Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 14 de 14
Filter
1.
Article in Chinese | WPRIM | ID: wpr-1020075

ABSTRACT

The clinical data of a patient with Klinefelter syndrome (KS) complicated by partial androgen insensitivity syndrome (PAIS) was retrospectively analyzed.The patient, a 2-month-and-22-day-old baby, was admitted to Children′s Hospital Affiliated to Zhengzhou University due to abnormal external genitalia in October 2021.Upon birth, the patient exhibited abnormal external genitalia, manifested as clitoral hypertrophy.Hormonal examinations were consistent with those of peers, while chromosomal analysis revealed 47, XXY.Due to the severe undermasculinization, whole exome sequencing was conducted, indicating a heterozygous variant of the AR gene (c.1847G>A, p.Arg616His). The patient was diagnosed with PAIS, and her elder sister was diagnosed with complete androgen insensitivity syndrome.For further treatment, a multidisciplinary comprehensive evaluation is needed.This is a rare case of KS combined with PAIS, suggesting the possibility of AR gene mutations in KS children with severe undermasculinization.

2.
Journal of Medical Research ; (12): 74-80, 2024.
Article in Chinese | WPRIM | ID: wpr-1023629

ABSTRACT

Objective To systematically evaluate the efficacy and safety of high-dose dual therapy(HDDT)versus quadruple ther-apy(QT)for the first-line helicobacter pylori(Hp)infection.Methods The randomized controlled trial(RCT)about HDDT versus QT for the first-line treatment of Hp infection were searched from CNKI,VIP,Wanfang,CBM,PubMed,Embase,Cochrane Library and other databases from the establishment of databases to 3 July 2022.RevMan 5.4 and Stata 17.0software were used for Meta-analysis.Results A total of 1l studies with 4015 patients were included.The results of Meta-analysis showed that:the eradication rate of HDDT was statistically superior to that of QT(RR=1.04,95%CI:1.01-1.06,P<0.01)in the intention-to-treat analysis;the eradica-tion rate of the two groups was not statistically significant(RR=1.02,95%CI:1.00-1.04,P=0.08)in the coincidence protocol a-nalysis.HDDT had a significantly lower rate of adverse reactions than QT(RR=0.47,95%CI:0.36-0.61,P<0.01);but HDDT and QT both had achieved a similar eradication rate(RR=1.01,95%CI:1.00-1.02,P=0.06)in the per-protocol analysis.Conclusion The efficacy of HDDT in eradicating Hp infection for the first time is better than that of QT,and the safety is better,so it can be used as a first-line treatment in clinic.

3.
Article in Chinese | WPRIM | ID: wpr-933905

ABSTRACT

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

4.
Article in Chinese | WPRIM | ID: wpr-879523

ABSTRACT

OBJECTIVE@#To analyze the clinical and genetic characteristics of a patient with congenital isolated adrenocorticotropic hormone deficiency (IAD).@*METHODS@#Clinical characteristics of the patient was reviewed. Genomic DNA of the child was subjected to whole exome sequencing.@*RESULTS@#Genetic testing has confirmed the diagnosis of congenital IAD by identification of compound heterozygous variants of the TBX19 gene, which included a pathogenic nonsense c.535C>T (p.R179X) variant inherited from his father and a novel missense c.298C>T (p.R100C) variant inherited from his mother.@*CONCLUSION@#Congenital IAD due to variants of the TBX19 gene is a rare autosomal recessive disease. It is characterized by low plasma adrenocorticotropic hormone and cortisol levels but normal levels of other pituitary hormones. Delayed diagnosis may lead to severe early-onset adrenal failure and wrong treatment which may result in neonatal mortality. Hydrocortisone replacement is effective. Detection of pathogenic variant of TBX19 gene is the key to diagnosis.


Subject(s)
Child , Humans , Adrenal Insufficiency/genetics , Homeodomain Proteins/genetics , T-Box Domain Proteins/genetics
5.
Article in Chinese | WPRIM | ID: wpr-879498

ABSTRACT

OBJECTIVE@#To analyze the clinical and genetic characteristics of a patient with dihydrolipoamide dehydrogenase deficiency.@*METHODS@#Potential variants of the DLD gene were detected by whole exome sequencing and verified by Sanger sequencing.@*RESULTS@#Compound heterozygous variants, c.704_705delTT (p.Leu235Argfs*8) and c.1058T>C (p.Ile353Thr), were detected in the DLD gene. The c.1058T>C (p.Ile353Thr) variant was derived from his mother and known to be pathogenic. The c.704_705delTT (p.Leu235Argfs*8) variant was derived from his father and was unreported previously.@*CONCLUSION@#The compound heterozygous variants of c.704_705delTT (p.Leu235Argfs*8) and c.1058T>C (p.Ile353Thr) of the DLD gene probably underlay the disease in this patient. Above finding has facilitated genetic counseling and prenatal diagnosis for the family.


Subject(s)
Female , Humans , Male , Pregnancy , Acidosis, Lactic/genetics , Dihydrolipoamide Dehydrogenase/genetics , Genetic Testing , Genetic Variation , Maple Syrup Urine Disease/genetics , Exome Sequencing
6.
Article in Chinese | WPRIM | ID: wpr-743519

ABSTRACT

Objective To analyze the clinical and molecular genetic characterizations of X-linked adrenal dysplasia congenita(AHC) onset in infant.Methods Seven children (from 7 families) with X-linked AHC who were admitted to the Department of Endocrinology,Genetics and Metabolism,Children's Hospital Affiliated to Zhengzhou University,from July 2012 to June 2017 were selected.All patients were screened for dosage-sensitive-sex reversal-adrenal hypoplasia congenital critical region on the X chromosome gene1 (DAX1/NR0B1) mutations.The clinical manifestation and laboratory examination were analyzed,their clinical characterizations were summarized.Results Seven patients were all male,the onset age of the patients were from after birth to 7 months old,and 4 patients (4 families) had a family history of X-linked recessive inheritance.The clinical manifestations were skin pigmentation [100.0% (7/7 cases)],vomiting [71.4% (5/7 cases)],no weight gain [57.1% (4/7 cases)] and poor spirit [28.6% (2/7 cases)].Laboratory tests showed that hyperkalemia and hyponatremia,increased coricotrophin,normal or decreased cortisol,17α-hydroxyprogesterone,progesterone,aldosterone and dehydroepiandrosterone.Testosterone levels increased in 5 patients.The abnormalities of adrenal glands imaging could be seen in 2 patients.Two patients were misdiagnosed as congenital adrenal cortical hyperplasia.Then the definitive diagnosis were made by genetic test.DAX1/ NR0B1 gene mutations were found in all patients.Five patients were novel mutations (c.114_126del,c.872G > A,c.56delG,c.884T > G,c.1217delG).Conclusions The clinical manifestations of X-linked AHC with infant onset include pigmentation,poor spirit and growth retardation,which should be differentiated from congenital adrenal cortical hyperplasia.Hormone levels such as elevated blood 17α-hydroxyprogesterone and family history are the main identification points,and AHC cannot be excluded when testosterone level increases.Five novel mutations are found in this study,which enrich the gene database.

7.
Article in Chinese | WPRIM | ID: wpr-772033

ABSTRACT

OBJECTIVE@#To analyze the genetic variant of a child with fructose-1, 6 bisphosphatase deficiency.@*METHODS@#Potential variant of the FBP1 gene was detected by next generation sequencing and verified by Sanger sequencing.@*RESULTS@#A compound heterozygous variant, c.826-2T>C and c.490G>A (p.Gly164Ser), was detected in the FBP1 gene. Among them, the c.490G>A(p.Gly164Ser) variant was derived from his mother and known to be pathogenic. The c.826-2T>C variant was derived from his father and was not reported previously.@*CONCLUSION@#The compound heterozygous variant of c.826-2T>C and c.490G>A(p.Gly164Ser) of the FBP1 gene probably underlie the disease in this patient. Genetic testing can facilitate diagnosis and genetic counseling and prenatal diagnosis.


Subject(s)
Child , Humans , Fructose , Fructose-1,6-Diphosphatase Deficiency , Genetic Testing , High-Throughput Nucleotide Sequencing , Mutation
8.
Article in Chinese | WPRIM | ID: wpr-756157

ABSTRACT

We reported a case diagnosed with meningeal cysts complicated with tethered cord syndrome based on prenatal ultrasound images at 37+5 gestational weeks, which also showed horseshoe kidney and intrahepatic vascular abnormalities (arteriovenous fistula) in the fetus. The gravida had a precipitate delivery at 39+4 gestational weeks. The anus of this newborn was about 1 cm in front of the normal position. Intrahepatic arteriovenous fistula and horseshoe kidney were detected by neonatal ultrasound and CT scan, and spinal cystic occupying lesion was found by lumbar-sacrum MRI. Intraspinal tumors were removed through spinal canal exploration and spinal cord tumor resection and were confirmed as ependymal cysts by pathological analysis, which was consistent with the prenatal diagnosis. Postoperative changes of lumbar spine was reported by CT scan after the operation. The baby received successful anoplasty when five months old and no abnormal growth or development were found when followed up to one year and eight months old. Raising awareness of tethered cord syndrome can help reduce missed diagnosis and misdiagnosis.

9.
Article in Chinese | WPRIM | ID: wpr-861279

ABSTRACT

Objective:To explore the value of ultrasound in screening of twin pregnancies during early trimmest (11-13+6 weeks). Methods: Totally 196 twin pregnant women who received prenatal ultrasonography at 11-13+6 weeks were enrolled, among them the twins were classified as chorionic and amniotic. The fetal-rump length and nuchal translucency (NT) were measured, the fetal structures were examined systematically to detect structural abnormalities, and the pregnancy outcomes were followed up. Results: Among 196 twin pregnant women, dichorionic and diamniotic (DCDA) twins were found in 149 women, monochorionic and diamniotic (MCDA) twins were found in 43 women, while monochorionic and monoamniotic (MCMA) twins were observed in 4 women. Ultrasonography showed that 36 pregnant women had abnormal fetuses, including 30 DCDA twins, 4 MCDA twins and 2 MCMA twins. A total of 30 abnormal fetuses were detected in DCDA twins, all were one of the twins, including one with spine and lower limbs abnormally developed, one with neck water cyst, one of twins stopped developing in 25 cases and one of twins with thickened NT in 3 cases. A total of 6 abnormal fetuses were detected in MCDA twins, including one fetus without cardiac twins sequence, one of twins with neck water cyst in one case, one of the twins stopped developing and the other with neck water cyst in one case, and both twins stopped developing in one case. Among MCMA twins, encephalomeningocele was found in one of twins in one case, while conjoined twins were detected in one case. Conclusion: Ultrasound screening plays a very important role in diagnosing chorionic and amniotic, detecting fetal structural abnormalities and complications of twins during early trimmest.

10.
Chinese Journal of Pathophysiology ; (12): 1493-1493,1494, 2016.
Article in Chinese | WPRIM | ID: wpr-604538

ABSTRACT

AIM:Atherosclerotic calcification is highly linked with plaque instability and cardiovascular events .Adenosine monophosphate-activated protein kinase ( AMPK) has been involved in the pathogenesis of various cardiovascular disease .The contributions of AMPKαsubunits to the development of atherosclerotic calcification in vivo remained unknown .We hypothesized that AMPKαsubunits may play a role in the development of atherosclerotic calcification .METHODS: Atherosclerotic calcification was generated by 24-week fed of western diet in ApoE-/-background mice .Calcification was evaluated in aortic roots and innominate arteries of ApoE-/-mice or in mice with dual deficiencies of ApoE and AMPKαsubunits globally ( AMPKα1 and AMPKα2 ) , or vascular smooth muscle cell ( VSMC)-specific or macrophage-specific knockout of AMPKα1 with atherosclerotic calcification pone diet . The mechanism of AMPKα1 in regulating Runx2 was further explored in human aortic VSMC .RESULTS: Ablation of AMPKα1 but not AMPKα2 in ApoE-/-background promoted atherosclerotic calcification with increased Runt -related transcription factor ( Runx2 ) expression in VSMC compared with ApoE-/-mice.Conversely, chronic administration of metformin, which activated AMPK, markedly reduced ath-erosclerotic calcification and Runx2 expression in ApoE-/-mice but had less effects in ApoE-/-/AMPKα1 -/-mice.Furthermore, VSMC-but not macrophage-specific deficiency of AMPKα1 in ApoE-/-background promoted atherosclerotic calcification in vivo com-pared with the controls .AMPKα1 silencing in human aortic VSMC prevented Runx 2 from proteasome degradation to trigger osteoblastic differentiation of VSMC .Conversely , activation of AMPK led to Runx 2 instability by inducing its small ubiquitin-like modifier modifi-cation (SUMOylation).Protein inhibitor of activated STAT-1 (PIAS1), the SUMO E3-ligase of Runx2, was directly phosphorylated by AMPKα1 at serine 510, to enhance its SUMO E3-ligase activity.Ablation of PIAS1 serine 510 phosphorylation inhibited metformin-in-duced Runx2 SUMOylation, and subsequently prevented the effect of metformin on reducing oxLDL-triggered Runx2 expression in hu-man aortic VSMC.CONCLUSION:Deficiency of AMPKα1 in VSMC increases Runx2 expression and promotes atherosclerotic calcifi-cation in vivo.AMPKα1 phosphorylates PIAS1 to enhance Runx2 SUMOyalation and subsequent degradation .

11.
Article in Chinese | WPRIM | ID: wpr-426481

ABSTRACT

Tyrosinemia type Ⅰ is an autosomal recessive disease characterized by severe liver and kidney damage.Patients with this disease may develop acute liver failure and have a high risk of hepatocellular carcinoma.The diagnosis is confirmed by elevated tyrosine serum levels and large amounts of succinylacetone in blood and urine.Nitisinone has been significantly effective in treatment of the disease,while dietary therapy with restriction of phenylalanine and tyrosine is necessary at the same time.Liver transplantation has been performed in a few patients and has a positive effect.Experimental work in model mice has provided some promise for gene therapy to this disorder.

12.
Article in Chinese | WPRIM | ID: wpr-388657

ABSTRACT

Objective To study the 2244G→A, 2299 A→G single nucleotide polymorphism (SNP) in the 5' regulatory regions of Toll-like receptor 4 (TLR4) in patients with Gram negative bacteria infection in Shenzhen locality, and to discuss the occurrence, course and prognosis of patients with sepsis. Method Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to detect the genotype of TLR4. After the whole blood DNA of patient was extracted and PCR was amplified, the products were 500bp and 599 bp, and were cut by endonuclease Mae Ⅱ and Sph Ⅰ respectively to determine the SNP 2244G→A and 2299 A→G in TLR4. These two kinds of allele frequencies were statistically calculated in all patients. In the meantime, the incidence of septic shock, average hospitalized days, cost and prognosis of all patients were recorded. Statistical analysis was performed with SPSS version 16 software. ANOVA was used for comparison among multiple groups, and t -test and Sighed rank test were used for paired comparison. Results The 2299 and 2244 sites in the 5' regulatory regions of TLR4 gene of patients with Gram negative bacteria infection in Shenzhen locality had various degrees of changes in single nucleotide. Compared with the documented data from Chinese people in general, there was a significant difference in 2299A→G genotype frequency in residents of Shenzhen locality ( P < 0.05). But there were no statistically significant difference in mortality, incidence of septic shock, average days of ICU stay or ICU cost between TLR4 SNP positive and negative groups of patients. Conclusions There is a wide range of genetic variation in the 2299 and 2244 sites in the 5' regulatory regions of TLR4 among citizens of Shenzhen locality with unique distribution. The 2299A→G genotype frequency probably has differences in distribution and population. The pathogenesis and the prognostic factors of sepsis are complicated, whereas the gene polymorphism may be just one of the factors affecting the prognosis of patients with Gram negative bacteria infection.

13.
Article in Chinese | WPRIM | ID: wpr-552710

ABSTRACT

Objective\ To in vestigate the change of the premature ventricular complexes(PVC)and the heart rate variability(HRV)before and after the treatment of Sotalol on PVC patients.Methods\ To observe the different index of HRV in 50 cases with PVC by means of 24h.ambulator ECG before and after the use of Sotalol,the other 50 cases with PVC as the control.Results\ After the therapy of Sotalol,the SDNN,SDANNI and SDNNI that showd the total HRV significantly(P

14.
Article in Chinese | WPRIM | ID: wpr-554012

ABSTRACT

Objective To find out the relationship between ambulatory pulse pressure (24 h PP) and left ventricular hypertrophy (LVH) and the enlarged diameter of aortic root (AOD) in aged pati ents with essential hypertension.Methods 118 aged patients with essential hypertension we r e examined by ambulatory blood pressure (ABP) and echocardiography,the different index of ABP and left ventricular mass index (LVMI) and AOD were measured.The p atients were divided into group A (24 h PP≥60 mmHg) and group B (24 h PP

SELECTION OF CITATIONS
SEARCH DETAIL