Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 21
Filter
1.
Chin. med. j ; Chin. med. j;(24): 26-35, 2021.
Article in English | WPRIM | ID: wpr-921240

ABSTRACT

BACKGROUND@#Endoscopic biopsy can underestimate gastric malignancies as low-grade intraepithelial neoplasia (LGIN). Definitively diagnosed LGIN would progress. This study aimed to evaluate predictive factors to identify malignancies misdiagnosed as LGIN by biopsy and LGIN at high risk of progression.@*METHODS@#The clinical records of patients diagnosed with gastric LGIN by endoscopic biopsy who underwent at least two endoscopies during the first year of follow-up between 2007 and 2017 were retrospectively collected. Three endoscopists reviewed photographs of the initial endoscopy, described lesion characteristics, and made endoscopic diagnoses. Logistic regression was used to analyze predictors to identify malignancies underestimated as LGIN. A receiver operating characteristic curve was used to evaluate the diagnostic accuracy of these predictors. Patient clinical outcomes of follow-up >1 year were collected. Kaplan-Meier estimates with log-rank tests and Cox proportional hazards regression were used to analyze predictors of progression.@*RESULTS@#Overall, 48 of 182 (26.4%) patients were proven to have malignancies. A single lesion, a large lesion size, and marked intestinal metaplasia (IM) were independent predictors of initially misdiagnosed malignancies. The area under the curve of these predictors was 0.871, with a sensitivity of 68.7% and specificity of 92.5%. Twelve of 98 patients (12.2%) progressed during the 33-month median follow-up period. A whitish appearance, irregular margins, marked IM, and histological diagnosis of LGIN more than twice within the first year were predictors for progression.@*CONCLUSIONS@#Lesions diagnosed as LGIN by biopsy with marked IM and other predictors above should be prudently treated for high potential to be malignancies or progress. Endoscopic follow-up with repeated biopsies within the first year is recommended.


Subject(s)
Humans , Biopsy , Carcinoma in Situ , Endoscopy , Prognosis , Retrospective Studies , Stomach Neoplasms/diagnosis
2.
Zhonghua Nei Ke Za Zhi ; (12): 288-293, 2019.
Article in Chinese | WPRIM | ID: wpr-745745

ABSTRACT

Objective To provide helpful continued medical education (CME) for physicians and improve gout treatment,we conducted a questionnaire survey to investigate physicians' knowledge in nine districts of Beijing.Methods A questionnaire survey including ten gout-related questions was conducted among 298 physicians in Beijing.Demographic data and previous gout CME experience were collected.Chi-square test or Student's t test,univariate analysis and logistic regression analysis were used to evaluate the relevant factors of physicians' knowledge level.Results A total of 250 valid copies were collected including 127 from community service centers (CSC),123 from tertiary hospitals.The correct answer rate of gout etiology,pathogenesis and attack symptoms were over 70% in both groups.45.5% (56/123) CSC doctors and 57.4% (66/115) tertiary doctors answered right drugs to control acute gout attack (P=0.067).Only 42.3% (52/123) in CSC and 53.4% (63/118) in hospitals chose allopurinol as a urate-lowering drug (ULT),while 46.3% (57/123) and 32.2% (38/118) doctors considered colchicine as a ULT drug (P=0.084) respectively.Near half doctors considered that gout patients should take long-term ULT [40.5% (51/126) vs.57.6% (68/118)respectively,P=0.007].Univariate analysis showed that CME training could improve gout-related knowledge in CRC doctors.Conclusion Most CSC doctors generally understand basic knowledge of gout,while confusion of treatment is still significant.CME especially including standard gout treatment should be performed by doctors in tertiary hospitals.

3.
Zhonghua Nei Ke Za Zhi ; (12): 27-31, 2018.
Article in Chinese | WPRIM | ID: wpr-666079

ABSTRACT

Objective To investigate the demographic characteristics, clinical features, diagnosis and treatment of patients with gout in China.Methods Clinical data of 6 814 patients with gout from 100 hospitals in 27 provinces, municipalities or autonomous regions in China were collected and analyzed. Results (1)The ratio of male to female in patients with gout was 14.7:1.The mean age of onset was(48.8 ± 15.1)years old.Mean serum urate level was(526.7 ± 132.3)μmol/L.Patients'education background was of U-shaped distribution; (2) Hypertension was the most common comorbidity [15.8%(1 079/6 814)], then overweight or obesity[51.9%(3 536/6 814)];(3)Alcohol and high-purine food intake were dominant triggering factors in men. The diagnosis of gout was made after onset in majority of patients with cardinal symptom arthralgia.Most patients had the disease less than 5 years,and the longer the course,the more flares in the previous year of entry;(4)Febuxostat was the mostly used urate-lowering medication.20.7%(1 412/6 814), 10.8%(739/6 814) and 3.9%(265/6 814) of patients were followed up in 4 weeks, 12 weeks and 24 weeks after registration,and 18.9%(267/1 412),29.1%(215/739)and 38.1%(101/265)of them reached the control target of serum urate levels,respectively.After treatment,patients'liver function was not affected,but serum creatinine levels decreased significantly. Conclusions The proportion of gout patients who reach target serum urate level is very low.Further steps including education and survey need to be carried on.

4.
Zhonghua Nei Ke Za Zhi ; (12): 264-269, 2018.
Article in Chinese | WPRIM | ID: wpr-710055

ABSTRACT

Objective To analyze the clinical features of secondary gout in glycogen storage disease type Ⅰ a (GSD Ⅰ a),so as to improve the awareness of this disease.Methods The clinical features,laboratory findings,treatments and prognosis of 5 GSD Ⅰ a patients with secondary gout who had been admitted to the Peking Union Medical College Hospital during 2006 to 2016 were collected and analyzed.GSD Ⅰ a was confirmed by liver biopsy and genotyping.Results Among the 5 patients (median age:27 years),3 were males and 2 were females.The mean age of gout onset was 17 ranging from 10 to 22 years old.The common manifestations of GSD included hepatomegaly since childhood,hypoglycemia,growth retardation,anemia,hyperlactacidemia and hyperlipidemia.All the 5 patients were complicated with gouty tophi and kidney stone.Gouty tophi and kidney stone were identified 3.8 years and 10.2 years after the first occurrence of articular symptoms,respectively.Renal damage occurred in 3 cases.All the patients underwent several therapeutic modalities including lifestyle intervention,allopurinol,and raw corn starch treatment.Conclusions Determination of the presence of primary disease should be performed actively for young-onset gout with early occurrence of gouty tophi.GSD should be suspected if there exist clinical manifestations like hepatomegaly,recurrent hypoglycemia,growth retardation.Early management of hyperuricemia and gout in GSD patients is important to prevent complications and improve prognosis.

5.
Article in Chinese | WPRIM | ID: wpr-710817

ABSTRACT

Qualitative study is a research method applied to investigate human experience,behavior and emotion.It can improve the depth and breadth of patient-centered clinical research,therefore is useful for medical fields.This article summarizes the main process of qualitative study,reviews its development in China,and introduces its application in general medicine as a research tool.

7.
Zhonghua Nei Ke Za Zhi ; (12): 833-838, 2017.
Article in Chinese | WPRIM | ID: wpr-667469

ABSTRACT

Objective To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia .Method A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing .The enrollment criteria were faculty member of the hospital with signed consent .The exclusion criteria were tumor , previous renal diseases , renal function damage , pregnancy , currently taking medicines that could increase or decrease serum uric acid level , and those who had gout.Males with serum uric acid >416.4 μmol/L and females with serum uric acid >359.6 μmol/L were enrolled as hyperuricemia group .Subjects with normal serum uric acid were randomly enrolled at 1:2 ratio after matching for gender , age, renal function and body mass index .Rs2231142( C>A) was assayed by amplification refractory mutation system polymerase chain reaction , with common forward primer:5′GGCTTTGCAGACATCTATGG 3′, C specific reverse primer:5′CGAAGAGCTGCTGAGAAATG 3′, and A specific reverse primer:5′CGAAGAGCTGCTGAGAAATT 3′.Association between rs 2231142 and hyperuricemia was analyzed in the general study group , as well as different gender and age groups .Results A total of 198 subjects with hyperuricemia and 370 controls were enrolled .The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001).After adjustment for hypertension, hyperglycemia and dyslipidemia , the OR was 2.99 (95%CI 1.94 -4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female.In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female.While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females.Interaction study between gender and rs 2231142 did not reach significant level in both the gender group and two age groups . Conclusion Single nucleotide polymorphism rs 2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort .The ORs are higher in male than those in female , especially in those less than 55 years old .

8.
Article in Chinese | WPRIM | ID: wpr-621465

ABSTRACT

Objective To summarize surgical treatment of Takayasu arteritis,and analysis the drug treatment effect during the perioperative period.Methods Retrospective analysis 46 patients with Takayasu's arteritis disease and received cardiovascular surgery between January 2010 to December 2015,in Anzhen Hospital.By collecting their clinical characteristics,preoperative drug therapy,surgical treatment,pathological examination results to analyze operation conditions,effect of drugs and preoperative conditions.Results The perioperative mortality rate was 2.2% and the complication rate was 23.9% in 46 patients.There were 34 patients with symptomatic relief in the perioperative period,11 patients didn't take hormone drugs before operation.There were 11 cases of complications during the perioperative period,of which 7 patients were in active stage and 10 patients had not been used before operation.Conclusion The surgical treatment of patients with Takayasu's arteritis disease can effectively improve symptoms.The patients in Takayasu's arteritis active stage will affect the outcome of the surgery.Rational use of hormone drugs before surgery,can effectively control the patient's condition,improve the rate of remission of symptoms,and effectively reduce the incidence of perioperative complications.

9.
Article in Chinese | WPRIM | ID: wpr-671221

ABSTRACT

Low birth weight is associated with newborn mortality and adult chronic diseases.Some studies found that naternal caffeine consunption during pregnancy was closely related with low birth weight.Resent research evidence indicates that caffeine may induce low birth weight by blocking adenosine receptors,inhibiting phosphodiesterase(PDE) and enhancing angiotensin Ⅱ (AT2) receptor gene expression to lower the placenta blood flow.We recommend that women should reduce caffeine intake during pregnancy.

10.
Article in Chinese | WPRIM | ID: wpr-489129

ABSTRACT

A profile of the standardized residency training at PUMCH in nine decades depicted the rigorous attitude, strict requirements, tight methodology, enhanced basic theories, basic knowledge and basic skills training, which constitute the characteristic standardized residency training system of the hospital.

11.
Chin. med. j ; Chin. med. j;(24): 607-613, 2014.
Article in English | WPRIM | ID: wpr-317932

ABSTRACT

<p><b>BACKGROUND</b>Integrated positron emission tomography and computed tomography (PET/CT) is increasingly used for the preoperative nodal staging of non-small cell lung cancer (NSCLC). The aim of this study was to evaluate the accuracy of PET/CT in comparison with CT in detection of nodal metastasis and preoperative nodal staging in patients with NSCLC, and to analyze the causes of the PET/CT false-negative and false-positive results.</p><p><b>METHODS</b>Consecutive patients with pathologically proven NSCLC who underwent staging using PET/CT from July 2008 to February 2012 were evaluated retrospectively. Nodal staging was pathologically confirmed on tissue specimens obtained at thoracotomy. The accuracy of PET/CT and CT in the assessment of intrathoracic nodal involvement was determined using histological results as the reference standard. Logistic regression was used to define the causes of the false-negative and false-positive results.</p><p><b>RESULTS</b>A total of 528 lymph node stations were evaluated in 101 patients. Lymph nodes were positive for malignancy in 43 out of 101 patients (42.6%), and 101 out of 528 nodal stations (19.2%). PET/CT was significantly more accurate for nodal staging than CT. The sensitivity, specificity, positive and negative predictive values, and accuracy of PET/CT for detecting nodal metastasis were 51.5%, 95.8%, 74.3%, 89.3%, and 87.3% and the corresponding data by CT were 45.5%, 87.1%, 45.5%, 87.1%, and 79.2%, respectively. PET/CT confers significantly higher specificity, positive predictive value, and accuracy than CT in detecting nodal metastasis. False-negative results by PET/CT are significantly associated with smaller lymph node size, whereas false-positive results are related to a combination of inflammatory disorders and larger lymph node size.</p><p><b>CONCLUSION</b>PET/CT confers significantly higher accuracy than CT in nodal staging, and is more specific and accurate than CT in detecting nodal metastasis but has a low sensitivity and high false-negative rate.</p>


Subject(s)
Adult , Aged , Female , Humans , Male , Middle Aged , Carcinoma, Non-Small-Cell Lung , Pathology , Lung Neoplasms , Pathology , Lymph Nodes , Pathology , Lymphatic Metastasis , Pathology , Multimodal Imaging , Neoplasm Staging , Methods , Positron-Emission Tomography , Preoperative Period , Retrospective Studies , Sensitivity and Specificity , Tomography, X-Ray Computed
12.
Article in Chinese | WPRIM | ID: wpr-431464

ABSTRACT

Chinese Society of Medical Science Research Administration Association has been established for 28 years.In order to make Chinese Society of Medical Science Research Administration Association better play the role,strengthen communication and guidance,the author made an investigation and analysis on Local Medical Association Medical Research Management special committee of current situation.With the increasing research investment from government,efficient research outputs need science research personnel and higher comprehensive quality of research and management personnel.Establish and improve local medical science research management special committee by means of positive organizational building and rich academic exchange and professional training to promote medical research management team construction.

13.
Article in Chinese | WPRIM | ID: wpr-431467

ABSTRACT

Research collaboration and interdisciplinary integration is anecessary trend of the development of science and technology,and is especially true in biomedical field.This paper describes the interdisciplinary practice of the projects at Peking University Health Science Center in recent years.Problems and the efficiency of the management is also analysed.

14.
Zhonghua Nei Ke Za Zhi ; (12): 205-208, 2011.
Article in Chinese | WPRIM | ID: wpr-384294

ABSTRACT

Objective To analyze the disease spectrum of patients admitted to the General Internal Medicine Unit at Peking Union Medical College Hospital, which is the first academic division of general internal medicine in the department of medicine within Chinese medical colleges and universities, and the value of general internal medicine unit in comprehensive hospitals. Methods A retrospective data review of patients admitted to the General Internal Medicine Unit from 2004 to 2008 was conducted from hospital information system and partially by chart review manually. Analysis of disease spectrum was performed thereafter. Results A total of 2593 patients were included in our study. It consisted of 1075 men and 1518women, with an average age of 45.1 years old. Forty point three percent of these patients were from Beijing,the local city, and the remaining 59.7% were from outside of Beijing. Sixty-four point nine percent (1683/2593)of these patients did not have a clear diagnosis on admission, including 758 fever of unknown origin (FUO) cases and 925 non-FUO cases. The final diagnostic rate of the FUO cases was 89. 2% [676/758, with the first three leading causes as diseases of the musculoskeletal system and connective tissue (29. 8%), certain infectious and parasitic diseases(26.3%), and neoplasm (14. 5%)] . The final diagnostic rate of the 928 non-FUO cases was 86. 8%(803/925), with the first three leading causes as musculoskeletal system and connective tissue(24.9%), neoplasm (15.5%), and diseases of blood and blood-forming organs(11.4%). Despite most diagnoses fitting into the above categories, the array of diseases was broad with as many as 550 discharge diagnoses from 2004 to 2008. Conclusions During 2004 -2008, there was a high proportion of cases that presented to the General Internal Medicine Unit at Peking Union Medical College Hospital with an unclear diagnosis, and the spectrum of diseases diagnosed was very broad. This kind of patient admitting model might not only benefit patients with no clear admission diagnosis and patients with multidisciplinary medical problems for whom it is usually difficult to be admitted by a specialty unit, but would also benefit medical students and residents by providing a good clinical medicine teaching base. These features show the value of general internal unit in comprehensive hospitals.

15.
Article in Chinese | WPRIM | ID: wpr-389763

ABSTRACT

Objective To evaluate diagnostic accuracy based on patient history and physical examinations in medical outpatients.Methods Totally, 145 consecutive patients visiting general internal medicine clinic at a university-affiliated teaching hospital during October 10 to 17, 2008 were recruited into the study and followed-up for 12 months.Results Eighteen of 145 patients ( 12.4% ) were lost to followup.Diagnosis was confirmed by follow-up for 45 ( 35.4% ) of those with medically unexplained symptoms (MUS).Sensitivity of physical diagnosis for those with MUS was 82.2 percent, with specificity of 95.1 percent, likelihood ratios of positive and negative results of 16.9 percent and 0.19 percent, its positive and negative prediction values of 90.2 percent and 90.7 percent, and overall accuracy of 90.6 percent,respectively.Conclusions MUS was common in medical clinical practice.Preliminary diagnosis for MUS based on patient history and physical examinations has been proved remarkably reliable.Carefully selected auxiliary laboratory evaluation combined with physical diagnosis is important for management of MUS.

16.
Article in Chinese | WPRIM | ID: wpr-391092

ABSTRACT

Objective To quantitatively evaluate relative contribution of medical history,physical examination and laboratory investigation to diagnoses for medical outpatients.Methods In total,145 medical visitors to the outpatient department of Peking Union Medical College Hospital (PUMCH) during October 10 to 16,2008 were recruited and followed-up for 12 months.Results Nineteen of 145 visitors (13.1%) were lost during the period of follow-up and diagnoses were established for 86 of them (68.3%)finally with medical history and for 20 (15.9%) with physical examination or laboratory investigation,respectively.Confidence index of internists in their correct diagnosis increased to 7.3 with medical history and to 7.9 and 8.7 with physical examination and laboratory investigation in average,respectively.Conclusions Most visitors to internal medicine department could be diagnosed correctly with medical history only.On the basis of physical diagnosis,selection of adequate laboratory investigation for them is critical to improvement of clinical diagnosis.

17.
Article in Chinese | WPRIM | ID: wpr-396914

ABSTRACT

Department of General Internal Medicine (DGIM) in the Peking Union Medical College (PUMC) Hospital is the first academic general internal medicine division in teaching hospitals in China. We attempted to construct DGIM teaching base in 2005, and the teaching reform was conducted in a part of the students. Primary assessment was based on examinations and questionnaires. The results show that the students could not only master the basic medical knowledge, but also improve overall capability. We conclude that DGIM in teaching hospital would become an important teaching base in China.

18.
Article in Chinese | WPRIM | ID: wpr-587052

ABSTRACT

Objective To investigate the prevalence of gout and its associated factors in populations in Beijing. Methods A cross-sectional study of gout was carried out in state-employees who had yearly health examination at Peking Union Medical College Hospital in Beijing,China from September to December 2005. The prevalence of gout was calculated in the population. Data were further analyzed by multivariate logistic regression models to find associated factors of gout. Results The prevalence of gout in the population was 1.0%,and were 1.5% and 0.3% for men and women respectively. Bivariate and multivariate logistic regression analysis found that male gender (OR 15.07,95%CI 1.79~127.19),hard liquor (OR 4.93,95%CI 1.41~17.31 for ≥7 beverages per week),diuretics (OR 6.72,95%CI 2.34~19.34),waist obesity (OR 4.38,95%CI 1.33~14.43),and hypercholesterolemia (OR 3.63,95%CI 1.23~10.67 for serum cholesterol 5.17~6.21mmol/L) were associated with increased prevalence of gout,whereas products of bean curd (OR 0.21,95%CI 0.07~0.59) were associated with reduced prevalence of gout. Conclusion Male gender,hard liquor,diuretics,waist obesity and hyperchol-esterolemia may be associated with the increased risk of gout,whereas products of bean curd may be associated with the reduced risk of gout.

19.
Article in Chinese | WPRIM | ID: wpr-525267

ABSTRACT

Objective This study was to investigate the relationship between the activities of thymidine phosphorylase (TP) and dihydropyrimidine dehydrogenase (DPD) and clinicopathological parameters in human colorectal cancer,and the relationship between TP and/or DPD activity in tumor tissue and efficiency of chemotherapy. MethodsSixty-eight patients undergoing surgery for primary colorectal cancer were enrolled including 40 patients receiving postoperative adjuvant chemotherapy with 5-FU plus leucovorin(de Gramont regimen). The activities of TP and DPD both in tumor tissue and in normal tissue were determined by enzyme-linked immunosorbent assay(ELISA). Results The TP activity was significantly higher in tumor than in normal tissues(P

20.
Article in Chinese | WPRIM | ID: wpr-525024

ABSTRACT

Objective To explore the mechanism of HPV infection in carcinogenesis and progression of colon cancer. Methods Human colon cancer cells, HCT116 (with wild-type p53) and SW480 (with mutant-type p53), were transfected by HPV16 E6E7 oncogenes using a recombinant adeno-associated virus vector system. The transfection efficiency was determined by flow cytometry. The expression of HPV16 E6 genes was determined by Western blot. The cell proliferation and cell cycle was studied by MTT method and flow cytometry. Results Western blot confirmed the expression of E6 gene in colon cells that were infected by rAAV-E6E7. The population doubling time of HCT116 cell, which was more than 48 hours at control group, decreased to 33 hours. HPV16 E6E7 increased cell percentage of S phase and decreased cell percentage of G0/G1. The population doubling time of SW480 cell was 77.06% decreased and the OD540 was 47.18% increased with interference of HPV16 E6E7 gene. Conclusion HPV16 E6E7 oncogene precipitates the proliferation and positively controls cell cycle of HCT116 and SW480 human colon cancer cells. HPV infection may closely relate to the carcinogenesis and progression of colon cancer.

SELECTION OF CITATIONS
SEARCH DETAIL