Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 12 de 12
Filter
1.
Article in Chinese | WPRIM | ID: wpr-703152

ABSTRACT

Objective To study the clinical, laboratorial, histopathological, imaging features of two cases of hypothyroid myopathy. Method Clinical manifestations, thyroid function, electromyography, muscle MRI, muscle biopsy and follow-up results were collected, and analyzed with the literature. Result These two patients were middle-age to old age and the onset of disease was insidious. Their common clinical manifestations included subacute progressive weakness in the proximal muscles,myalgia after sports and reduction in tendon reflex.The blood test showed an increase in serum concentration of CK and TSH, and a decrease in FT3 and FT4. The electromyography showed suspicious myogenic damage.Muscle histopathological findings were largely nonspecific,such as type I fiber predominance and type 2 atrophy. The MRI revealed extensive muscular dystrophy and fatty filtration in the posterior group of thighs. Treatment of replacement therapy with L-T4 relieved the myopathic symptoms quickly. Conclusion When a patient presents with a subacute progressive weakness in the proximal muscles, the hypothyroidism should be consideration. Muscle histopathological findings may be nonspecific. The muscle MRI have a value of differential diagnosis and lesion assessment.

2.
Article in Chinese | WPRIM | ID: wpr-669063

ABSTRACT

Objective To study the clinical, pathological, imaging features of two cases of central core disease (CCD) with different inheritance and to explore the similarities and differences between autosomal recessive CCD (AR-CCD) and autosomal dominant CCD (AD-CCD). Methods Clinical manifestations, family history, muscle MRI and muscle biopsy were collected. Targeted next generation sequencing (NGS) and sanger sequencing were applied for genetic analysis. Co-segregation analysis was further conducted in one family. Results Their common clinical manifestations included childhood early-onset proximal limbs muscle weakness and dystrophy accompanied with facial involvement. The MRI revealed extensive muscular dystrophy and fatty filtration in the both thighs, but not in rectus femoris. Pathology of skeletal muscle showed typical central cores in type Ⅰ muscle fibers and eccentric cores only in AR-CCD. Targeted NGS identified 3 missense mutations in RYR1, including one novel mutation. Conclusion The present study has described clinical and pathological features of two typical CCD patients with different inheritance, which may be associated with the different mutations in RYR1 gene. Targeted NGS apparently improves the genetic diagnosis of CCD.

3.
Acta Pharmaceutica Sinica B ; (6): 59-64, 2017.
Article in English | WPRIM | ID: wpr-256779

ABSTRACT

Euphorbia factor L2, a lathyrane diterpenoid isolated from caper euphorbia seed (the seeds ofL.), has been traditionally applied to treat cancer. This article focuses on the cytotoxic activity of Euphorbia factor L2 against lung carcinoma A549 cells and the mechanism by which apoptosis is induced. We analyzed the cytotoxicity and related mechanism of Euphorbia factor L2 with an MTT assay, an annexin V-FITC/PI test, a colorimetric assay, and immunoblotting. Euphorbia factor L2 showed potent cytotoxicity to A549 cells. Euphorbia factor L2 led to an increase in reactive oxygen species (ROS) generation, a loss of mitochondrial electrochemical potential, release of cytochromeactivation of caspase-9 and caspase-3, and cleavage of poly(ADP-ribose) polymerase, suggesting that Euphorbia factor L2 induced apoptosis through a mitochondrial pathway. The cytotoxic activity of Euphorbia factor L2 in A549 cells and the related mechanisms of apoptotic induction provide support for the further investigation of caper euphorbia seeds.

4.
Article in Chinese | WPRIM | ID: wpr-287969

ABSTRACT

<p><b>OBJECTIVE</b>To assess the association of genetic polymorphisms of CYP2C19*2,*3,*17 with the recurrence risk of ischemic stroke during clopidogrel prevention in ethnic Han Chinese from Fujian Province.</p><p><b>METHODS</b>Clinical data of 985 patients with acute ischemic stroke was collected. After 1 year postdischarge follow-up evaluations, only 114 patients with persistence of clopidogrel were enrolled. CYP2C19 genetic polymorphisms were detected by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)and direct sequencing ,then we analysis the correlation between polymorphisms and the recurrence of stroke.</p><p><b>RESULTS</b>Among the 114 patients, 23 had a second onset whilst receiving clopidogrel treatment. During the antiplatelet therapy with clopidogrel, carriers of CYP2C19 poor metabolizer (CYP2C19*2/*2 or *2/*3) had a higher rate of recurrent stroke compared with extensive metabolizers (CYP2C19*1/*1) (OR=4.71, 95%CI: 1.18-18.80, P<0.05). Carriers of CYP2C19 *2 mutant allele had increased recurrence compared with those carrying none loss-of-function allele (OR=2.31, 95%CI: 1.20-4.46, P<0.05). The rate of recurrent stroke in those carrying homozygous mutant *2 allele (CYP2C19*2/*2) was 6.14 times greater than the rate of wild-type homozygotes (CYP2C19*1/*1) (95%CI: 1.54-24.54, P<0.05). Patients with previous stroke history had increased risk of recurrence (OR= 4.146, 95%CI: 1.259-13.655, P<0.05). However, CYP2C19*17 was not detected in the group.</p><p><b>CONCLUSION</b>For ethnic Han Chinese patients receiving clopidogrel treatment, carriers of poor metabolizer or homozygous mutant *2 allele (CYP2C19*2/*2) have a higher risk of recurrent stroke. The CYP2C19 *2 allele is an independent risk factor for recurrent stroke. Those with previous history of stroke are more prone to the recurrence.</p>


Subject(s)
Aged , Female , Humans , Male , Middle Aged , Alleles , Asian People , Genetics , Brain Ischemia , Ethnology , China , Cytochrome P-450 CYP2C19 , Genetics , Gene Frequency , Genetic Predisposition to Disease , Ethnology , Genetics , Genotype , Linkage Disequilibrium , Logistic Models , Platelet Aggregation Inhibitors , Therapeutic Uses , Polymerase Chain Reaction , Polymorphism, Restriction Fragment Length , Polymorphism, Single Nucleotide , Recurrence , Risk Factors , Sequence Analysis, DNA , Stroke , Ethnology , Genetics , Ticlopidine , Therapeutic Uses , Time Factors
5.
Chinese Journal of Microsurgery ; (6): 464-467, 2011.
Article in Chinese | WPRIM | ID: wpr-428296

ABSTRACT

ObjectiveTo study whether the abductor pollicis brevis been effected by the reinnervation of the Riche-Cannieu anastomosis in the median nerve injury cases.MethodsCollect 43 cases (29male,14 female,mean age 32.6)corresponds with the study needs: (1)The traumatic median nerve injury (proved by the results of electrophysiological examine and the clinic diagnose)on or below the forearm.(2)The existence of RCA was verified by the electrophysiological examine results,and the amplitude of electric potential was under 1mv.(3) Rule out the cases with the other injure of nerve or nervous system disease and cervical vertebra disease,diabetes patient.The analysis base on the results of 43 case's periodical examine,the periodical criteria as following: within 2-4th week,within the 2-4thmonth and 1 year after the injury.Results Forty-three cases had not obvious recovery indication of the median nerve under the clinical and electrophysiological aspect,eight cases of abductor pollicis brevis function improved quickly in 3 months,the relevant CMAP amplitude of Riche-Cannieu anastomosis increased apparently,the EMG (Electromyography)results of abductor pollicis brevis ameliorated accordingly.ConclusionIn the case of RCA combined with the median nerve injury,the abductor pollicis brevis fibra might be dominated by RCA reinnervation when losing domination of median nerve,the reinnervation process will much faster than the regeneration process of the broken nerve.

6.
Chinese Journal of Neurology ; (12): 568-573, 2011.
Article in Chinese | WPRIM | ID: wpr-419639

ABSTRACT

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

7.
Article in Chinese | WPRIM | ID: wpr-419682

ABSTRACT

Objective To analyze the electrophysiological characteristics of Hirayama disease and explore their significance for its diagnosis.MethodsElectrophysiological tests were performed on 18 patients who fulfilled the clinical criteria for Hirayama disease. Sixteen were males and 2 were females. The mean age was 24.9years old ( 19-58 years), and the mean case history was 5.2 years ( 1-40 years). The Hirayama disease was clearly unilateral in 10 patients and bilateral in 3, with 5 cases suspected of being bilateral. Motor neuron conduction velocity (MCV) and sensory neuron conduction velocity (SCV) were measured in the median and ulnar nerves.Electromyograms (EMGs) of the abductor digiti minimi, abductor pollicis brevis, extensor digitorum communis,brachioradialis muscle, biceps brachii and sternocleidomastoid were recorded in all cases. The MCV and SCV of the common peroneal nerve and an EMG of the tibialis anterior muscle were examined in one leg. The MCV and SCV of the ulnar nerve and EMGs of the abductor digiti minimi, extensor digitorum communis and brachioradialis muscles were inspected on the contralateral sides of 8 cases, including the patients suspected of suffering bilateral Hirayama disease. The MCVs of the median and ulnar nerves were examined segmentally by stimulating the nerves distally as well as proximally, and recording the amplitude, duration and area of compound muscle action potentials (CMAP) and changes in wave form, then determining whether there was a nerve conduction block.Results (1) No conduction block was detected in any median nerve or ulnar nerve among the 18 cases. (2) All the SCVs and sensory nerve action potentials of the median and ulnar nerves were normal. ( 3 ) All the MCVs and SCVs of the common peroneal nerve and the EMGs of the anterior tibialis muscles were normal. (4) MCV slowing in the upper limbs accounted for 41.3% (19/44) of the examined nerves. The rates of MCV decrease were 72.2% (13/18)in the ulnar nerve on the affected sides, 33.3% (6/18) in the median nerve on the affected sides and 0% (0/8)in the ulnar nerve on the contralateral sides. (5) Amplitude reduction in the CMAP in the upper limbs accounted for 81.8% (36/44) of the examined nerves. The rates of amplitude decrease were 100% (18/18) in the ulnar nerves of the affected sides, 77.8%(14/18) of median nerves on the affected side and 50%(4/8) of ulnar nerves on the contralateral side. ( 6 ) Upper limb EMGs revealed a rate of neurogenic damage of 47.0% ( 62/132). The EMGs decreased in 100% (18/18) of the abductor digiti minimi and abductor pollicis brevis on the affected side, 88.9% (16/18) of extensor digitorum communis on the affected side, 62.5% (5/8) of the abductor digiti minimi on the contralateral side, 37.5% (3/8) of the extensor digitorum communis on the contralateral side,5.6% ( 1/18 ) of the brachioradialis and biceps brachii muscles on the affected sides. There was no neurogenic damage of the contralateral brachioradialis muscle or the sternocleidomastoid on the affected side.Conclusions The electrophysiological features of Hirayama disease include unilateral or bilateral neurogenic damage in the upper limbs. According to the abnormal EMGs, spinal anterior horn cells on the affected sides were injured at C7-T1. C6and above C6 were rarely involved. The electrophysiological characteristics of Hirayama disease could provide a clear basis for localization and differentiation in Hirayama disease diagnosis.

8.
Chinese Journal of Neurology ; (12): 90-92, 2010.
Article in Chinese | WPRIM | ID: wpr-391404

ABSTRACT

Objective To investigate the spectrum of senataxin gene mutations in Chinese patients with sporadic amyotrophic lateral sclerosis (SALS). Methods Sixty sporadic SALS patients and 200 unrelated normal individuals were screened for mutations of senataxin by PCR-sequencing methodology. Results Two silent mutations, Asp844Asp and Phe998Phe, were identified in two SALS patients, respectively. They were not found in controls. However, a homology search of senataxin gene in different species revealed that these two amino acids were not evolutionarily conserved, indicating that the mutations were not pathogenic. Additional 19 polymorphisms were detected. Conclusion The identification of two silent mutations and 19 polymorphisms has further broadened the spectrum of mutations and polymorhpisms in senataxin.

9.
Chinese Journal of Neurology ; (12): 253-257, 2009.
Article in Chinese | WPRIM | ID: wpr-395420

ABSTRACT

Objective To screen the mutation and analysis its characteristics of SPG4 and SPG3A in Chinese patients with hereditary spastic paraplegia (HSP).Methods Mutation and polymorphism of the SPG4 and SPG3A were screened in the index eases of 26 autesomal dominant families (AD-HSP) and 30 sporadic cases by combination of DHPLC and sequencing analysis, then the index cases of 26 AD-HSP were further confirmed with direct sequencing.Results One novel mutation of SPG4, 1616 + 1g→t, was identified in the index ease from an AD-HSP family.Three symptomatic patients and 2 pre-symptomatic patients were found in this family by sequencing analysis.No mutation of SPG3A was detected.In addition, 8 novel SPG4 polymorphisms and 3 novel SPG3A polymorphisms were identified.Conclusions The study has broadened the mutation and polymorphism spectrums of SPG4 and SPG3A.Mutation of these two genes is less common in this group of patients.

10.
Chinese Journal of Neurology ; (12): 197-200, 2009.
Article in Chinese | WPRIM | ID: wpr-395990

ABSTRACT

Objective To evaluate the quantitative technique of real-time amplification refractory mutation system quantitative PCR( RT ARMS-qPCR)in the detection of the mitochondrial DNA A3243G mutation load.To investigate the mutation load in different tissues in patients with mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS).Methods Wild type and mutant-type (A3243G) of mitochondrial DNA were cloned into plasmid pMD18-T to construct express vectors. Thirteen standard controls having different proportions of mutation loads were developed by mixing wild-type and mutant-type cloned plasmid DNA in different ratios. The mutation loads in the tissues of blood, muscle, hair follicles and urine from seven patients with MELAS and one carrier, and blood samples in 53 unaffected subjects were detected by lit ARMS-qPCR and PCR-RFLP. ResultsIn standard controls, there was a linear correlation between the expected values and results of mutation loads detected by both methods of PCR-RFLP (R21 = 0. 885 ) and RT ARMS-qPCR (R22 = 0. 991 ) . The results detected by RT ARMS-qPCR were closer to the expected values. The detection of mutation loads in tissues from the patients revealed higher values by liT ARMS-qPCR method than by PCR-RFLP and RT ARMS-qPCR was more sensitive in detecting the lower A3243G mutation load. The mutation load in muscle, hair follicles or urinary sedimem is higher than that in leukoeytas.Conclusion The RT ARMS-qPCR provides a convenient,rapid, sensitive and reliable quantitative detection of heteroplasmic mutant mtDNA A3243G in different tissues.

11.
Article in Chinese | WPRIM | ID: wpr-381999

ABSTRACT

Objective To explore the optimal electrophysiologieal approach for detecting Riehe-Cannieu anastomosis(RCA),an anomalous anastomosis between the deep branch of ulnar nerve and the recurrent branch of the medial nerve in the palm of the hand,and to estimate its incidence. Methods One hundred subjects(56 male,44 female,mean age 37.8 years)without any hand motor or sensory dysfunction were selected randomly.The ulnar nerve was stimulated at both the elbow and wrist,and recordings were made from the abductor pollicis brevis,which is normally innervated by the medial nerve,to document any compound muscle action potentials(CMAP).CMAP recorded from both points during stimulation is an accepted indicator of RCA.Group A comprised 40 hands of 20 subjects,while group B included 160 hands of 80 subjects.Surface electrode stimulation was used in both groups.Surface and needle electrode recording was used in group A,while only needle electrode recording was used in group B.Results In group A,31 hands of 16 subjects were found to have RCA by means of surface electrode recording,but only 6 hands of 3 subjects were found to have RCA by means of concentric needle electrode recording.There was a difference of up t0 80.6% between results obtained by the 2 recording methods.In group B,35 hands of 20 subjects were found to have RCA.A total of 41 hands of 23 subjects among the 100 were found to have RCA when concentric needle electrode recording was used(20.5%incidence). Conclusion The type of recording electrode influences the accuracy of RCA examination.An accurate and reliable result can be obtained by using a concentric needle electrode.The abductor pollicis brevis can be anomalously innervated by the ulnar nerve because of RCA.When both the medial and ulnar nerve have been injured.RCA might result in anomalous clinical symptoms and electrophysiological findings.Thoroughly understanding this anomaly is of crucial importance in the clinical evaluation and diagnosis of medial or ulnar nerve injury,as well as to avoid mistakenly interpreting the electrophysiological data when Riche-Cannieu anastomosis is present.

12.
Article in Chinese | WPRIM | ID: wpr-535882

ABSTRACT

Objective To study and report 7 novel mutations and 5 novel polymorphisms of Wilson disease (WD) geneIn combination with the mutations and polymorphisms previously reported, mutation characteristics of WD gene in Chinese were further analysed. Methods Genomic DNA of 60 normal controls and 84 WD patients from 64 families were extracted from peripheral blood leukocytesThe mutations of WD gene (exon1~21) in these subjects were screened by PCR-single strand conformation polymorphism (SSCP) and further confirmed by sequencing. Results 18 different mutations and 17 polymorphisms have been found, in which 7 mutations and 5 polymorphisms are novel, respectivelyOf them, Arg778Leu and Thr935Met reaching a mutation frequency of 37.7% and 10% of in WD chromosomes may be the hotspots of mutation in Chinese population.Ile1148Thr, previously defined as a possible disease-causing mutation may be a polymorphism which has not yet been detected in normal chromosomes. Conclusion In Chinese, WD seems resulting from a few relatively common and a large number more rare mutations

SELECTION OF CITATIONS
SEARCH DETAIL