Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 21
Filter
Add filters








Year range
1.
Article in Chinese | WPRIM | ID: wpr-1030748

ABSTRACT

ObjectiveTo investigate the infection of mouse norovirus (MNV) in experimental mice raised under natural conditions from 19 biological companies in Beijing. MethodsThe mice used in this study were randomly selected from mice produced by 19 companies, and 14 mice of each strain and batch were combined into one cage, totaling 1 396 cages of 19 544 mice. The fecal samples from BALB/c, C57BL/6, ICR, KM, and BALB/c-nude mice were collected. TaqMan probe fluorescence quantitative PCR method was used to detect MNV infection of mice with MNV-1 primer, and whether the mice were infected with MNV was determined according to cycle threshold (Ct value). The chi-square test was used to analyze the difference of positive rate among the fecal samples from the five types of mice. The Ct values of the positive samples were statistically described; the non-parametric test was used to analyze the differences in Ct values among the five types of mice. Results A total of 1 396 fecal samples were collected. The positive rates of fecal MNV detection in BALB/c, C57BL/6, ICR, KM, and BALB/c-nude mice were 17.65%, 39.33%, 10.57%, 18.32% and 27.4%, respectively. According to the chi-square test results, the positive rate of fecal in C57BL/6 mice was higher than that in BALB/c, ICR, and KM mice (all P<0.05), and the positive rate of BALB/c-nude mice was higher than that in ICR and BALB/c mice (P<0.001, P<0.05) . The viral load of BALB/c-nude or C57BL/6 mice was generally greater than that of KM mice (P<0.05). ConclusionMNV-1 primers can be applied to the detection of MNV infection in mice. The positive rate of MNV in five types of experimental mice in Beijing ranges from 10% to 40%, among which C57BL/6 mice and BALB/c-nude mice have higher positive rates of MNV than the others.

2.
Chinese Journal of Biologicals ; (12): 1218-1223, 2023.
Article in Chinese | WPRIM | ID: wpr-996681

ABSTRACT

@#Objective To develop and verify a multiplex fluorescence quantitative PCR(Taqman probe) method for the detection of telomerase activity.Methods Specific reverse transcription primers,two pairs of quantitative primers and probes were designed for the CDS sequence of telomerase catalytic subunit telomerase reverse transcriptase(TERT).After optimization of the reverse transcription primers(specific reverse transcription primers and random primers) and quantitative primers(two pairs of quantitative primer probes used alone or in combination) in the reaction system,with the primer probe of internal reference gene GAPDH,multiplex fluorescence quantitative PCR was performed in a single tube.In addition,telomerase positive standard and negative standard were prepared with 293T and MRC-5 cells respectively,and the stability and precision of the method were verified.The telomerase activity in 19 normal mesenchymal cell samples and 32 breast cancer cell samples were detected by the developed method.Results The optimum reaction system was as follows:using cDNA synthesized with specific reverse transcription primers as the template,2 pairs of quantitative primer probes of TERT gene were mixed with internal reference gene GAPDH primer probes for multiplex fluorescence quantitative PCR reaction in a single tube.After optimization,the sensitivity and TERT fluorescence signal quantity of the system were greatly improved,and the ΔRn was enhanced by 3 times.The amplification curve of positive standard TERT gene was normal,and the ΔCt between TERT gene and GAPDH gene remained stable.The amplification curve of GAPDH gene in negative standard was normal,while there was no amplification curve of TERT gene.There was a little difference in ΔCt between TERT and GAPDH genes in the positive standard frozen and thawed for 3 and 5 times repeatedly and the positive standard without freezing and thawing,and the CVs of precision in intra-and inter-groups were all less than 1%.Telomerase activity was negative in 19 normal mesenchymal cell samples and positive in 32 breast cancer cell samples,and significant difference in Ct value of TERT gene between them was observed(t=4.236,P <0.001).Conclusion The developed multiplex fluorescence quantitative PCR(Taqman probe) method for the detection of telomerase activity has good stability and precision,which is expected to be used in early diagnosis and gene therapy of tumors.

3.
Chinese Pharmaceutical Journal ; (24): 2001-2009, 2019.
Article in Chinese | WPRIM | ID: wpr-857818

ABSTRACT

OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.

4.
Yao Xue Xue Bao ; (12): 746-752, 2019.
Article in Chinese | WPRIM | ID: wpr-780163

ABSTRACT

The molecular identification of Ophiocordyceps sinensis and its adulterants was carried out by real-time fluorescent PCR with TaqMan probe. Genomic DNA was extracted from 100 samples of Ophiocordyceps sinensis and its adulterants. MEGA 7.0 software was used for comparative analysis to define the variable sites between Ophiocordyceps sinensis and its adulterants according to the internal transcribed spacer (ITS) region of ribosomal DNA (rDNA). A set of specific primers and TaqMan probe were designed using Primer Premier 6.0 software, and sensitivity and specificity studies were performed on two different real-time fluorescent PCR systems (Genesig q16 and Bio-Rad CFX96). The sensitivity study showed that the detectable DNA template concentration of Ophiocordyceps sinensis for the real-time fluorescent PCR was 0.016 ng·μL-1 in the Bio-Rad CFX96 system and 15.527 ng·μL-1 in the Genesig q16 system, respectively. Meanwhile, this method had good specificity for Ophiocordyceps sinensis on Genesig q16 and Bio-Rad CFX96 systems, so Ophiocordyceps sinensis could be clearly distinguished from Ophiocordyceps nutans, Cordyceps gunnii, Cordyceps militaris, Cordyceps cicadae, Cordyceps liangshanensis, Cordyceps gracilis. Our results indicate that real-time fluorescent PCR with TaqMan probe can be used to accurately identify Ophiocordyceps sinensis from its adulterants. This provides a technical method that has wide applications for market management and quality control of Chinese materia medica.

5.
Article in Chinese | WPRIM | ID: wpr-703211

ABSTRACT

Objective To establish an efficient method of genotyping for Leprdb/ +mouse offsprings by TaqMan probe quantitative fluorescence PCR. Methods Genome DNA was extracted from tails of 228 Leprdb/ +mouse offsprings. PCR primers and TaqMan probes were designed according to the mutation sites of Lepr gene(rs1801133). Real time PCR assay was applied and SNP loci were typed with SDS software. The genotyping of 2-month old Leprdb/dbmice was validated by the phenotype and Hardy-Weinberg equilibrium test was performed. Results 228 samples were detected by the established TaqMan fluorescence quantitative PCR assay. 64 mice were of GG genotype, with a genotype frequency of 0.1929. 123 mice were of GT genotype, with a genotype frequency of 0.5395. 41 mice were of TT genotype, with a genotype frequency of 0.2807. Compared with the phenotype typing,the sensitivity of the TaqMan fluorescence quantitative PCR was 97.56% and the specificity was 99.47%. Conclusions TaqMan probe quantitative fluorescence PCR assay is a simple and efficient method,and can be used to detect the genotype of Leprdb/ +mouse offsprings.

6.
Article in Chinese | WPRIM | ID: wpr-711443

ABSTRACT

Objective To establish a sensitive real-time quantitative PCR assay with TaqMan probe for rapid detection of mcr-1 gene in clinical isolated strains. Methods According to the mcr-1 gene sequence, a pair of specific primers and a TaqMan probe were designed. Moreover, a recombinant plasmid with mcr-1 gene was constructed as the positive standard. TaqMan probe-based fluorescence quantitative PCR assay was used to detect the colistin resistance gene mcr-1. The sensitivity, repeatability and specificity of the assay were evaluated. Results There was a good linear relationship between the initial template amount and Ct value (R2>0. 999). The lower limit of detection was 10 copies/μL, which was 100 times more sensitive than the conventional PCR. Results of test for specificity showed that only the strains carrying the mcr-1 gene were positive, while the remaining strains were negative. Coefficients of variation of intra-and inter-group repeatability tests were less than 1%. Two out of 150 clinical isolated strains carried mcr-1 re-sistance gene and both of them were identified as Escherichia coli. Conclusion TaqMan probe-based fluo-rescence quantitative PCR for the detection of colistin resistance gene mcr-1 was established with strong spe-cificity, high sensitivity and good repeatability. It could be used for the specific detection of clinical drug-re-sistant strains positive for mcr-1 gene and provide reference for pharmacotherapy.

7.
Article in Chinese | WPRIM | ID: wpr-512097

ABSTRACT

Objective To observe the change in IL-1β,IL-13mRNA expression in drowning rat lungs and serum,so as to investigate the significance of IL-1β and IL-13 mechanism in the development of drowning.Methods SD rats were randomly divided into control group,drowning group.Then using TaqMan probe method to determine the expression of IL-1β and IL-13 mRNA in Right lower lobe of lung tissue and the serum of right ventricle,which were extracted respectively from each group of rats.Results (1) The lung tissue morphological changes:Typical appearance signs and anatomy of drowning group meet ante-mortem drowning feature.(2) The expression of IL-1β,IL-13 in lung tissue:compared with the control group,the expression of IL-1β and IL-13 were slightly decreased,which has no statistical significance.(3) The expression of IL-1β and IL-13 in serum:compared with the control group,the expression of IL-1β and IL-13 were significant increased,both of which has statistical significance.Conclusion (1)The expression of IL-1β and IL-13 were decreased in lung tissue may be due to drowned rats present compensatory anti-inflammatory response syndrome which causes immune incompetent performance.(2) The expression of IL-1β and IL-13 were significant increased in serum may be relate to drown stress and drowning associated acute lung injury after traumatic stress.

8.
Article in Chinese | WPRIM | ID: wpr-485814

ABSTRACT

Objective Toexplore the expression and significance of microRNA-155 (miR-155) in psoriasis vulgaris. Methods Areal-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) method with TaqMan probe technology was performed to detect miR-155 expression in skin lesion area and nonskinlesionalarea of 35 patients with psoriasis vulgaris , compared with that of 30 normal controls. The correlations among miR-155 expression, psoriasis area and severity index (PASI) score and Interleukin-17A(IL-17A)expression were studied. Results The expressions of miR-155 and IL-17A in lesional and non-lesionalgroups were higher than that of control group (all P < 0.01). Also expressions in lesional skin were higher than non-lesional skin (both P < 0.01). In skin lesion group, significant positive correlations existed betweenmiR-155 or IL-17A expression and PASI score as well as miR-155 and IL-17A expression (all P < 0.05). Conclusions Up-expression of miR-155 was relevant to psoriasis development , which is related withthe hyperfunctionof Th17 cells in psoriasis.

9.
Article in Chinese | WPRIM | ID: wpr-467217

ABSTRACT

Objective To establish a fluorescence quantitative Taqman-PCR method for rapid and accurate detection of mouse poxvirus.Methods After sequence alignment and comparison, ERPV_027 gene was selected as the primer and probe design gene.Furthermore, the specificity, sensitivity, stability and reproducibility of these primers and probes were detected.Results The detection limitation of this method was 68 copies/μL.Data showed that this method has high specificity, which specifically amplifies mouse poxvirus, with no amplification signal of mouse hepatitis virus, Sendai virus, Salmonella and some other viruses and bacteria.This method also showed good stability and reproducibility. Conclusions This study has successfully established a fluorescence quantitative Taqman-PCR method for detection of mouse poxvirus, with high specificity, sensitivity, good stability and reproducibility, and a broad application potential.

10.
Article in Chinese | WPRIM | ID: wpr-467218

ABSTRACT

Objective To establish a rapid,specific and sensitive TaqMan real-time fluorescence quantitative PCR assay for detection of murine polyomavirus ( MPyV) .Methods The specific primers and TaqMan probe were designed based on genome sequence of MPyV.The primers amplified a 69 bp fragment.After optimizing the reaction system and reaction condition, the standard curve was plotted by detecting recombinant plasmid standards.The specificity, sensitivity and reproducibility of this method were evaluated.In addition, samples of lungs, spleens and feces obtained from experimentally infected mice and 86 clinical samples were used to validate the efficacy of this real-time PCR assay.Results The specificity assay showed that this assay could specifically detect MPyV and the sensitivity for MPyV was about 100 copies/well.The coefficients of variation ( CV) of both intra-assay and inter-assay were less than 1.13%.All of the samples from experimentally infected mice were positive for MPyV and 3 out of 86 clinical samples were positive by this TaqMan-PCR detection with a positive rate of 3.5%.Conclusions The real-time fluorescence quantitative TaqMan-PCR assay established in this study has high specificity, sensitivity and stability.It can be used for clinical diagnosis, routine detection and epidemiological investigation of murine polyomavirus infections.

11.
China Pharmacist ; (12): 242-244, 2014.
Article in Chinese | WPRIM | ID: wpr-452779

ABSTRACT

Objective:To establish a Taqman fluorescence quantitative PCR for the detection of Salmonella in drugs. Methods:Based on Salmonella specific gene, a pair of primers and a probe were designed, and DNA of Salmonella was extracted for the detec-tion. Results:The method was much specific, and the detection limit was 160 cfu/ml. The detection rate was 100% for the artificially contaminated samples. Conclusion:Fluorescence quantitative PCR can be applied in the rapid detection of Salmonella in drugs.

12.
Article in Chinese | WPRIM | ID: wpr-419514

ABSTRACT

Objective To compare the levels of indoleamine 2,3-dioxygenase (IDO) in the peripheral blood mononuclear cells(PBMCs) from HIV-1 infected and HIV-1 negative individuals and in human tumor cells in the presence or absence of TLR ligand stimulation.Methods TaqMan probe real-time RT-PCR method for human IDO mRNA was established; IDO mRNA levels in the PBMCs from HIV-1+ and HIV-1-individuals were tested; IDO mnRNA levels in mucosal origin(T84,Caco-2,Hela) and leukocyte origin(THP-1,MT-4) tumor cells before and after exposure to agonists for TLR4,TLR7/8 and TLR9 were examined.Results It was found that a high level of IDO mRNA could be found in HIV-1+ individuals( 103.42 copy IDO mRNA/106 copy GAPDH mRNA) ; however,some high risk HIV-1-individuals may have also a high level of IDO mRNA.Some of the tumor cells could express higher level of IDO mRNA after exposure to TLR agonist.Conclusion This study indicated a role for IDO in the viral persistence and tumor formation in HIV/AIDS and further studies were warranted.

13.
Journal of Leukemia & Lymphoma ; (12): 531-533, 2012.
Article in Chinese | WPRIM | ID: wpr-460164

ABSTRACT

Objective To develop a real-time quantitative PCR method with TaqMan probe to analysis the lineage-specific chimerism based on single nucleotide polymorphisms (SNP).Methods CD3 positive and CD15 positive cells were separated by magnetic cell sorting system from cord blood,and a quantitative method were established using real-time quantitative PCR and SNP.Detect the artificial chimerism and mark the standard curves.The reaction system was optimized,and the sensitivity and specificity were evaluated.Results Separation purity of blood cells by magnetic cell sorting system was up to 94 %-97 %.Discrimination between donor and recipient was possible.Dilution experiments of the mock chimerism sample revealed that Ct values correlated linearly with the logarithm of recipient/donor DNA fraction (r > 0.98),and the limit of detection for a minor DNA percentage was under 0.1%,and the specificity was also good.Quantitative analysis of 4 clinical cases in same period were made by real-time fluorescence quantitative SNP-PCR,the fitted rate was 87.50 % based on the chimera standard curve calculated for 1 case.Conclusion The method shows high sensitivity and specificity,and will be used to quantify the lineagespecific chimerism after allogeneic hematopoietic stem cell transplantation.

14.
Chinese Journal of Epidemiology ; (12): 993-997, 2009.
Article in Chinese | WPRIM | ID: wpr-321060

ABSTRACT

Objective To investigate the epidemioiogical pattern of Borna disease virus (BDV) among different canine breeds in Ili, China, and to analyze its potential phylogeny. Methods BDV p24 RNA fragments were detected from peripheral blood mononuclear cells (PBMCs) of canine by modified nested RT-PCR (nRT-PCR). Possible false positives were excluded by determination of both BDV p40 RNA fragments and PMD19 plasmid standards. Analysis were performed on genetic sequence, homologous comparison, amino acid sequence and phylogeny after p24 positive products were validated. Results BDV p24 RNA fragments were found only in Kazakh Tobet (a shepherd dog) in 8 breeds of 150 cases and their overall positive rate was 11.0% (10/91). Compared with the strain of He/80 from horse and that of S6 from sheep in Germany, the homologous similarities of Kazakh Tobet was 99.2% and 95.7%, and that of amino acid as 100% and 89.3%, respectively. The kinship of Kazakh Tobet was close to He/80 and next to S6. Conclusion There was potential natural BDV infection in Kazakh Tobet in Ili, and its endemic strain was concerned with He/ 80 infecting Ili horse and S6 of German Merino sheep introduced into the region from Germany.

15.
Article in Chinese | WPRIM | ID: wpr-381079

ABSTRACT

Objective To investigate the epidemiology of BDV infection in Yili horses and Yili donkeys and to analyze phylogenetic source of BDV in Yili area, Xinjiang. Methods We established fluo- rescence quantitative nested RT-PCR to detect BDV p24 segment in peripheral blood mononuclear cells (PBMCs) of 518 Yili horses and 206 Yili donkeys in Yili area, Xinjiang. Positive products were validated by detecting BDV p40 segment and plasmid to preclude the contamination, and were sequenced to analyze the homology of gene sequence, amino acid sequence and phylogenetic tree. Results The positive rates of BDV infection in PBMCs of 518 Yili horses and 206 Yili donkeys were 0.97% and 1.94%, respectively. The results of BDV p40 segment verification were positive in all of the samples of BDV p24 positive. All the samples tested were not contaminated by plasmid. There was a homology of the gene sequence of positive PCR samples with strain He/80. And the gene sequence revealed more than 93% identical to H1766 and strain V. Conclusion Our study suggested BDV natural infection in Yili horses and Yili donkeys. The en- demic BDV had a high degree of identity to strain He/80.

16.
Chinese Journal of Epidemiology ; (12): 1106-1109, 2008.
Article in Chinese | WPRIM | ID: wpr-298309

ABSTRACT

Objective To investigate the epidemiological pattern of Borna disease virus (BDV)infection in horses and to analyze the phylogenetic tree of derived BDV in Yili, Xinjiang. Methods We established a modified nested RT-PCR (nRT-PCR) to detect BDV p24 segment in peripheral blood mononuclear cells (PBMCs) and brain tissues of 120 horses in Yili, Xinjiang. Positive products were analyzed by sequencing and homology analysis. Results The positive rate of BDV infection was 2.5% in both PMBCs and brain tissues at the same time. The gene sequence revealed in positive PCR samples was more than 93 % ,identical to that of BDV derived from horses in other countries. We also noticed a high degree of identity ( >98 % ) to standard strain He/80 in gene sequence of positive PCR samples. Conclusion Our study found the presence of BDV natural infection in horses in Yili. The endemic BDV had a high degree of identity to standard strain He/80.

17.
Article in Chinese | WPRIM | ID: wpr-578151

ABSTRACT

Objective:To investigate the epidemics of Nipah virus(NiV)in Yili, Xinjiang Uygur Autonomous Region. Methods:One step real time reverse transcriptase polymerase chain reaction(real-time RT-PCR)was performed to detect the NiV N in peripheral blood mononuclear cells from 120 equines. Gene sequence and amino acid sequence were analyzed for positive products.Results:The positive rate of NiV N in PBMCs from 120 equines was 0%(0/120).Conclusion:The investigation do not support that NiV infection exist in Yili, Xinjiang Uygur Autonomous Region.

18.
Article in Chinese | WPRIM | ID: wpr-578154

ABSTRACT

Objective:To investigate the epidemic of west Nile virus(WNV) infection in Yili, Xinjiang uygur autonomous region. Methods:One step real-time RT-PCR was performed to detect the west nile virus envelope(WNV E) in peripheral blood mononuclear cells(PBMCs) of 120 equines. Gene sequence and amino acid sequence were analyzed for positive products. Results:No positive product was found in all the samples. Conclusion:No evidence was found to support WNV infection in Yili, Xinjiang uygur autonomous region.

19.
Article in Chinese | WPRIM | ID: wpr-588977

ABSTRACT

Objective To investigate and evaluate the method of PCR amplification blocking associated with fluorescent probe for the detection of pre-C region of HBV G1896A gene mutation.Methods The primers were designed based on the mutation of HBV DNA 1896 locus.The 3′end of primers was at 1896 site,and it was complemented with the base sequence of mutation template of 1896 site.The mismatching bases were separately introduced into the second and the third base of the primer by inverse counting from the 3′end for increasing the specificity of reaction.Results The PCR amplification for wild plasmid with the mutant primer showed an effectively blocking,but not showed blocking for the mutant plasmid (G1896A).The sensitivity of detection for the mutant plasmid was 5?103 copies/ml.Ninety-five cases of HBV-positive serum was selected randomly and amplified with the mutant primer,and 8 cases were positive HBV G1896A gene mutant(mutant rate of 8.4%).Conclusion The amplification blocking associated with fluorescent probe for the detection of HBV G1896A gene mutation is a effective,convenient method for the detection of clinical samples.

20.
Article in Chinese | WPRIM | ID: wpr-683082

ABSTRACT

Objective To establish a TaqMan real-time fluorescent quantitative PCR to detect Vibrio vulnificus based on hemolysin gene(vvhA)that coding cytolysin.Method By using software Primer Express, the PCR primers and TaqMan probe,which located in the conserved region of vvhA gene sequence,were designed for establishment of a TaqMan real-time fluorescent quantitative PCR to detect 100 bp amplicon from V.vulnificus DNA.A recombinant plasmid pMD19-vvhA100 as a positive control during detection was constructed using gene cloning technique.Minimal amplification cycles(Ct value)and fluorescence intensity enhancement (△Rn value)were used as observing index to optimize the reaction conditions of the TaqMan real-time fluorescent quantitative PCR.The DNAs with different concentrations from V.vulnificus and other eight bacteria and pMD19- vvhA100 were applied as templates to determine the specificity,sensitivity and reappearance of the TaqMan real- time fluorescent quantitative PCR.ICR mice were intraperitoneally,subcutaneously and orally infected with V. vulnificus,respectively.The detection effect of the TaqMan real-time fluorescent quantitative PCR was measured using the specimens of peripheral blood,subcutaneous tissue and intestinal content collected from the infected mice.Results The established TaqMan real-time fluorescent quantitative PCR showed positive results only for V. vulnificus DNA and pMD19-vvhA100.The detection effectiveness of the TaqMan real-time fluorescent quantitative PCR was as high as 0.01 ng of V.vulnificus DNA or 103 copies of pMD19-vvhA100.The SD values of the detection results repeated for three times using pMD19-vvhA100 with different concentrations were lease than 0.79. The detection results of TaqMan real-time fluorescent quantitative PCR were positive for all the specimens of peripheral blood and subcutaneous tissue.Conclusions The TaqMan real-time fluorescent quantitative PCR established in this study for V.vulnificus vvhA gene detection has advantages such as quickness,stability, sensitivity and specificity,indicating this method can be used for clinical laboratory diagnosis of septicemia and wound infection caused by V.vulnificus.

SELECTION OF CITATIONS
SEARCH DETAIL