Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 7 de 7
Filter
Add filters








Language
Year range
1.
Article in Chinese | WPRIM | ID: wpr-933905

ABSTRACT

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

2.
Article in Chinese | WPRIM | ID: wpr-756119

ABSTRACT

We reported a case of monochorionic monoamniotic twins discordant for anencephaly diagnosed by second-trimester ultrasonography at the First Affiliated Hospital of Fujian Medical University.Ultrasound at seven weeks of gestation showed only one gestational sac with an embryo inside.Another 12 gestational weeks' ultrasound scan performed at another hospital found one gestational sac and one fetus (crown-rump length was 6.11 cm and nuchal translucency was 0.11 cm) in the upper-middle uterine cavity.The ultrasound examination at 22+6 gestational weeks identified one placenta and two fetuses without obvious diaphragm echo in between.Although no structural abnormality was observed in one fetus,frog-like eyes,absence of skull image and brain tissue echo were presented in the other fetus.The patient was transferred to a higher level hospital and was successfully performed radiofrequency ablation for selective reduction at 23+4 weeks of gestation.At 35 weeks,a premature live boy and an anencephalic stillbirth fetus were born vaginally after premature rupture of membranes.The baby boy was healthy at follow-up at four months old.

3.
Article in Chinese | WPRIM | ID: wpr-756157

ABSTRACT

We reported a case diagnosed with meningeal cysts complicated with tethered cord syndrome based on prenatal ultrasound images at 37+5 gestational weeks, which also showed horseshoe kidney and intrahepatic vascular abnormalities (arteriovenous fistula) in the fetus. The gravida had a precipitate delivery at 39+4 gestational weeks. The anus of this newborn was about 1 cm in front of the normal position. Intrahepatic arteriovenous fistula and horseshoe kidney were detected by neonatal ultrasound and CT scan, and spinal cystic occupying lesion was found by lumbar-sacrum MRI. Intraspinal tumors were removed through spinal canal exploration and spinal cord tumor resection and were confirmed as ependymal cysts by pathological analysis, which was consistent with the prenatal diagnosis. Postoperative changes of lumbar spine was reported by CT scan after the operation. The baby received successful anoplasty when five months old and no abnormal growth or development were found when followed up to one year and eight months old. Raising awareness of tethered cord syndrome can help reduce missed diagnosis and misdiagnosis.

4.
Article in Chinese | WPRIM | ID: wpr-443189

ABSTRACT

Objective To study the outcome of fetoscopic laser photocoagulation (laser) in the management of monochorionic diamniotic twin (MCDA) pregnancies complicated with selective intra-uterine growth restriction (sIUGR).Methods Retrospective analysis of 5 MCDA twin pregnancies with sIUGR treated by laser.Results All 5 cases were sIUGR type Ⅱ.In all 5 cases,the growth restriction was associated with oligohydamnios,and the umbilical cord had marginal insertion to the placenta.Abnormal Doppler flow pattern of the ductus venosus was present in 3 cases.Indication for laser therapy was beause of high risk of deterioration and fetal demise of the growth restricted fetus.In all cases,fetal reduction as an alternative was discussed and was refused.The median gestation at laser was 19 weeks.The procedure was successful in all cases,with complete seperation of the vascular anastomoses.There was no case of immediate postoperative complications.Fetal karyotype was normal in all cases.Fetal death of the small twin occurs in all cases within two weeks after surgery.Follow up studies of the surviving twin in all cases showed normal fetal growth,amniotic fluid volume,and middle cerebral artery peak systolic velocity.All cases resulted in preterm labor,with a median gestational age of 32 weeks (30+3 weeks to 34 weeks),and a median birth weight of 1 540 g (1 100-2 080 g) ; the postoperative fetal survival rate was 5/10,with at least one child survival rate of 5/5.There was no neonatal complication in the survival twins.Postnatal pathological examination of the placenta confirmed MCDA twin in all cases.Conclusions Laser treatment of MCDA twin complicated with sIUGR is effective.It protects the normal fetus even when the growth restricted twin died.However,the intention to give a small chance of survival to the growth restricted fetus by avoiding fetal redution procedure was not successful.All of the sIUGR fetuses died due to placental insufficicent.This fact is important during the pre-treatment counselling to avoid unrealistic expectation.

5.
Article in Chinese | WPRIM | ID: wpr-462380

ABSTRACT

Objective To investigate the method for the normal three‐dimensional ultrasound imaging and the characteristics of the fetal hard palate .Methods 210 single fetus free of deformity were examined using three‐dimensional ultrasound(3DUS) .Offline analysis was made after reconstruction ,the hard palate was observed and the width was measured .Results With reconstruction ,the fetal palate was clearly displayed 1.97 cases in 210 cases were successfully displayed (93 8.% ) .The front palate and both frontalis processus of maxillary bone composed similar triangular structure in the coronal plane .The retral part showed sustained linear hyperechoic and the radian increased along with the gestational age .Early palate showed flaky hyperechoic in the cross section and it became horse‐shoe shaped in the second or third trimester pregnancy surrounded by alveolar bone .Linear regression yielded the following formula for the hard palate width (PW) according to gestational age (GA):PW= -0 5.47+0 0.13 × GA( r =0 9.82 ,P <0 0.01) .Conclusions 3DUS acquired palate images fast and easily .The hard palate in the coronal ,sagittal and cross plane showed obvious characteristic images in different gestational stages .With increasing gestational age ,the curvature ,width ,trend and the contrast with the surrounding tissue had the corresponding changes . The successful three‐dimensional image reconstruction of the postnasal triangle and the retral part of fetal hard palate would have an important significance in terms of assessing its continuity and integrity .

6.
Article in Chinese | WPRIM | ID: wpr-399146

ABSTRACT

Objective To investigate the character of real-time gray-scale contrast-enhanced ultrasonography (CEUS) and its clinical value in diagnosing hepatic focal lesion. Methods One hundred and three patients with 142 focal hepatic lesions were examined by CEUS after an intravenous administration of the contrast agent, then the characters of the images were analyzed. Results The initial contrast-enhanced signal patterns were classified into 5 modes, peak contrast-enhanced signal patterns into 4 modes, and contrast agent perfusion patterns into 7 modes. Different lesions had different characters of contrast-enhanced phases. The accuracy rate of the CEUS in diagnosing focal hepatic lesion was 93.0%. which was significantly higher than that of conventional ultrasound and contrast-enhanced CT (X2=47.430, P<0.05). Conclusions The characteristic initial contrast-enhanced pattern and contrast agent perfusion pattern are helpful in the differential diagnosis of hepatic focal lesion, while peak contrast-enhanced signal pattern is relatively unreliable. Compared with conventional ultrasound and contrast-enhanced CT, CEUS can dramatically improve the accuracy of qualitative diagnosis of hepatic focal lesion.

7.
Journal of Chinese Physician ; (12): 466-469, 2008.
Article in Chinese | WPRIM | ID: wpr-400962

ABSTRACT

Objective To observe the changes of the endothelium-dependent vasodilatation(EDF)and serum vascular endothelial growth factor(VEGF)in the patients with impaired glucose tolerance(IGT)and type 2 diabetes mellitus(DM).Methods 30 IGT patients,30 type 2 DM patients and 33 normal subjects were divided into3 groups. Fasting glucose(FPG),fasting insulin(FINS),serum superoxide dismutase(SOD),maleie. dialdehyde(MDA)and VEGF were measured after 12 hours overnight fast. Oral 75g glucose tolerance test(OGTT)was performed. The inner diameter of braehial artery was assessed by a high resolution ultrasound system before and after reactive hyperemia. EDF was calculated as the percent change in brachial artery diameter 1 minute after reactive hyperemia compared with baseline. Results In the IGT group and DM group, EDF was significantly lower than that in NGT group(both P<0.01),and EDF in the DM group was significantly lower than that in the IGT group(P<0.01).SOD in the IGT group and DM group were significantly lower than that in the NGT group(both P<0.01),but MDA in reverse(both P<0.01).Compared with the IGT group, SOD in DM group was significantly lower(P<0.01),but MDA was significantly higher(P<0.01).VEGF was progressively increased in the NGT,IGT, DM groups. The difference between the two groups was significant(both P<0.01).Stepwise regression analysis showed that EDF was positively related to SOD(r=0.418,P<0.01,n=93),and negatively related to HOMA-IR and VEGF(r=-0.553,-0.221,both P<0.01,n=93).VEGF was negatively related to SOD(r=-0.552,P<0.01,n=93).Conclusion EDF is impaired in IGT patients while the impairment in DM patients becomes more marked. Insulin resistance, VEGF,SOD and MDA are closely related to the impairment of EDF in IGT and type 2 DM.

SELECTION OF CITATIONS
SEARCH DETAIL