A Retrospective Analysis of Fetal and Maternal Outcome in Patients with Intrahepatic Cholestasis of Pregnancy

Background: Introduction: Intrahepatic cholestasis of pregnancy (ICP), is the most common liver disease specific to pregnancy. Previous studies of fetal effects have suggested that ICP is associated with a higher rate of adverse neonatal outcomes including preterm birth, neonatal respiratory distress syndrome (RDS), meconium-stained amniotic fluid, neonatal intensive care unit admission, and stillbirth. Material & Methods: This was a 4 year retrospective observational study including 43,344 female who delivered in our hospital out of which 1126 cases of ICP were identified, who were compared with 1136 age and parity matched controls. Results: : Previous history and family history of ICP was significant in the ICP group. Gestational diabetes and preterm labour were more frequent in the ICP group. Mean birth weight was lower in the ICP group, rate of small for gestational age foetuses was not significantly different. Cesearean section and post-partum haemorrhage was more frequent in the ICP group. Adverse neonatal outcomes i.e. respiratory distress syndrome (RDS) and need for NICU admission were more in the ICP group. Conclusion: ICP is associated with increased rate of preterm delivery, post-partum hemorrhage and increased neonatal morbidity. Management of patients with ICP should be individualized based on the severity of symptoms and associated medical complications.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

The mechanism research of Xiaoyan Lidan formula for the intervention of chronic intrahepatic cholestasis based on metabolomics combined with molecular docking analysis / 药学学报

In this study, the mechanism of Xiaoyan Lidan formula (XYLDF) against 3,5-diethoxycarbonyl-1,4-dihydro-2,4,6-collidine (DDC)-induced chronic intrahepatic cholestasis (CIHC) in mice was investigated based on metabolomics, molecular docking and pharmacological methods. In the pharmacodynamics study, a dosage of 5 g·kg-1 (clinical equivalent) XYLDF was administered in DDC-induced mice, then the effect of XYLDF against CIHC was evaluated by measuring the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (AKP) as well as total bilirubin (TBIL) in serum and observing liver histopathological changes. All experiments were approved by the Ethical Committee Experimental Animal Center of Guangzhou University of Chinese Medicine (ZYD-2021-001). The serum metabolites of mice in each group were detected and identified based on ultra-performance liquid chromatography quadrupole time-of-flight tandem mass spectrometry, and the relevant biological pathways and molecular key targets were further enriched. Molecular docking technology was used to further evaluate the binding activity of the main active ingredients of XYLDF with potential targets. Subsequently, the in vitro experiment was conducted for the validation of the vital target. The results showed that compared with the model group, XYLDF significantly decreased the levels of ALT, AST, AKP and TBIL in the serum of CIHC mice, as well as alleviated inflammatory infiltration and hepatocyte necrosis in liver tissue. According to the metabonomic study, a total of 35 differential metabolites was identified as biomarkers associated with cholestasis, 12 of which were significantly recovered by XYLDF treatment. These biomarkers were involved in the pathways of primary bile acid biosynthesis and linoleic metabolism, which are closely related to the mechanism of XYLDF against CIHC. Protein-protein interaction network indicated that cytochrome P450 3A4 (CYP3A4) and cytochrome P450 1A1 (CYP1A1) are significant potential targets with good binding properties with six major active ingredients of XYLDF. Furthermore, it was found that 4-methoxy-5-hydroxycanthin-6-one, dehydroandrographolide and isodocarpin, three of the main active components in XYLDF, markedly induced the expression of CYP3A4 mRNA in vitro. This study revealed that XYLDF mainly mediates the biosynthesis of bile acids in CIHC mice to improve liver tissue lesions and bile efflux disorders, among which, CYP3A4 is the key target in the protection of XYLDF against CIHC. This research provides a reference for further elucidation of the pharmacological mechanism of XYLDF.

Efficacy of fetal left ventricular modified myocardial performance index in predicting adverse perinatal outcomes in intrahepatic cholestasis of pregnancy

SUMMARY OBJECTIVE: This study aimed to evaluate the effectiveness of fetal left ventricular modified myocardial performance index in predicting adverse perinatal outcomes for intrahepatic cholestasis of pregnancy. METHODS: A cross-sectional study was conducted, including 51 women with intrahepatic cholestasis of pregnancy and 80 healthy controls. Using Doppler ultrasonography, E-wave, A-wave, isovolumetric contraction time, isovolumetric relaxation time, and ejection time were recorded and the left ventricular modified myocardial performance index was measured. RESULTS: Findings showed that the mean left ventricular modified myocardial performance index, isovolumetric contraction time, and isovolumetric relaxation time values were statistically significantly higher while the ejection time and E/A ratios were statistically significantly lower in the intrahepatic cholestasis of pregnancy group than the control group. In the intrahepatic cholestasis of pregnancy group, a statistically significant positive correlation was found between left ventricular modified myocardial performance index and adverse perinatal outcomes in the intrahepatic cholestasis of pregnancy group (r=0.478, p<0.001), while a statistically significant negative correlation was found between the E/A ratio and adverse perinatal outcomes (r=-0.701, p<0.001). CONCLUSIONS: For intrahepatic cholestasis of pregnancy cases, high fetal left ventricular modified myocardial performance index values were an indicator of ventricular dysfunction, and this correlated with negative perinatal outcomes.

Screening strategy and genetic mutation analysis of citrin deficiency among newborns in Xuzhou / 中国新生儿科杂志

Objective:To study the incidence, clinical features and genetic mutation profiles of neonatal intrahepatic cholestasis caused by citrin deficiency (NICCD) using screening strategy.Methods:From September 2015 to September 2020, neonates in Xuzhou area were prospectively screened for genetic metabolic diseases using tandem mass spectrometry. Suspected infants were further confirmed using urinary organic acid test and SLC25A13 gene mutation analysis. The clinical manifestations, biochemical and gene mutation results, treatment and prognosis of the confirmed cases were analyzed.Results:A total of 468,494 live-birth newborns were screened with 112 cases suspected and 95 cases received urinary organic acid test and SLC25A13 gene mutation analysis. 13 cases of NICCD were diagnosed with a prevalence of 1/36,038. Most confirmed cases presented with delayed disappearance of neonatal jaundice, feeding difficulties and poor weight gain. Biochemical changes included increased bile acid, abnormal liver enzymes, increased alpha-fetoprotein, hypoglycemia, decreased hemoglobin, abnormal coagulation function and increased blood ammonia. Tandem mass spectrometry showed increased citrulline, methionine, arginine, tyrosine and phenylalanine, and in some cases with slightly increased acylcarnitine. Urine organic acid analysis mainly showed increased 4-hydroxyphenyllactic acid and 4-hydroxyphenylpyruvate. All confirmed cases received genetic mutation tests and a total of 13 mutation loci were detected, including c.852_855delTATG, c.511dupG, c.1638_1660dup, IVS16ins3kb, c.1078C>T, c. 615+5G>A, c.742G>A, c.44G>A, c.1311+1G>A, c.1399C>T, c.889G>T, c.1177+1G>A, c.1841+3_1841+4del, among which, c.852_855delTATG was the most common one. A total of 5 novel mutation loci were discovered in this study with c.1841+3_1841+4del, c.511dupG and c.889G>T predicted as pathogenic variants. Special formula of lactose-free and fortified medium-chain triglyceride (MCT) were used in confirmed cases and most of the symptoms were relieved within 1 year and abnormal indicators significantly improved.Conclusions:The prevalence of NICCD in Xuzhou was 1/36,038. c.852_855delTATG mutation is the most frequent one. Five novel mutation loci are discovered, expanding the SLC25A13 gene mutation spectrum. Most infants with NICCD have a good prognosis, requiring early diagnosis, treatment and life-long follow-up.

Clinical characteristics and high-throughput sequencing analysis of genetic and metabolic infantile cholestatic hepatopathy / 中华实用儿科临床杂志

Objective:To investigate the clinical and genetic characteristics of genetic and metabolic infantile cholestatic hepatopathy (ICH), and to provide evidence for its diagnosis and treatment.Methods:Clinical data and follow-up outcomes of hospitalized children diagnosed with ICH in the Department of Gastroenterology, Children′s Hospital, Capital Institute of Pediatrics from January 2014 to December 2019 were retrospectively analyzed.Among the 80 children, 27 were female and 53 were male, with a mean age of onset of (39±18) days old.Children with confirmed etiology by high-throughput sequencing analysis were included in the genetic metabolic group (44 cases), and those with idiopathic neonatal cholestasis(INC) of unknown etiology after the systematic examination were included in the INC group (36 cases). The t-test or independent sample rank sum test was used to compare the laboratory test results and biochemical indexes.The infection rate of cytomegalovirus was compared by the Chi- square test. Results:(1) A total of 80 cases were included, and 44 cases (55.0%)were confirmed as INC by high-throughput sequencing.Among those with a positive molecular diagnosis, there were 23 cases of citrin deficiency (CD), 10 cases of Alagille syndrome (ALGS), 6 cases of progressive familial intrahepatic cholestasis (PFIC), 2 cases of congenital bile acid synthesis defect, 2 cases of Nieman Pick disease, and 1 case of cystic fibrosis.(2) Serum total bile acid (TBA) and activated partial prothrombin time (APTT) levels in the genetic metabolic group were significantly higher than those in the INC group (all P<0.05). TBA and APTT levels in genetic metabolites were 180.6 (115.5, 271.6) μmol/L and 40.6 (37.1, 45.2) s, respectively, which were 123.3 (98.8, 163.4) μmol/L and 34.8 (31.7, 40.1) s in INC group, respectively.There was no significant difference in the cytomegalovirus infection rate between the 2 groups ( P>0.05). (3)The pathological examination of liver tissue in the genetic metabolic group was worse than that in the INC group, with spot-like and fusion focal-like necrosis, and 5 cases (4 cases of ALGS and 1 case of CD) showed a reduced number of bile ducts in the portal area and lumen stenosis. Conclusions:CD, ALGS and PFIC are the common causes of genetic and metabolic ICH.Fundamental cause of cholestasis should be actively examined in children with cytomegalovirus infection.High-throughput sequencing is of great significance in the accurate diagnosis of ICH.

Expert consensus on the diagnosis and treatment of intrahepatic cholestasis (2021 edition) / 中华肝脏病杂志

Intrahepatic cholestasis is a clinical syndrome due to the defect of bile acid synthesis, abnormal bile excretion, and mechanical or functional disturbance of intrahepatic bile flows caused by hepatic parenchymal cell and/or intrahepatic bile duct diseases. It commonly occurs as cholestatic liver diseases, intrahepatic cholestasis of pregnancy, and genetic/metabolic-related cholestatic diseases. In recent years, new information and progress in diagnosis and treatment of intrahepatic cholestatic diseases have been achieved. In order to provide updated clinical reference and guidance for clinicians, we organized experts to compile the Expert Consensus on the Diagnosis and Treatment of Intrahepatic Cholestasis (2021), on the basis of the 2015 edition.

Colestasis intrahepática del embarazo: forma de presentación temprana y relación con la infección por el virus de la hepatitis C: reporte de casos / Intrahepatic cholestasis of pregnancy: early presentation and relationship with infection by the hepatitis C virus: case reports / Colestase intra-hepática da gravidez: forma de apresentação precoce e sua relação com a infecção por vírus da hepatite C: relato de casos

Se describe los casos de tres pacientes a quien se les realiza diagnóstico de colestasis intrahepática del embarazo (CIE) de aparición temprana. En dos de ellos el diagnóstico se relacionó con infección por el virus de la hepatitis C (VHC). Reconocer que esta enfermedad puede presentarse de manera temprana en el embarazo y su relación con la infección por el VHC es fundamental para hacer un diagnóstico oportuno de ambas enfermedades y tomar las conductas terapéuticas adecuadas, mejorando así el pronóstico materno y fetal.

It is of great importance to acknowledge that this disease can occur early in pregnancy and that its relationship with HCV infection is a key point for a prompt diagnosis, allowing taking timely appropriate therapeutic decisions, aimed at improving the fetal prognosis.

Descrevemos os casos de três pacientes com diagnóstico de colestase intra-hepática da gravidez de início precoce. Em dois deles o diagnóstico estava relacionado à infecção pelo vírus da hepatite C (VHC). Reconhecer que esta doença pode se manifestar precocemente na gravidez e sua relação com a infecção pelo VHC é fundamental para fazer um diagnóstico oportuno de ambas as doenças e assumir condutas terapêuticas adequadas, melhorando assim o prognóstico materno e fetal.

Colestasis intrahepática del embarazo Un reto más para la obstetricia / Intrahepatic Cholestasis of Pregnancy. One More Challenge for Obstetrics

Resumen: La colestasis intrahepática del embarazo es el trastorno hepático específico más común durante la gestación; es una condición multifactorial que aparece en mujeres genéticamente susceptibles. Se caracteriza principalmente por prurito palmo-plantar de predominio nocturno, su importancia radica en su considerable morbimortalidad fetal y aunque su tratamiento es sencillo, se debe diagnosticar. Objetivo: Realizar una revisión actualizada y a detalle de la bibliografía nacional e internacional de la etiología, las pruebas diagnósticas, tratamiento, resultados perinatales y su asociación con otras patologías del embarazo. Metodología: Se realizó una búsqueda de la literatura publicada en inglés y en español en bases de datos como PubMed / MEDLINE, Ovid, MD Consult, entre otras, utilizando las palabras clave: colestasis intrahepática del embarazo, etiología, diagnóstico, tratamiento, efectos adversos perinatales, preeclampsia, embarazo múltiple. De la información obtenida se seleccionaron 64 artículos, los cuales fueron clasificados y utilizados como soporte para realizar esta revisión. Resultados: Se aporta una actualización en cuanto al diagnóstico y tratamiento de esta enfermedad para actuar como guía clínica a los profesionales de la salud. Conclusión: Esta enfermedad es una entidad importante de diagnosticar para evitar los efectos adversos fetales que implica, la principal limitación es la carencia de determinación de niveles de ácidos biliares séricos en nuestro país, por lo tanto, la sospecha clínica se convierte en la herramienta más factible para su diagnóstico e inicio oportuno de tratamiento.

Abstract: Intrahepatic cholestasis of pregnancy is the most common specific liver disorder during pregnancy, it is a multifactorial condition that appears in genetically susceptible women and it is mainly characterized by palmoplantar itching predominantly at night. Its importance lies in the considerable fetal morbidity and mortality. Although the treatment is simple, we must know how to make the diagnosis. Objective: To carry out an updated and detailed review of the national and international bibliography of etiology, diagnostic tests, treatment, perinatal results, and their association with other pregnancy pathologies. Methodology: A search of the literature published in English and Spanish was conducted in databases such as PubMed / MEDLINE, Ovid, MD Consult, and others, using the keywords: intrahepatic cholestasis of pregnancy, etiology, diagnosis, treatment, perinatal adverse effects, preeclampsia, tween pregnancy. 64 articles were selected from the obtained, which were classified and used as support to carry out this review. Results: An update regarding the diagnosis and treatment of this disease is provided, to act as a clinical guide for healthcare professionals. Conclusion: This disease is an important entity to diagnose in order to avoid the fetal adverse effects that implies. The main limitation is the lack of determination of serum bile acid levels in our country, therefore, clinical suspicion becomes the most useful tool for diagnosis and early treatment.

Effects of Lycium barbarum polysaccharides on blood indexes andliver tissue morphology in rats with intrahepatic cholestasis / 预防医学

Objective@#To study the effects of Lycium barbarum polysaccharides ( LBP ) on blood indexes and liver tissue morphology in rats with intrahepatic cholestasis.@*Methods@#Sprague-Dawley rats were randomly divided into the control group, the model group, and LBP low, medium and high dose group. The rats in the model group and LBP dose groups were given 60 mg/kg alpha-naphthylisothiocyanate ( ANIT ) by gavage every three days of the experiment, and the rats in the control group were given salad oil instead of ANIT. From the third day, the rats in each dose group were given 40, 150 and 600 mg/kg LBP, and the rats in the model group were given distilled water. After four weeks, the blood and urine indexes were measured, and the morphological changes of liver tissue were observed. @*Results@#From the third day of the experiment, the activity of rats in the model group and LBP dose groups decreased, and the color of urine changed to dark yellow. There was no abnormality in the group. In the model group, the levels of serum total bilirubin, direct bilirubin, total bile acid ( TBA ), alkaline phosphatase ( ALP ), γ-glutamyltransferase(γ-GGT), cholesterol, alanine aminotransferase ( ALT ), aspartate aminotransferase ( AST ), white blood cell ( WBC ), percentage of granulocyte, urinary bilirubin, urinary bile acid, liver mass and liver to body ratio were higher than those in the control group, while red blood cell and percentage of lymphocyte were lower than those in the control group ( all P<0.05 ). Pathological changes of liver tissue were observed. The levels of serum TBA, ALP, γ-GGT, ALT, AST, WBC and liver to body ratio in LBP high dose group were lower than those in the model group ( all P<0.05 ). The infiltration of inflammatory cells, proliferation and expansion of bile duct, degeneration and necrosis of liver cells were alleviated. @*Conclusions@#LBP can improve the blood indexes and pathological changes of liver tissue in rats with intrahepatic cholestasis at the dosage of 600 mg/kg. Inhibition of inflammatory response and reduction of oxidative stress injury may be the mechanism for alleviating cholestatic liver injury.

Advances in the role of silence information regulator family in pathological pregnancy / 浙江大学学报·医学版

Aberrant maternal inflammation and oxidative stress are the two main mechanisms of pathological pregnancy. The silence information regulator (sirtuin) family is a highly conserved family of nicotinamide adenine dinucleotide (NAD)-dependent deacylases. By regulating the post-translational modification of proteins, sirtuin is involved in various biological processes including oxidative stress and inflammation. Nowadays, emerging evidence indicates that sirtuin may be closely related to the occurrence and development of pathological pregnancy. The down-regulation of sirtuin can cause spontaneous preterm delivery by promoting uterine contraction and rupture of fetal membranes, cause gestational diabetes mellitus through promoting oxidative stress and affecting the activity of key enzymes in glucose metabolism, cause preeclampsia by reducing the proliferation and invasion ability of trophoblasts, cause intrahepatic cholestasis of pregnancy by promoting the production of bile acids and T helper 1 cell (Th1) cytokines, and cause intrauterine growth restriction through inducing mitochondrial dysfunction. Moreover, the expression and activation of sirtuin can be modulated through dietary interventions, thus sirtuin is expected to become a new target for the prevention and treatment of pregnancy complications. This article reviews the role of the sirtuin family in the occurrence and development of pathological pregnancy and its influence on the development of the offspring.

Desenlaces perinatales, en un centro de tercer nivel de México de pacientes con colestasis intrahepática del embarazo / Perinatal outcomes of patients with intrahepatic cholestasis of pregnancy in a third level center in Mexico

Resumen OBJETIVO: Describir la atención, tratamiento, desenlaces perinatales y complicaciones asociadas con la colestasis intrahepática del embarazo. MATERIALES Y MÉTODOS: Estudio de serie de casos, retrospectivo y observacional de pacientes embarazadas, con diagnóstico de colestasis intrahepática atendidas en el Instituto Nacional de Perinatología entre los meses de enero de 2016 a diciembre de 2020. Se evaluaron las características obstétricas, los datos demográficos, clínicos, bioquímicos y de tratamiento, la finalización del embarazo y los desenlaces perinatales. RESULTADOS: Se analizaron 67 casos de colestasis intrahepática que arrojaron una incidencia de 0.57%. La edad promedio de las pacientes fue 29.0 ± 6.8 años, 30 de 67 eran primigestas, 12 tuvieron el antecedente de colestasis intrahepática en el embarazo previo y 7 de óbito. El inicio de la enfermedad fue en el tercer trimestre en 41 de 67 pacientes. En los estudios de bioquímica 32 de 67 tuvieron valores de ácidos biliares entre 10 y 39 μM/L; 12 de las 67: 40-99 μM/L y 23 más de 100 (μM/L). Se administró tratamiento con ácido ursodesoxicólico a 63 de 67 y ante la falta de respuesta se agregó rifampicina. El promedio de semanas de gestación fue 35.6 ± 2.0 semanas con peso promedio de 2397 ± 572 g. Se encontró líquido amniótico con meconio en 10 neonatos y restricción del crecimiento en 20 de 67; se registraron 2 óbitos. CONCLUSIONES: Este es el primer estudio efectuado en México que describe la incidencia de la enfermedad y se utiliza la determinación de los ácidos biliares para establecer el diagnóstico. Los desenlaces perinatales coinciden con lo reportado en la bibliografía.

Abstract OBJECTIVE: To describe the care, treatment, perinatal outcomes and complications associated with intrahepatic cholestasis of pregnancy. MATERIALS AND METHODS: A retrospective and observational case series study of pregnant patients with a diagnosis of intrahepatic cholestasis seen at the National Institute of Perinatology between January 2016 and December 2020. Obstetric characteristics, demographic, clinical, biochemical and treatment data, pregnancy termination and perinatal outcomes were evaluated. RESULTS: Sixty-seven cases of intrahepatic cholestasis were analyzed, yielding an incidence of 0.57%. The mean age of the patients was 29.0 ± 6.8 years, 30 of 67 were primigravidases, 12 had a history of intrahepatic cholestasis in the previous pregnancy and 7 had an abortion. The onset of the disease was in the third trimester in 41 of 67 patients. In biochemistry studies 32 of 67 had bile acid values between 10 and 39 μM/L; 12 of 67: 40-99 μM/L and 23 more than 100 (μM/L). Treatment with ursodeoxycholic acid was administered to 63 of 67 and rifampicin to 4 patients. The mean number of weeks of gestation was 35.6 ± 2.0 weeks with a mean weight of 2397 ± 572 g. Amniotic fluid with meconium was found in 10 neonates and growth restriction in 20 of 67; there were 2 recorded abortions. CONCLUSIONS: This is the first study carried out in Mexico in which the incidence of the disease is described, and the determination of bile acids is used to establish the diagnosis. Perinatal outcomes coincide with those reported in the literature.

Pregnancy outcome in patients with intrahepatic cholestasis of pregnancy: an observational case control study

Background: Intrahepatic cholestasis of pregnancy (IHCP) is the most common cholestatic liver disease, which may impact the foeto-maternal health. The present study is conducted to determine various factors including maternal and neonatal outcome in IHCP comparing with the controls.Methods: In this prospective case control study, pregnancy with IHCP is compared with asymptomatic non-IHCP controls. Classical pruritus, icterus, elevated liver enzymes were considered in diagnostic criteria of IHCP. Dermatological lesion, acute or chronic liver disease, and other causes of pruritus were excluded from study.Results: Out of 100 patients, 50 cases and 50 controls were included in this study. Incidence of IHCP was seen 3.914% of which 66% were primi presented maximum at 31-33 weeks. 86% of IHCP responded to medication. Mean value of ALT, AST and ALP was found significantly raised (p value-<0.001) in IHCP patients. 66% in IHCP and 64% in non-IHCP group had normal delivery and remaining 34% and 36 % had caesarean delivery respectively. There was no significant increase in foetal distress or low Apgar (<7 at 5 min) at birth or adverse neonatal or maternal outcome in IHCP group. However, there was a statistically high meconium stained liquor (MSL), neonatal jaundice, IUGR and NICU admission were noted in the IHCP group in comparison to non-IHCP group.Conclusions: There is a significant incidence of IHCP in the obstetrical population. The biochemical changes, meconium stained liquor, neonatal jaundice, IUGR and NICU admission were significantly high in IHCP in pregnancy.

Cholestasis of pregnancy: effects on maternal and fetal outcome

Background: Intrahepatic cholestasis of pregnancy (ICP) typically occurs in late pregnancy affecting 1.5-2% pregnancies. Limited data is available regarding its fetal and maternal implications. This study aims to assess the impact of ICP on maternal and fetal outcome.Methods: A total 200 patients with pruritus in later half of pregnancy were studied over a period of 18 months out of which 135 were diagnosed as ICP. Clinical and biochemical parameters like serum aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total protein, and gamma glutamyl transferase was recorded. Maternal and fetal outcome was noted in the form of LSCS rate, preterm births, fetal distress and neonatal ICU admissions.Results: In this study, most common symptom was pruritus. Most of cases had onset of symptoms between 32-36 weeks. High LSCS rates were seen among cases. Intrapartum complications viz. meconium staining of amniotic fluid (57.8%), preterm delivery (11.9%), fetal distress (42.2%) were significantly higher in study population and there was high incidence of NICU admissions (49. 6% neonates) among cases mostly due to meconium aspiration and prematurity.Conclusions: ICP increases maternal morbidity and is associated with adverse perinatal outcome viz. increased risk of fetal distress, preterm births and sudden IUD at term as evidenced in this study. A timely intervention at 37-38 weeks will reduce the adverse outcomes.

Pregnancy outcome in women with intrahepatic cholestasis of pregnancy

Background: Intrahepatic cholestasis of pregnancy is a multifactorial condition of pregnancy diagnosed when otherwise unexplained pruritus with abnormal liver function test and neither of which has an alternative cause. The most appropriate gestational age for the delivery of women with ICP is yet to be determined. The present study is designed to determine whether with active intervention, pregnancy with ICP can be carried to a later gestation.Methods: Fifty Women with diagnosed a case of ICP were recruited into the study. The diagnosis of ICP was based on the symptoms, clinical examination and lab investigations. Group I: 25 women planned for delivery at POG 37 - 37+6 weeks of pregnancy. Group II: 25 women Planned for delivery at POG ≥38 weeks of pregnancy.Results: In group, one woman had preterm delivery at POG 36+2 weeks and rest of 24 women were delivered at POG 37-37+6 weeks. In group II, out of 25 women one woman had emergency LSCS at POG 35+3 weeks for MSL and induction of labour was done in 2nd for abnormal fetal well-being tests at POG 37 weeks. One woman had pre-term delivery at POG 36+1 weeks. Remaining 22 women in group II were delivered at POG ≥38 weeks. In the present study there was no significant difference in the gestational age at delivery between the two groups.Conclusions: It can be concluded that pregnancies with obstetric cholestasis can be carried to later gestation of ≥38 weeks under surveillance with UDCA treatment.

Effectiveness of ursodeoxycholic acid therapy in intrahepatic cholestatsis of pregnancy

Background: Intrahepatic cholestasis of pregnancy (ICP) is a pregnancy specific disorder and commonly presents with maternal pruritus, abnormal liver function tests and adverse maternal -foetal outcomes. ICP lacks protocol-based therapy as etiology is multifactorial and is based on symptomatic treatment. The overall incidence of ICP is variable from 0.1 to 15.6% worldwide. The aim of this study is to assess the effectiveness of UDCA in ICP with regards to reduction in pruritus, normalizing LFTs and maternal-foetal outcomes.Methods: This multicentric prospective study was performed from June 2017 to December 2019 in pregnant women with ICP attending the Antenatal clinic at INHS Patanjali, MH Dehradun, INHS Asvini, INHS Sandhani. In this study, 50 women with ICP. who satisfied the inclusion and exclusion criteria were started on UDCA therapy. The effectiveness of therapy was evaluated on the basis of normalization of LFT levels, reduction in pruritus, safe confinement, maternal-foetal outcomes and adverse effects if anyResults: The pregnant women with ICP on UDCA therapy showed marked improvement in pruritus, near normal LFT levels. After the UDCA therapy the frequency and intensity of pruritus was reduced in 50 (100%) of women. Safe confinement was achieved, with normal delivery in 45 (90%) women with no any major adverse effects and adverse maternal-foetal outcomes.Conclusions: This study shows the effectiveness of URCA therapy in reducing the ICP associated pruritus, normalizing LFTs and safe confinement without any major adverse effects. UDCA therapy is an effective and safe option in ICP.

The flickering jaundice

Benign Recurrent Intrahepatic Cholestasis (BRIC) is a rare autosomal recessive disorder characterized by intermittent episodes of jaundice and pruritus. It is also known as Summerskill-Walshe-Tygstrup syndrome. It is a benign disease with no progression to end stage liver disease.. The first episode of cholestatic jaundice occurs early in life and there are asymptomatic periods between attacks lasting weeks to years. This case report presents a young male who presented with severe pruritus and acute onset jaundice. He had his first episode of jaundice at the age of twelve and had several intermittent episodes since then. Diagnosis was made by the unique clinical presentation with exclusion of other causes of cholestatic jaundice. This case report highlights the importance of detecting such cases of rarity and preventing unnecessary invasive diagnostic procedures on such patients.

A study on feto-maternal outcome of intra hepatic cholestasis of pregnancy

Background: Intrahepatic cholestasis of pregnancy is one kind of the hepatic disorder which is unique to pregnancy. It is associated with many adverse pregnancy outcomes if doesn’t intervened at right time. It requires adequate clinico-biochemical correlation during management.Methods: A prospective observational study was conducted at multispecialty government zonal hospital. Total 137 IHCP patients were managed during the study period from 01 Jan 2017 to 30 Jun 2019. Incidence and pregnancy outcome in form of several maternal and fetal factors were analysed by appropriate statistical test using spps software version 20.0.Results: During the study period total 4872 patients were undergoing delivery and 137 patients were diagnosed with IHCP. The incidence of IHCP was 2.81%. Majority of cases 75 out 137 (54.74%) were nulligravida. Total 29.92% (41/137) cases were underwent LSCS delivery and of this 21.17% (29/137) were primary caesarean delivery. There were three still birth noted in IHCP study population. Total 28 cases (20.44%) of IHCP were presented with preterm labour. And NICU admissions of the study population were 32 new born babies (23.36%). 2.18% case of still birth was noted among study population.Conclusions: IHCP causes significant maternal and neonatal morbidity and is major contributor of preterm delivery, caesarean delivery, meconium stained liquor and NICU admission.

Mechanism of sarmentosin on juvenile intrahepatic cholestasis in rats / 中国药科大学学报

@#To study the effects of sarmentosin(SA)on the intervention and regulation of juvenile intrahepatic cholestasis in rats, 48 young SD rats were randomly divided into the control group, α-naphthylisothiocyanate(ANIT)model group, ursodeoxycholic acid(UDCA)positive control group and low-, medium- and high- dosage groups of SA, with 8 rats in each group. Except for the control group, rats in each group were given corresponding drugs by gavage once a day for a week, and 80 mg/kg ANIT model was established on the 5th day. Bile excretion was measured 48 hours after the establishment of the model; the activities of alanine aminotransferase(ALT), aspartate aminotransferase(AST)and alkaline phosphatase(ALP)and the contents of total bilirubin(TBIL), direct bilirubin(DBIL)and total bile acid(TBA)in serum were measured. The pathological changes of liver tissue and the contents of malondialdehyde(MDA), superoxide dismutase(SOD)and glutathione peroxidase(GSH-Px)in tissue homogenate were detected, and the expressions of tumor necrosis factor-α(TNF-α), γ-interferon(IFN-γ)and interleukin-1β(IL-1β)in serum were determined. Bile acid transporters and synthetic proteins were analyzed by Western blot. Compared with the control group, bile excretion was significantly inhibited in the model group; liver tissue showed obvious pathological damage; serum levels of ALT, AST, ALP, TBIL, DBIL and TBA were significantly increased; MDA content in tissue homogenate was significantly increased, SOD and GSH-Px contents were significantly decreased; inflammatory factors TNF-α, IFN-γ and IL-1β were significantly decreased in the model group. The expression of FXR, SHP-1, SHP-2, MREP2, BSEP and NTCP decreased, while the expression of CYP7A1 and CYP27A1 increased. Compared with the model group, the bile excretion of rats in each dose of SA group increased in varying degrees; the pathological damage of liver tissue was improved; the levels of ALT, AST, ALP, TBIL, DBIL and TBA in serum were decreased; the contents of MDA in liver homogenate were decreased; and the contents of SOD and GSH-Px were increased; the expression of TNF-α, IFN-γ and IL-1β decreased. The results showed that sarmentosin had a certain therapeutic effect on cholestasis. The effect of high dose of SA was similar to that of UDCA group, while SA could up-regulate the expression of FXR, SHP-1, SHP-2, MREP2, BSEP and NTCP, down-regulate the expression of CYP7A1 and CYP27A1, suggesting that the drug plays a role by regulating related proteins. SA has obvious intervention and regulation effect on ANIT-induced intrahe patic cholestasis in young SD rats, with possible therapeutic function by participating in the transport and synthesis of bile acids.