Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 6 de 6
Filter
1.
Indian J Exp Biol ; 2016 Sept; 54(9): 597-605
Article in English | IMSEAR | ID: sea-178808

ABSTRACT

Quantitative real-time PCR (qRT-PCR), used to determine the gene expression profile, is an important tool in functional genomic research, including fishes. To obtain more robust and meaningful result, the best possible normalization of the data is of utmost significance. In the present study, we have evaluated the potential of five commonly used housekeeping genes i.e., elongation factor 1-α (EF1A), β-Actin (ACTB), 18S ribosomal RNA (18S), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-2-Microglobulin (B2M) in normal physiological conditions, developmental stages and in response to bacterial infection in Asian seabass, Lates calcarifer (Bloch), an important food fish cultured in the Asia-Pacific region. The expression levels of these five genes were estimated in 11 tissues of normal seabass juveniles, 14 embryonic and larval developmental stages and six tissues of Vibrio alginolyticus-challenged animals. Further, the expression stability of these genes was calculated based on three algorithms i.e. geNorm, NormFinder and BestKeeper. The results showed that although there are tissue-specific variations for each gene, ACTB and EF1A are the most stable genes across the tissues of normal animals. However, in bacteria-challenged animals, EF1A and 18S were found to be the best reference genes for data normalization. The expression of all the genes tested showed an increasing trend in developmental stages and the increase was significant at blastula stage. Among the five genes tested, EF1A and ACTB were found to be the genes with least variation and highest stability across the developmental stages. This forms the first report on validation of housekeeping genes in L. calcarifer, in the context of ontogenic development and in response to infection.

2.
Br J Med Med Res ; 2014 June; 4(17): 3283-3292
Article in English | IMSEAR | ID: sea-175257

ABSTRACT

Objectives: To evaluate the role of placental leucine aminopeptidase (P-LAP) in miscarriage and searching to select the gene of this enzyme in miscarriage to exclude direct or indirect effects of abortion. Methods: Total RNA is purified from the fresh placental tissue sample according to the protocol of the QIAamp®RNA Tissues Mini Kit (Qiagen). The sample is visualized by 0.7% agrose gel containing. Total RNA is reverse-transcribed RT-PCR carried out on the previously extracted RNA samples using (QIAGEN One Step RT –PCR Kit). Aliquots (1ml) of RT reaction samples are amplified by PCR, the PCR products (10μl) per lane are resolved by using electrophoresis on 2.0% agrose gel .Later the product is detected and examined under UV transiluminator. Results: The obtained results indicate that there is an expression of P-LAP mRNAs in placentas of normal pregnancy women (28±SE0.45) and there is a decrease in miscarriage. Furthermore, there is a difference between single miscarriage and those with recurrent miscarriage, the mean values in single miscarriage (1st and 2nd) are (16.1%±SE0.84) and (13%±SE0.24) respectively while the mean values in recurrent miscarriage (1st and 2nd) are (12%±SE0.19) and (9%±SE0.52) respectively. The expression of P-LAP is significantly lower (p=0.05) in miscarriage and highly significant decrease in recurrent than in single miscarriage women. Conclusion: The decrease of P-LAP mRNA levels in miscarriage placentas could be a sign that p-LAP function is an important step in pregnancy regulation.

3.
Chinese Journal of Pharmacology and Toxicology ; (6): 296-301, 2014.
Article in Chinese | WPRIM | ID: wpr-445803

ABSTRACT

OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.

4.
Biomedical and Environmental Sciences ; (12): 17-26, 2014.
Article in English | WPRIM | ID: wpr-247091

ABSTRACT

<p><b>OBJECTIVE</b>To study the effect of spleen lymphocytes on the splenomegaly by hepatocellular carcinoma-bearing mouse model.</p><p><b>METHODS</b>Cell counts, cell cycle distribution, the percentage of lymphocytes subsets and the levels of IL-2 were measured, and two-dimensional gel electrophoresis (2-DE) was used to investigate the relationship between spleen lymphocytes and splenomegaly in hepatocellular carcinoma-bearing mice.</p><p><b>RESULTS</b>Compared with the normal group, the thymus was obviously atrophied and the spleen was significantly enlarged in the tumor-bearing group. Correlation study showed that the number of whole spleen cells was positively correlated with the splenic index. The cell diameter and cell-cycle phase distribution of splenocytes in the tumor-bearing group showed no significant difference compared to the normal group. The percentage of CD3+ T lymphocytes and CD8+ T lymphocytes in spleen and peripheral blood of tumor-bearing mice were substantially higher than that in the normal mice. Meanwhile, the IL-2 level was also higher in the tumor-bearing group than in the normal group. Furthermore, two dysregulated protein, β-actin and S100-A9 were identified in spleen lymphocytes from H22-bearing mice, which were closely related to cellular motility.</p><p><b>CONCLUSION</b>It is suggested that dysregulated β-actin and S100-A9 can result in recirculating T lymphocytes trapped in the spleen, which may explain the underlying cause of splenomegaly in H22-bearing mice.</p>


Subject(s)
Animals , Female , Mice , Carcinoma, Hepatocellular , Cell Cycle , Liver Neoplasms , Lymphocytes , Physiology , Mice, Inbred ICR , Neoplasms, Experimental , Therapeutics , Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization , Spleen , Cell Biology , Pathology , Splenomegaly , Therapeutics , Thymus Gland
5.
Chinese Journal of Endocrine Surgery ; (6): 29-32, 2014.
Article in Chinese | WPRIM | ID: wpr-622061

ABSTRACT

Objective To investigate different methods in parathyroid adenoma tissue storage and to provide theoretical support for standardized construction of parathyroid adenoma tissue data.Methods 22 samples of sporadic parathyroid adenoma in Beijing Union Hospital from Aug.2010 to Nov.2011 were collected.All cases obtained pathological diagnosis,among which 11 were kept in frozen nitrogen (group A)and the rest in RNAlater(group B).The ratio of OD 260/280 was measured by ultraviolet spectrophotometer.The integrity of RNA was examined by gel electrophoresis.The expression of β-actin was measured by Realtime-PCR technique.Results RNAlater group had no advantage than frozen nitrogen group in terms of the purity,concentration,and integrity of the extracted RNA(P >0.05),but had a higher expression level of the β-actin(P <0.05).Conclusion The method of RNAlater has no significant advantages compared with frozen nitrogen in terms of RNA prevention and RNA degradation,but is more effective in longer storage of samples.

6.
Chinese Journal of Immunology ; (12): 210-213, 2010.
Article in Chinese | WPRIM | ID: wpr-403261

ABSTRACT

Objective:To investigate the effect of interleukin-1β (IL-1β) on epithelial-mesenchymal transition (EMT) and cytoskeleton rearrangement of renal tubular epithelial cells.Methods:Immortalized renal tubular epithelial cell line NRK52E was cultured in vitro with IL-1β (30 μg/L) for 3 days and 6 days,then the cell morphology was observed;The mRNA expressions of α-smooth muscle actin (α-SMA),cytoskeleton components β-actin and α-tubulin were semi-quantitative examined by RT-PCR.The protein expression of α-SMA and arrangements of β-actin and α-tubulin were assessed by immunofluorescent staining.Results:After induced by IL-1β for 3 days and 6 days in vitro,the mRNA and protein expression of α-SMA increased significantly compared with corresponding control cells (P<0.001),it prompted that NRK52E cells underwent EMT;At the same time,the cell morphology also changed,from a typical multilateral paving stone to fibroblast-like appearance,with multiple processes; Cytoskeletal protein β-actin mRNA expression was also slightly increased (P<0.05).The distributions and arrangements of β-actin protein were also changed,from cell membrane transferred to peri-nucleus and cytoplasm,moreover it formed fiber bundle-like structures.However,another cytoskeleton protein α-tubulin in IL-1β induced cells,neither it's mRNA expression nor it's distribution had significant differences compared with the control group.Conclusion:IL-1β can induce NRK52E cells undergoing EMT in vitro,cell morphology changes into fibroblast-like appearance with multiple processes,and also the cytoskeleton protein β-actin expression increases and rearrangement occurrs.However,there was no changes onα-tubulin.

SELECTION OF CITATIONS
SEARCH DETAIL