la EDA, pero sí se observó que la EDA por rotavirus se comporta de manera diferente al analizar en forma comparativa las dos regiones del estudio


Subject(s)
Diarrhea , Rotavirus , Rotavirus Infections , Colombia
16.
Acta méd. colomb ; 27(2): 108-114, mar.-abr. 2002. tab, graf
Article in Spanish | LILACS | ID: lil-363462

ABSTRACT

Objetivo: comparar la reactividad antilisados de cepas colombianas de Trypanosma cruzi entre pacientes chagásicos asintomáticos y sintomáticos. Métodos: se seleccionaron tres cepas colombianas del parásito procedentes de diversas áreas geográficas, huésped y ciclo de transmisión, las cuales se analizaron mediante PAGE-SDS. Los pacientes se clasificaron en tres grupos. Grupo 1: donantes de sangre, positivos para la infección por T. cruzi, que no presentaban manifestaciones clínicas de la enfermedad; Grupo II: pacientes con cardiomiopatía chagásica y Grupo III: donantes de sangre, negativos para la infección por T. cruzi. Las muestras de sueros se analizaron mediante ensayos inmunoenzimáticos (ELISA) utilizando como antígeno una mezcla de los tres lisados del parásito. Los resultados se evaluaron según la prueba t-student. Resultados: el análisis de PAGE-SDS de los lisados demostró que las cepas presentaban diferentes perfiles de fracciones proteicas, de manera que se decidió utilizar una mezcla de los mismos para ampliar el repertorio de proteínas a ser reconocidas por los sueros. Por otra parte, se evidenció que 100 por ciento de los pacientes del grupo II reconocían el antígeno, así como también 86 por ciento del grupo I, mientras que 18 por ciento de los pacientes del grupo II reaccionaron contra los lisados. Adicionalmente, se observó cómo los índices de reactividad fueron significativamente más altos en los pacientes sintomáticos que en los asintomáticos. Conclusiones: los resultados indican que los pacientes colombianos difieren en su reactividad promedio anti-T. cruzi, dependiendo del estadio de la enfermedad en que se encuentren, siendo más alta la reactividad en los sintomáticos que en los asintomáticos


Subject(s)
Chagas Disease , Enzyme-Linked Immunosorbent Assay , Immunity, Mucosal , Trypanosoma cruzi
17.
Acta méd. colomb ; 25(3): 117-121, mayo-jun. 2000. ilus
Article in Spanish | LILACS | ID: lil-358424

ABSTRACT

Objetivo: comparar la respuesta contra los colágenos tipo I y IV entre pacientes infectados con Trypanosoma cruzi y controles normales. Métodos: los pacientes infectados fueron clasificados en grupo I y II dependiendo de si se encontraban asintomáticos (I) o tenían manifestaciones clínicas de la enfermedad (II). Los pacientes no infectados constituyeron el grupo control (III). Las muestras de suero de dichos pacientes fueron examinadas mediante pruebas de inmunoensayo enzimático (ELISA) y los resultados analizados mediante la prueba de hipótesis para proporciones entre grupos y la prueba de análisis de varianza (ANOVA). Resultados: el 55 por ciento de los pacientes infectados presentó reactividad frente a colágeno tipo IV, mientras el grupo control no reconoció dicho antígeno (p<0.05). Así mismo se encontraron diferencias (p<0.05) en la reactividad a colágeno tipo IV entre los grupos II y I con porcentajes de 71 y 47 por ciento respectivamente. Por otra parte, el 33 por ciento de los controles normales respondieron a colágeno tipo I, en comparación al 13 por ciento de los pacientes infectados (p<0.05). Conclusión: puesto que el colágeno tipo IV constituye una de las proteínas de la membrana basal del miocardio, es posible que el incremento de anticuerpos anti-colágeno tipo IV desarrollados durante la fase crónica de la infección esté involucrado en la patología de la cardiopatía chagásica crónica.


Subject(s)
Chagas Disease , Collagen/analysis
SELECTION OF CITATIONS
SEARCH DETAIL