TIPS en pacientes cirróticos con trombosis venosa portal: una revisión de la literatura / TIPS in cirrhotic patients with portal vein thrombosis: A review of the literature

En los últimos años, la trombosis de la vena porta entre los pacientes cirróticos se ha comportado como una entidad reconocida y cada vez más estudiada, no solo por su creciente incidencia, sino por la asociación con gravedad y mal pronóstico en cirrosis. Asimismo, se hacen objeto de estudio las terapias disponibles para el manejo tanto médico como quirúrgico de estos pacientes, lo que ha dado un papel importante a la derivación portosistémica transyugular intrahepática (TIPS). El uso de TIPS en esta población se posiciona como una alternativa de manejo aceptable, no solo por brindar mejoría en las complicaciones derivadas de la hipertensión portal, sino también por sus resultados prometedores en diferentes estudios sobre el flujo y la recanalización portal, y por su perfil de seguridad. Sin embargo, la eficacia, los efectos adversos a largo plazo y el pronóstico de dicha intervención en la compleja fisiopatología de la cirrosis deben continuar en estudio. El objetivo de este artículo es revisar los avances del uso de TIPS en el manejo de pacientes con cirrosis hepática y trombosis portal.

In recent years, portal vein thrombosis among cirrhotic patients has been a well-recognized and continuously studied entity, not only because of its increasing incidence but also because of its association with severity and poor prognosis in cirrhosis. Likewise, therapies available for both medical and surgical management in these patients are being studied, which has given an important role to the transjugular intrahepatic portosystemic shunt (TIPS). The use of TIPS in this population is positioned as an acceptable management alternative, not only because it provides improvement in complications derived from portal hypertension, but also because of its promising results in different studies on portal flow and recanalization upgrade, and for its safety. However, the efficacy, long-term adverse effects, and prognosis of this intervention in the complex pathophysiology of cirrhosis must continue to be studied. The objective of this article is to review the advances in the use of TIPS in the management of patients with liver cirrhosis and portal vein thrombosis.

Research progress in perioperative management of portal vein thrombosis in liver transplantation / 器官移植

Portal vein thrombosis is one of the common complications of liver cirrhosis. The incidence of portal vein thrombosis is increased with the progression of diseases. The incidence and progression of portal vein thrombosis are associated with multiple factors. The indications of anticoagulant therapy remain to be investigated. At present, portal vein thrombosis is no longer considered as a contraindication for liver transplantation. Nevertheless, complicated portal vein thrombosis will increase perioperative risk of liver transplantation. How to restore the blood flow of portal vein system is a challenge for surgical decision-making in clinical practice. Rational preoperative typing, surgical planning and portal vein reconstruction are the keys to ensure favorable long-term prognosis of liver transplant recipients. In this article, epidemiological status, risk factors, typing and identification of portal vein thrombosis, preoperative and intraoperative management of portal vein thrombosis in liver transplantation, and the impact of portal vein thrombosis on the outcomes of liver transplantation were reviewed, aiming to provide reference for perioperative management of portal vein thrombosis throughout liver transplantation.

Carcinoma de vías biliares intrahepáticas: análisis de defunciones según sexo, grupo etario y regiones en Chile entre 2017-2021 / Intrahepatic bile duct carcinoma: analysis of deaths according to sex, age group, and regions in Chile between 2017-2021

Introducción: el colangiocarcinoma intrahepático es un cáncer agresivo de células epiteliales de los conductos biliares intrahepáticos y su desarrollo se asocia a inflamación crónica del árbol biliar. En Chile, su epidemiología es limitada y el presente estudio tiene por objetivo describir su tasa de mortalidad. Métodos: se realizó un estudio descriptivo observacional transversal y ecológico de las defunciones por carcinoma de vías biliares en Chile durante 2017 y 2021 según sexo, grupo etario y región de residencia. Resultados: la tasa de mortalidad nacional de personas mayores a 20 años durante el periodo estudiado fue de 1,56 por cada 100.000 habitantes. La tasa de mortalidad más alta del sexo masculino se observó en 2020, siendo de 2,61. La mayor mortalidad se encontró en personas mayores a 80 años en el sexo masculino con una tasa de 24,38. A nivel regional, en Magallanes se observó la mayor tasa de mortalidad con 5,66, mientras que Tarapacá presentó la menor tasa con un valor de 0,96. Finalmente, el índice de Swaroop fue igual o mayor al 92% en todas las regiones del país. Conclusión: la mayor mortalidad por colangiocarcinoma intrahepático se presenta en personas de edad avanzada y de sexo masculino. Interesantemente la mayor mortalidad por esta causa se concentra en la zona sur de Chile. Dada la magnitud del problema que representa esta enfermedad en la salud pública nacional es que futuros estudios son necesarios para establecer medidas de prevención y/o tratamiento de esta enfermedad.

Introduction: intrahepatic cholangiocarcinoma is an aggressive cancer of epithelial cells of the intrahepatic bile ducts, and its deve-lopment is associated with chronic inflammation of the biliary tree. In Chile, its epidemiology is limited, and the present study aims to describe its mortality rate. Methods: a descriptive, cross-sectional, observational, and ecological study of deaths from bile duct carcinoma in Chile between 2017 and 2021 was performed according to sex, age group, and region of residence. Results: the national mortality rate of people over 20 years old during the study period was 1.56 per 100,000 inhabitants. The highest mortality rate for the male sex was observed in 2020, with a value of 2.61. In turn, the highest mortality rate was found in people over 80 years old in the male sex, with a rate value of 24.38. On a regional level, Magallanes had the highest mortality rate, with a rate value of 5.66, while Tarapacá had the lowest rate, with a value of 0.96. Finally, Swaroop's index was equal to or greater than 92% in all regions of the country. Conclusion: the highest mortality from intrahepatic cholangiocarcinoma occurs in older people and males. Interestingly, the highest mortality from this cause is concentrated in the southern zone of Chile. Given the magnitude of the problem that this disease represents for national public health, future studies are necessary to establish both prevention measures and treatments

A Retrospective Analysis of Fetal and Maternal Outcome in Patients with Intrahepatic Cholestasis of Pregnancy

Background: Introduction: Intrahepatic cholestasis of pregnancy (ICP), is the most common liver disease specific to pregnancy. Previous studies of fetal effects have suggested that ICP is associated with a higher rate of adverse neonatal outcomes including preterm birth, neonatal respiratory distress syndrome (RDS), meconium-stained amniotic fluid, neonatal intensive care unit admission, and stillbirth. Material & Methods: This was a 4 year retrospective observational study including 43,344 female who delivered in our hospital out of which 1126 cases of ICP were identified, who were compared with 1136 age and parity matched controls. Results: : Previous history and family history of ICP was significant in the ICP group. Gestational diabetes and preterm labour were more frequent in the ICP group. Mean birth weight was lower in the ICP group, rate of small for gestational age foetuses was not significantly different. Cesearean section and post-partum haemorrhage was more frequent in the ICP group. Adverse neonatal outcomes i.e. respiratory distress syndrome (RDS) and need for NICU admission were more in the ICP group. Conclusion: ICP is associated with increased rate of preterm delivery, post-partum hemorrhage and increased neonatal morbidity. Management of patients with ICP should be individualized based on the severity of symptoms and associated medical complications.

Fístula arteriovenosa post-TIPS, un reto diagnóstico: reporte de caso / Post-TIPS arteriovenous fistula, a diagnostic challenge: case report

La hipertensión portal es una de las principales complicaciones de la cirrosis. El papel de la derivación portosistémica transyugular intrahepática (TIPS, por sus siglas en inglés), ha ganado aceptación como tratamiento efectivo en la hipertensión portal. En los últimos años su técnica se ha ido perfeccionando, disminuyendo la morbimortalidad relacionada con este procedimiento. Describimos un caso de un paciente masculino con cirrosis Child-Pugh 8 y MELD 16, con antecedente de descompensación por sangrado variceal recurrente y trombosis parcial de la vena porta, con un gradiente de presión venosa hepática (GPVH) de 20 mmHg, por lo que es llevado a TIPS como profilaxis secundaria, con un gradiente final post-TIPS de 6 mmHg. Posterior al procedimiento, presentó evolución tórpida con deterioro de las pruebas de bioquímica hepática. Se realizó una angiografía demostrando permeabilidad del TIPS sin progresión de la trombosis portal, y hallazgos anormales inespecíficos de la arteria hepática. Se decidió realizar una arteriografía selectiva, demostrando un pseudoaneurisma de la rama derecha de la arteria hepática y una fístula arteriovenosa de la arteria hepática a las colaterales portales. Se realizó embolización selectiva de la fístula con evolución satisfactoria del paciente.

Portal hypertension is a life-threatening complication of cirrhosis. The role of transyugular intrahepatic portosystemic shunt (TIPS) has gained acceptance as an effective treatment for portal hypertension. In the past few years, its technique has been improved, decreasing the mortality related with the procedure. We describe a case of a male with Child-Pugh 8 and MELD 16 cirrhosis, with previous decompensation of recurrent variceal bleeding and partial thrombosis of the portal vein. TIPS was performed due to a hepatic venous pressure gradient (HVPG) of 20 mmHg. The final measure showed HVPG of 6 mmHg. After the procedure, he presented a torpid evolution with deterioration of liver function tests. An angiography was performed demonstrating patency of the TIPS without progression of portal thrombosis and nonspecific abnormal findings of the hepatic artery. Selective arteriography was performed and revealed a pseudoaneurysm of the right branch of the hepatic artery and an arteriovenous fistula (AVF) from the hepatic artery to portal collaterals. Embolization was performed to treat the fistula with satisfactory evolution of the patient.

Alternativas de manejo intervencionista en el síndrome de Budd-Chiari. Serie de casos y revisión de la literatura / Interventional management alternatives in Budd-Chiari syndrome. Series of cases and review of the literature

La obstrucción en el tracto de salida del flujo venoso hepático, también conocida como síndrome de Budd-Chiari, es una condición infrecuente que causa congestión hepática, hipertensión portal, ne-crosis de los hepatocitos y, eventualmente, falla hepática aguda o crónica. Actualmente, el manejo de esta condición representa un reto para el médico, quien debe estar preparado para determinar la mejor alternativa entre las diferentes opciones terapéuticas disponibles. Este artículo pretende ilus-trar las alternativas del manejo intervencionista de esta enfermedad, a través de una serie de casos de pacientes tratados en el servicio de Radiología Intervencionista de un hospital de referencia de la ciudad de Medellín, entre 2011 y 2017.

Hepatic venous outflow tract obstruction, also known as Budd-Chiari syndrome, is a rare condition that causes hepatic congestion, portal hypertension, hepatocyte necrosis and eventually acute or chronic liver failure. Currently, the management of this condition represents a challenge for the physi-cian, who must be prepared to determine the best alternative among the different therapeutic options available. This article aims to illustrate the alternatives of interventional management of this disease, through a series of cases of patients treated in the Interventional Radiology service of a referral hos-pital in the city of Medellin, between 2011 and 2017.

Research progress of FAPI PET/CT in the diagnosis of malignant liver tumors / 中华肝脏病杂志

Malignant liver tumors have a high incidence and mortality rate. Therefore, it is of great significance to promptly learn about tumor advancement status through relevant examinations for patients' follow-up, diagnosis, and therapy as well as the improvement of the five-year survival rate. The primary lesions and intrahepatic metastases of malignant liver tumors have been better demonstrated in the clinical study with the use of various isotope-labeled fibroblast activating protein inhibitors because of their low uptake in liver tissues and high tumor/background ratio, which provides a new method for early diagnosis, precise staging, and radionuclide therapy. In light of this context, a review of the research progress of fibroblast-activating protein inhibitors for the diagnosis of liver malignant tumors is presented.

Factors influencing bilirubin elevation and its correlation with UGT1A1 gene polymorphism in the early postoperative period of transjugular intrahepatic portosystemic shunt / 中华肝脏病杂志

Objective: To investigate the factors influencing total bilirubin elevation and its correlation with UGT1A1 gene polymorphism in the early postoperative period of transjugular intrahepatic portosystemic shunt (TIPS). Methods: 104 cases with portal hypertension and esophageal variceal hemorrhage (EVB) treated with elective TIPS treatment were selected as the study subjects and were divided into a bilirubin-elevated group and a normal bilirubin group according to the total bilirubin elevation level during the early postoperative period. Univariate analysis and logistic regression were used to analyze the factors influencing total bilirubin elevation in the early postoperative period. PCR amplification and first-generation sequencing technology were used to detect the polymorphic loci of the UGT1A1 gene promoter TATA box, enhancer c.-3279 T > G, c.211G > A, and c.686C > A. Logistic regression was used to analyze the correlation of four locus alleles and genotypes with elevated total bilirubin in the early postoperative period. Results: Among the 104 cases, 47 patients were in the bilirubin elevated group, including 35 males (74.5%) and 12 females (25.5%), aged (50.72 ± 12.56) years. There were 57 cases in the normal bilirubin group, including 42 males (73.7%) and 15 females (26.3%), aged (51.63 ± 11.10) years. There was no statistically significant difference in age (t = -0.391, P = 0.697) and gender (χ(2) = 0.008, P = 0.928) between the two groups of patients. Univariate analysis revealed that preoperative alanine transaminase (ALT) level (χ(2) = 5.954, P = 0.015), total bilirubin level (χ(2) = 16.638, P < 0.001), MELD score (χ(2) = 10.054, P = 0.018), Child-Pugh score (χ(2) = 6.844, P = 0.022), and postoperative portal vein branch development (χ(2) = 6.738, P = 0.034) were statistically significantly different between the two groups. Logistic regression analysis showed that preoperative ALT level, total bilirubin level, and portal vein branch development after TIPS were correlated with the elevated total bilirubin in the early postoperative period. The polymorphism of the c.211G > A locus of the UGT1A1 gene correlation had elevated total bilirubin in the early postoperative period of TIPS. The risk of elevated total bilirubin was increased in the population carrying allele A (P = 0.001, OR = 4.049) in the early postoperative period. Allelic polymorphisms in the TATA box promoter region and enhancer c.-3279 T > G and c.686C > A had no statistically significant difference between the bilirubin-elevated group and the normal bilirubin group. Conclusion: The preoperative ALT level, total bilirubin level, and portal vein branch development are correlated with the elevated total bilirubin in early postoperative patients. The polymorphisms of the UGT1A1 gene and enhancer c.211G > A are correlated with the occurrence of elevated total bilirubin in the early postoperative period of TIPS. Allele A carrier may have a higher risk of elevated total bilirubin in the early postoperative period.

Efficacy and safety of radiotherapy combined with targeted therapy, immunotherapy and chemotherapy for unresectable intrahepatic cholangiocarcinoma / 中华放射医学与防护杂志

Objective:To evaluate the efficacy and safety of quadruple therapy involving radiotherapy (RT), lenvatinib, anti-PD-1 antibody and GEMOX (oxaliplatin and gemcitabine) chemotherapy (quadruple therapy) in treatment cohort of patients with unresectable intrahepatic cholangiocarcinoma (ICC).Methods:The patients with recurrent, metastatic, or unresectable ICC underwent quadruple therapy at Zhongshan Hospital, Fudan University between September 2018 and May 2022 were selected. The data about efficacy and safety of quadruple therapy were collected in the hospital electronic medical record system. All patients were followed up regularly to obtain the long-term prognostic data until December 31, 2022. The efficacy, prognosis, and toxicity data were collected and analyzed.Results:A total of 41 patients were included in the analysis. After a median follow-up period of 15 months, disease progression was diagnosed in 36 patients (18 patients died), while 3 patients were lost to follow-up. The causes of death included liver failure induced by intrahepatic tumor progression ( n=6), distant metastases (lungs or brain, n=6), abdominal lymph node metastases ( n=3), cancer cachexia ( n=2), and unknown cause ( n=1). The median progression-free survival (PFS) was 11 months (95% CI: 9.2-12.8), and the median overall survival (OS) was 35 months (95% CI: 17.0-52.0). All patients experienced treatment-related adverse events (AEs) during the study treatment period. Of the 41 patients, 13 patients experienced at least once grade 3 or worse treatment-related AE, but all were manageable with symptomatic treatment. No treatment-related deaths were reported during the follow-up period. Conclusions:Radiotherapy (RT), lenvatinib, anti-PD-1 antibody and GEMOX in the treatment of unresectable ICC shows significant efficacy and good safety, which is worthy of clinical application.

Influence of lymphadenectomy on efficacy of patients with intrahepatic cholangiocarcinoma at different locations / 中华消化外科杂志

Objective:To investigate the influence of lymphadenectomy on efficacy of patients with intrahepatic cholangiocarcinoma (ICC) at different locations.Methods:The retro-spective cohort study was conducted. The clinicopathological data of 123 patients with ICC who were admitted to the Affiliated Hospital of North Sichuan Medical College from January 2015 to January 2022 were collected. There were 78 males and 45 females, aged 55(rage, 50?60)years. All patients underwent radical resection. Observation indicators: (1) clinical characteristics of patients with ICC; (2) follow-up; (3) surgical situations in ICC patients with different number of lymph nodes dissected. Measurement data with normal distribution were represented as Mean± SD, and compari-son between groups was conducted using the independent sample t test. Measurement data with skewed distribution were represented as M(range), and comparison between groups was conducted using the Mann-Whitney U test. Count data were described as absolute numbers or percentages, and comparison between groups was conducted using the chi-square test. Kaplan-Meier method was used to draw survival curve and Log-Rank test was used for survival analysis. Results:(1) Clinical characteristics of patients with ICC. Of the 123 patients, 81 cases had peripheral ICC and 42 cases had central ICC. The albumin-bilirubin grade (grade 1, grade 2?3), preoperative lymph node metastasis risk assessment (low risk, high risk), the number of lymph nodes dissected (<6, ≥6), lymph node metastasis (positive, negative) were 57, 24, 51, 30, 49, 32, 15, 66 in patients with peripheral ICC, versus 19, 23, 17, 25, 14, 28, 16, 26 in patients with central ICC, showing significant differences in the above indicators between them ( χ2=7.40, 5.66, 8.17, 5.62, P<0.05). (2) Follow-up. All the 123 patients were followed up for 28(range, 21?38)months. The 3-year overall survival rate was 57.8% in the 81 patients with peripheral ICC, versus 32.3% in the 42 patients with central ICC, showing a significant difference between them ( χ2=5.98, P<0.05). Of the 42 patients with central ICC, there were 25 cases with high risk of lymph node metastasis before surgery and 17 cases with low risk of lymph node metastasis before surgery. Of the 25 central ICC patients with high risk of lymph node metastasis before surgery, the 3-year overall survival rate was 28.9% in the 18 cases with the number of lymph nodes dissected ≥6, versus 14.3% in the 7 cases with the number of lymph nodes dissected <6, showing a significant difference between them ( χ2=8.90, P<0.05). (3) Surgical situa-tions in patients with the different number of lymph nodes dissected. Of the 123 patients, cases with the number of lymph nodes dissected <6 and ≥6 were 63 and 60, and there was no significant difference in the operation time, intraoperative blood transfusion, postoperative complications, bile leakage, liver insufficiency, pulmonary infection, pleural effusion, abdominal effusion, or lymphatic leakage between them ( P>0.05). One patient might have multiple complications. Conclusions:The prognosis of patients with peripheral ICC is better than that of patients with central ICC. For patients with central ICC who are at high risk of lymph node metastasis before surgery, adequate lymph node dissection may result in a better prognosis.

Predictive value of controlled nutritional status score for overt hepatic encephalopathy after transjugular intrahepatic portosystemic stent-shunt of Budd-Chiari syndrome / 中华消化外科杂志

Objective:To investigate the predictive value of controlled nutritional status (CONUT) score for overt hepatic encephalopathy (OHE) after transjugular intrahepatic portosys-temic stent-shunt (TIPSS) in Budd-Chiari syndrome patients.Method:The retrospective case-control study was conducted. The clinicopathological data of 48 Budd-Chiari syndrome patients who underwent TIPSS in the First Affiliated Hospital of Zhengzhou University from August 2014 to March 2021 were collected. There were 26 males and 22 females, aged (46±13)years. Observation indicators: (1) surgical situations and follow-up; (2) analysis of influencing factors of OHE after TIPSS; (3) predic-tion of OHE after TIPSS. Measurement data with normal distribution were represented as Mean± SD, and comparison between groups was performed using the t test. Measurement data with skewed distribution were represented by M( Q1, Q3), and comparison between groups was performed using the Mann-Whitney U test. Count data were expressed as absolute numbers or percentages, and comparison between groups was performed using the chi-square test or Fisher exact probability. Multivariate analysis was performed using the Logistic regression model with forward method. The receiver operating characteristic (ROC) curve was drawn and the area under the curve (AUC) was calculated to evaluate the efficacy. Comparison among AUC was performed using the Delong test. Results:(1) Surgical situations and follow-up. All 48 patients underwent TIPSS successfully, and the operation time of the 48 patients was (131±29)minutes. All patients were implanted with 8 mm covered stent. All 48 patients were followed up for 46(25,71)months, and there were 14 cases with OHE and 34 cases without OHE after TIPSS. Of the 14 cases with OHE, 12 cases were evaluated as West-Haven Ⅱ grade and 2 cases were evaluated as West-Haven Ⅲ grade. (2) Analysis of influencing factors of OHE after TIPSS. Results of multivariate analysis showed that history of hepatic encephalo-pathy and CONUT score were independent factors influencing the incidence of OHE of Budd-Chiari syndrome patients who underwent TIPSS ( odds ratio=8.36, 1.74, 95% confidence interval as 1.02?68.75, 1.12?2.69, P<0.05). (3) Prediction of OHE after TIPSS. Results of ROC curve showed that the AUC of the CONUT score, the Child-Pugh score of liver function and the integrated model of end-stage liver disease (iMELD) score in predicting the incidence of OHE after TIPSS was 0.77(95% confidence interval as 0.64?0.91, P<0.05), 0.71(95% confidence interval as 0.56?0.87, P<0.05) and 0.71(95% confidence interval as 0.53?0.88, P<0.05), respectively, and there was no significant difference between the AUC of the CONUT score and the Child-Pugh score of liver function or the iMELD score ( Z=0.84, 0.59, P>0.05). The optimal cutoff value of CONUT score in predicting the incidence of OHE after TIPSS was 7, with the sensitivity, specificity and Yodon index as 78.6%, 61.8% and 0.40, respectively. Conclusion:The CONUT score can be used to predict the incidence of OHE in Budd-Chiari syndrome patients who underwent TIPSS, and the discrimination of CONUT score is equivalent to the Child-Pugh score of liver function and the iMELD score.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Research progress and prospect of surgical treatment of intrahepatic cholangiocarcinoma in the era of liver transplantation / 国际外科学杂志

The incidence of intrahepatic cholangiocarcinoma has been increasing worldwide in recent years. Hepatectomy is the first choice for surgical treatment of intrahepatic cholangiocarcinoma. However, due to high tumor invasion, early lymph node metastasis and other factors, only less than 30% of cases are resectable, and the overall prognosis of patients is very poor. Theoretically, liver transplantation can not only remove the tumor, but also replace the damaged liver. Therefore, many scholars have proposed liver transplantation for the treatment of intrahepatic cholangiocarcinoma in order to obtain better results. Intrahepatic cholangiocarcinoma was once listed as a contraindication of liver transplantation due to limited cases, tumor recurrence, and shortage of donors. However, with the optimization of recipient screening criteria and the development of neoadjuvant therapy, part of patients can also benefit from it, making liver transplantation a potential therapeutic strategy. Based on the literature review and the author′s experience, this article introduced the current situation of surgical treatment of intrahepatic cholangiocarcinoma, the comparison between hepatectomy and liver transplantation, the latest progress of liver transplantation treatment and the future challenges and solutions.

Effect and Mechanism of Osthole on Proliferation and Apoptosis in Human Intrahepatic Cholangiocarcinoma HuCCT1 Cells / 中国实验方剂学杂志

ObjectiveTo investigate the effect and mechanism of osthole on the proliferation and apoptosis in human intrahepatic cholangiocarcinoma HuCCT1 cells. MethodThe effect of 10， 20， 40， 80， and 120 μmol·L-1 osthole on the proliferation of HuCCT1 cells was detected by the cell counting kit-8 （CCK-8）. A blank group， and low-， medium-， and high-dose osthole groups （16， 32， and 64 μmol·L-1） were set up. The effect of osthole on cell clone formation rate was detected by colony formation assay. The effect of osthole on cell cycle and apoptosis was detected by flow cytometry. The effect of osthole on cell apoptotic morphology was detected by Hoechst 33342 fluorescent staining. The effect of osthole on cell cycle protein cyclin B1， proliferating cell nuclear antigen （PCNA）， cysteine-aspartic acid protease （Caspase）-9， Caspase-3， cleaved Caspase-9， cleaved Caspase-3， cleaved poly（ADP-ribose） polymerase （cleaved PARP）， B-cell lymphoma-2 （Bcl-2）， phosphorylated protein kinase B （p-Akt）， phosphorylated mammalian target of rapamycin （p-mTOR）， and phosphorylated ribosomal protein S6 （p-RPS6） was detected by Western blot. ResultThe cell viability in the osthole group（40，80，120 μmol·L-1） decreased （P<0.05，P<0.01）， with the half maximal inhibitory concentration （IC50） of 63.8 μmol·L-1 as compared with that in the blank group. Compared with the blank group， the osthole groups（32，64 μmol·L-1）showed reduced clone formation rate （P<0.01）， increased number of cells in the G2 phase （P<0.05，P<0.01）， decreased number of cells， increased pyknosis and fragmentation， increased apoptosis rate （P<0.05，P<0.01）， down-regulated expression of cyclin B1， PCNA， Bcl-2， Caspase-3， Caspase-9， p-Akt， p-mTOR， and p-RPS6 （P<0.05，P<0.01）， and up-regulated expression of cleaved Caspase-3， cleaved Caspase-9， and cleaved PARP （P<0.05，P<0.01）. ConclusionOsthole can inhibit the proliferation and promote the apoptosis of HuCCT1 cells， and its mechanism may be related to the Akt/mTOR signaling pathway.

Portal vein aneurysm after liver transplantation: report of two cases and literature review / 器官移植

Objective To summarize the diagnosis and treatment experience of portal vein aneurysm after liver transplantation. Methods Clinical data of two recipients with portal vein aneurysm after liver transplantation were retrospectively analyzed. Clinical features, diagnosis, treatment and prognosis were summarized based on literature review. Results Both two cases were diagnosed with intrahepatic portal vein aneurysm complicated with portal vein thrombosis and portal hypertension after liver transplantation. Case 1 was given with targeted conservative treatment and he refused to undergo liver retransplantation. Physical condition was worsened after discharge, and the patient eventually died from liver graft failure, kidney failure, lung infection, and septic shock. Case 2 received high-dose glucocorticoid pulse therapy, whereas liver function was not improved, and the patient was recovered successfully after secondary liver transplantation. Conclusions Long-term complication of portal vein aneurysm (especially intrahepatic type) after liver transplantation probably indicates poor prognosis. Correct understanding, intimate follow-up and active treatment should be conducted. Liver retransplantation may be a potential treatment regimen.

The mechanism research of Xiaoyan Lidan formula for the intervention of chronic intrahepatic cholestasis based on metabolomics combined with molecular docking analysis / 药学学报

In this study, the mechanism of Xiaoyan Lidan formula (XYLDF) against 3,5-diethoxycarbonyl-1,4-dihydro-2,4,6-collidine (DDC)-induced chronic intrahepatic cholestasis (CIHC) in mice was investigated based on metabolomics, molecular docking and pharmacological methods. In the pharmacodynamics study, a dosage of 5 g·kg-1 (clinical equivalent) XYLDF was administered in DDC-induced mice, then the effect of XYLDF against CIHC was evaluated by measuring the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (AKP) as well as total bilirubin (TBIL) in serum and observing liver histopathological changes. All experiments were approved by the Ethical Committee Experimental Animal Center of Guangzhou University of Chinese Medicine (ZYD-2021-001). The serum metabolites of mice in each group were detected and identified based on ultra-performance liquid chromatography quadrupole time-of-flight tandem mass spectrometry, and the relevant biological pathways and molecular key targets were further enriched. Molecular docking technology was used to further evaluate the binding activity of the main active ingredients of XYLDF with potential targets. Subsequently, the in vitro experiment was conducted for the validation of the vital target. The results showed that compared with the model group, XYLDF significantly decreased the levels of ALT, AST, AKP and TBIL in the serum of CIHC mice, as well as alleviated inflammatory infiltration and hepatocyte necrosis in liver tissue. According to the metabonomic study, a total of 35 differential metabolites was identified as biomarkers associated with cholestasis, 12 of which were significantly recovered by XYLDF treatment. These biomarkers were involved in the pathways of primary bile acid biosynthesis and linoleic metabolism, which are closely related to the mechanism of XYLDF against CIHC. Protein-protein interaction network indicated that cytochrome P450 3A4 (CYP3A4) and cytochrome P450 1A1 (CYP1A1) are significant potential targets with good binding properties with six major active ingredients of XYLDF. Furthermore, it was found that 4-methoxy-5-hydroxycanthin-6-one, dehydroandrographolide and isodocarpin, three of the main active components in XYLDF, markedly induced the expression of CYP3A4 mRNA in vitro. This study revealed that XYLDF mainly mediates the biosynthesis of bile acids in CIHC mice to improve liver tissue lesions and bile efflux disorders, among which, CYP3A4 is the key target in the protection of XYLDF against CIHC. This research provides a reference for further elucidation of the pharmacological mechanism of XYLDF.

Pharmaceutical care of patients with antithrombotic therapy after transjugular intrahepatic portal shunt / 中国临床药理学与治疗学

AIM: To explore the role of clinical pharmacist in the treatment of patients with transjugular intrahepatic portosystemic shunt. METHODS: Clinical pharmacist participated in the treatment of a patient with repeated oral bleeding after transjugular intrahepatic portal shunt followed treatment with multiple antithrombotic drugs, which assisted the physician to diagnose and adjust the antithrombotic treatment plan as well as provided the patient with whole-process pharmaceutical care and online management. RESULTS: Based on the inquiry about the patient's past and current medical history and medication consumption, the pharmacist considered that there was weak correlation between oral hemorrhage and antithrombotic drugs and advised for dentist inspection. Thereafter, the patient was diagnosed with chronic gingivitis. The dosage of warfarin was adjusted, and the pharmacists managed it online after discharge to achieve stable INR of the patient. In the later online follow-up, an abnormal increase of INR was encountered, By asking about the history of medication, it was considered that the increase in INR was related to taking amoxicillin capsules. Therefore, the pharmacist suggested to stop amoxicillin capsule and to gradually adjust the dose of warfarin to the original level to improve the treatment. CONCLUSION: The involvement of clinical pharmacists in clinical treatment facilitates comprehensive pharmaceutical care of patients, which plays a positive role in the efficacy and safety of medication therapy.

Effects and mechanism of Hugan buzure formula on intrahepatic cholestatic liver injury in rats / 中国药房

OBJECTIVE To study the effects of Hugan buzure formula （HBF） on intrahepatic cholestatic liver injury in rats and its potential mechanism. METHODS Rats were randomly divided into control group， model group， ursodeoxycholic acid （UDCA） group （positive control， 60 mg/kg ） and HBF low-dose， middle-dose and high-dose groups （HBF-L， HBF-M， HBF-H groups， 0.4， 0.8， 1.6 g/kg ）， with 6 rats in each group. The rats in each drug group were given the corresponding drug solution intragastrically， once a day， for 7 consecutive days. The rats in the control group and the model group were given equal volumes of water intragastrically. On the 5th day， except for the control group， the rats in other groups were single intragastrically administered with alpha-naphthyl isothiocyanate olive oil solution （100 mg/kg） to establish the model. After 48 h of modeling， the contents of liver function indexes （aspartate aminotransferase， alanine aminotransferase， alkaline phosphatase， total bile acid， total bilirubin， direct bilirubin） and oxidative stress indexes [malondialdehyde （MDA）， glutathione （GSH）， superoxide dismutase] in serum of rats were detected； the pathological changes of liver tissue were observed. The mRNA expressions of inflammation-related factors [tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）] and farnesoid X receptor （FXR） signaling pathway-related factors [FXR， small heterodimer partner （SHP）， multidrug resistance protein 2 （MRP2）， bile salt export pump （BSEP）， Na+-taurocholate cotransporting polypeptide （NTCP）， organic anion-transporting polypeptide 2 （OATP2） and cholesterol 7α-hydroxylase （CYP7A1）]， the expressions of FXR signaling pathway-related proteins （FXR， MRP2， BSEP， NTCP） and nuclear factor- κB p65 （NF- κB p65） in liver tissue were detected.RESULTS Compared with the model group， the contents of liver function indexes and the level of MDA in serum， the mRNA expressions of the above inflammation-related factors and CYP7A1， and the relative expression of NF-κB p65 in liver tissue were significantly decreased； the levels of GSH in serum， the mRNA expressions of FXR， SHP， MRP2， BSEP， NTCP and OATP2， and the relative expressions of FXR， MRP2， BSEP and NTCP in liver tissue were significantly increased （P＜0.05 or P＜0.01）； the pathological changes of liver tissue were significantly improved. Only some indexes in HBF-L group， HBF-M group and UDCA group were significantly reversed （P＜0.05 or P＜0.01）. CONCLUSIONS HBF can prevent intrahepatic cholestatic liver injury in rats， and the effects may be related to the activation of FXR signaling pathway and the reduction of inflammation and oxidative stress.

Prognostic Value of MRI Arterial-phase Enhancement Pattern in Intrahepatic Cholangiocarcinoma Patients / 中山大学学报(医学科学版)

ObjectiveTo investigate the prognostic value of the enhancement pattern in arterial phase of preoperative Gd-EOB-DTPA enhanced magnetic resonance imaging （MRI） in evaluating the disease-free survival （DFS） and overall survival （OS） in patients undergoing curative resection for intrahepatic cholangiocarcinoma （ICC）. MethodsA retrospective analysis was done on the clinical， preoperative MRI findings and postoperative follow-up results of 93 pathologically confirmed ICC patients undergoing surgery in our hospital between January 2018 and December 2021. Kaplan-Meier survival curves and log-rank test were used to compare the DFS and OS of three groups with different arterial enhancement patterns. Cox regression analysis was used to identify the factors affecting DFS and OS. ResultsThere were significant differences in DFS and OS among the 3 groups （log-rank test， P < 0.05）. The arterial enhancement pattern was an independent predictive factor for DFS （using diffuse hyperenhancement as a reference， peripheral rim enhancement： HR = 3.550； 95%CI： 1.16 ~ 10.8； P = 0.026；diffuse hypoenhancement： HR = 3.430； 95%CI： 1.04 ~ 11.3； P = 0.042）. The arterial enhancement pattern and tumor location were predictive factors for OS （（using diffuse hyperenhancement as a reference， diffuse hypoenhancement， HR = 8.500； 95%CI： 1.09-66.3； P = 0.041； using tumor distal location as a reference， tumor perihilar location HR=2.583，95%CI： 1.14-5.83， P =0.022）. The AUC of arterial enhancement patterns in predicting 1-， 2-， and 3- year DFS were 0.722， 0.748， and 0.617， respectively； in OS， 0.720， 0.704， and 0.730， respectively， which showed better prognostic efficacy than AJCC-TNM staging system. ConclusionArterial-phase enhancement pattern of preoperative Gd-EOB-DTPA enhanced MRI is an independent predictive factor for DFS and OS of ICC patients， with a better prognostic value than AJCC-TNM staging system， and can be used for the clinical management of ICC patients.

Progress on biliary flora and primary intrahepatic stone formation / 公共卫生与预防医学

Primary intrahepatic stone （PIS）is one of the intractable diseases in hepatobiliary surgery and an important cause of death from benign biliary tract diseases, and it has a high prevalence in the Yangtze River basin and southeastern coastal areas of China. At present, the mechanism of PIS occurrence has not been fully elucidated, but the role of biliary flora in the formation of PIS has been recognized by more and more studies. This article reviews the research progress of biliary flora in the formation of PIS with a view to strengthening the clinical understanding of mechanism of PIS, increasing the attention to the detection of biliary flora, and providing a reference for the prevention and treatment of PIS and the improvement of prognosis.