Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 85
Filter
1.
Acta Pharmaceutica Sinica ; (12): 2276-2281, 2021.
Article in Chinese | WPRIM | ID: wpr-887037

ABSTRACT

The high performance liquid chromatography-fluorescence micelle assay (HPLC-FMA) method for the content determination of polysorbate 80 in monoclonal antibody drugs was validated to study its applicability and transferability between various laboratories, and the feasibility to be included in the Chinese Pharmacopoeia. Both J.T. Baker and Nanjing Well-sourced polysorbate 80 was used in the collaborative validation of polysorbate 80 content analysis in seven different laboratories. The results show that when the protein concentration was no more than 20 mg·mL-1 and the concentration of polysorbate 80 ranged from 0.05 to 0.5 mg·mL-1, the method had good specificity. The recovery rates of the spiked samples ranged from 92.20% to 117.70% for J.T.Baker and from 93.90% to 117.20% for Nanjing Well. The intra-laboratory precision (%RSD) was less than 4.30% for J.T. Baker, and less than 2.60% for Nanjing Well, while the overall precision was less than 5.45% for J.T. Baker, and less than 6.70% for Nanjing Well. The linear correlation coefficient was more than 0.98 for J.T. Baker and more than 0.99 for Nanjing Well. The results of the collaborative validation prove that the HPLC-FMA method has good accuracy, precision, linearity, and specificity, and could be used for release control analysis of polysorbate 80 content in monoclonal antibodies across different laboratories.

2.
Article in Chinese | WPRIM | ID: wpr-883500

ABSTRACT

In this study,we developed a simple screening procedure for the determination of 18 anthelmintics(including benzimidazoles,macrocyclic lactones,salicylanilides,substituted phenols,tetrahydropyr-imidines,and imidazothiazoles)in five animal-derived food matrices(chicken muscle,pork,beef,milk,and egg)using liquid chromatography-tandem mass spectrometry.Analytes were extracted using acetonitrile/1%acetic acid(milk and egg)and acetonitrile/1%acetic acid with 0.5 mL of distilled water(chicken muscle,pork,and beef),and purified using saturated n-hexane/acetonitrile.A reversed-phase analytical column and a mobile phase consisting of(A)10 mM ammonium formate in distilled water and(B)methanol were used to achieve optimal chromatographic separation.Matrix-matched standard calibration curves(R2≥0.9752)were obtained for concentration equivalent to ×1/2,×1,×2,×3,×4,and ×5 fold the maximum residue limit(MRL)stipulated by the Korean Ministry of Food and Drug Safety.Recoveries of 61.2-118.4%,with relative standard deviations(RSDs)of ≤19.9%(intraday and interday),were obtained for each sample at three spiking concentrations(×1/2,×1,and ×2 the MRL values).Limits of detection,limits of quantification,and matrix effects were 0.02-5.5 μg/kg,0.06-10 μg/kg,and-98.8 to 13.9%(at 20 μg/kg),respectively.In five samples of each food matrix(chicken muscle,pork,beef,milk,and egg)purchased from large retailers in Seoul that were tested,none of the target analytes were detected.It has therefore been shown that this protocol is adaptable,accurate,and precise for the quantification of anthelmintic residues in foods of animal origin.

3.
Acta Pharmaceutica Sinica B ; (6): 3925-3934, 2021.
Article in English | WPRIM | ID: wpr-922450

ABSTRACT

T cell immunoglobulin and ITIM domain (TIGIT) is a novel immune checkpoint that has been considered as a target in cancer immunotherapy. Current available bioassays for measuring the biological activity of therapeutic antibodies targeting TIGIT are restricted to mechanistic investigations because donor primary T cells are highly variable. Here, we designed a reporter gene assay comprising two cell lines, namely, CHO-CD112-CD3 scFv, which stably expresses CD112 (PVRL2, nectin-2) and a membrane-bound anti-CD3 single-chain fragment variable (scFv) as the target cell, and Jurkat-NFAT-TIGIT, which stably expresses TIGIT as well as the nuclear factor of activated T-cells (NFAT) response element-controlled luciferase gene, as the effector cell. The anti-CD3 scFv situated on the target cells activates Jurkat-NFAT-TIGIT cells through binding and crosslinking CD3 molecules of the effector cell, whereas interactions between CD112 and TIGIT prevent activation. The presence of anti-TIGIT mAbs disrupts their interaction, which in turn reverses the inactivation and luciferase expression. Optimization and validation studies have demonstrated that this assay is superior in terms of specificity, accuracy, linearity, and precision. In summary, this reliable and effective reporter gene assay may potentially be utilized in lot release control, stability assays, screening, and development of novel TIGIT-targeted therapeutic antibodies.

4.
J Ayurveda Integr Med ; 44013; 11(3): 277-280
Article | IMSEAR | ID: sea-214033

ABSTRACT

Background: Viscum articulatum Burm. (Family: Loranthaceae) is commonly known as mistletoe. Inayurveda, the plant parts are used in “Kapha”, “Vata”, diseases of the blood, ulcer, and epilepsy. The plantparts are also used in urinary tract infection and wound infection. The plant contains five triterpenoidssuch as a-amyrin, lupeol, betulin, betulinic acid and oleanolic acid, exhibiting several pharmacologicalactivities including antimicrobial, anti-HIV, antitumor, antiviral activity.Objective: To ensure the content of uniformity of oleanolic acid, a RP-HPLC method has been developedfor estimation of oleanolic acid in V. articulatum aerial part.Material and methods: The RP-HPLC method was carried out in reverse phase C18 column, using methanol and water as mobile phase in the ratio of 95:5 (v/v), at the flow rate of 1 mL/min. The pH of aqueousphase was adjusted 3.2 with 1% (v/v) glacial acetic acid. The lmax was set at 210 nm.Results: The retention time of oleanolic acid was found at 21.5 ± 0.05 min. The linearity of the response wasfound to be 10e800 mg/mL. The coefficient of determinants of oleanolic acid was found to be (r2) 0.995 andequation Y ¼ 19462X þ 16,172. The LOD and LOQ were found to be for oleanolic acid (1.96% w/w) 0.197 ± 0.63and 0.623± 0.87 mg/mL, respectively. The developed method was accurate, specific, precise and reproducible.Conclusion: This RP-HPLC may be useful for quantitative estimation of the chemical constituents presentin the plant extract as well as the quality assessment of the herbal product.

5.
Int J Pharm Pharm Sci ; 2020 Jul; 12(7): 45-50
Article | IMSEAR | ID: sea-206124

ABSTRACT

Objective: The main objective of the research work is to develop and validate a rapid UHPLC method for the estimation of assay and its related substances of Trichostatin A (TSA) in pharmaceutical samples. Methods: The UHPLC method developed for chromatographic separation between TSA and its related compounds on Poroshell 120 SB C18(50×4.6) mm; 2.7 µm RRLC column using Agilent RRLC (UHPLC) system with linear gradient elution. Results: The developed UHPLC method has shown excellent chromatographic separation between TSA and its related compounds within 12 min run time, during validation experiments, specificity study revealed that the peak threshold was more than the peak purity and no purity flag was observed. Repeatability, intra, and inter-day precision results were well within the tolerable limits. Limits of detection concentrations were found between 0.075 to 0.077 ppm and the limit of quantitation is between 0.252 to 0.258 ppm for related compounds and TSA. The related substances method recoveries were found between 80 and 120 % and assay method recovery was found between 98.0 to 102.0%. Conclusion: The developed method capability was proven for the assay of TSA and its related compounds in pharmaceutical samples and the method shows eco-friendlier than routine, conventional HPLC methods in terms of analysis time, cost and HPLC effluent waste.

6.
Int J Pharm Pharm Sci ; 2020 Jun; 12(6): 76-80
Article | IMSEAR | ID: sea-206113

ABSTRACT

Objective: The objective of the present work was to establish a simple, precise, accurate and robust method for simultaneous estimation of gallic acid, curcumin and piperine from the marketed ayurvedic formulation by liquid chromatography. Methods: The separation was carried out on Hemochrom C18 Column (250 mm × 4.6 mm ID, 5 µm pore size) with a mobile phase methanol: acetonitrile: water (pH 3.2adjusted by using orthophosphate acid) in the ratio 70:20:10v/v by isocratic elution modeat 25 °C and the flow rate was setat0.8 ml/min. The analysis was carried out atisoabsorptive wavelength of 295 nm. Results: The retention time of gallic acid, curcumin and piperine was found to be 3.3(±0.2), 4.7 (±0.2) and 5.6 (±0.2) min, respectively. The linearity range for gallic acid, curcumin and piperine was found to be 10-70 μg/ml, 20-80 µg/ml and 2-14 µg/ml, respectively with the coefficient of linear regression greater than 0.99 for all markers. Mean percent recoveries for gallic acid, curcumin, and piperine were found within the limit of acceptance (99-100%). The percent relative standard deviation (%RSD) for precision and robustness was found less than 2%, which indicates the method is precise and robust. The developed method applied for quantification of these markers from the marketed ayurvedic formulation of Dekofcyn tablet. Conclusion: The developed method was found to be simple, rapid, precise and reproducible for standardization of Dekofcyn tablet and can be useful for other formulations containing these three markers.

7.
Rev. ciênc. farm. básica apl ; 41: [9], 01/01/2020. tab, ilus
Article in English | LILACS | ID: biblio-1128568

ABSTRACT

The substance 4-Aminobenzamidine dihydrochloride (4-AD) is one of the degradation products of diminazene aceturate and has demonstrated antiglaucomatous potential. Glaucoma is the second leading cause of blindness worldwide; thus, new therapeutic alternatives must be studied, for example, the molecule 4-AD vehiculated into polymeric inserts for prolonged release. The present work aims to develop and validate an analytical method to quantify 4-AD in pharmaceutical ophthalmic forms. A HPLC was used with UV-Vis detector, at 290 ƞm and ACE® C18 column (125 × 4.6 mm, 5 µm), in which the mobile phase consists of phosphate buffer (pH 7.4) and triethylamine (30 mmol/L), under an isocratic flow of 1.0 mL/min. The retention time of 3.2 minutes was observed. The method was developed and validated in accordance with ANVISA recommendations and ICH guides. The linearity range was established between the concentrations 5 and 25 µg/mL (correlation coefficient r = 0.993). The accuracy, repeatability, and intermediate precision tests obtained a relative standard deviation less than or equal to 5%. In addition, the method was considered selective, exact. and robust, with pH being its critical factor. Therefore, the HPLC analysis method is robust and can be used to quantify 4-AD in pharmaceutical forms for ocular application.(AU)


Subject(s)
Ophthalmic Solutions/pharmacology , Vasodilator Agents , Benzamidines/pharmacology , Diminazene/analysis , Glaucoma , Chromatography, High Pressure Liquid , Validation Studies as Topic
8.
Article in Chinese | WPRIM | ID: wpr-827964

ABSTRACT

Stilbenes is a class of natural polyphenols with 1,2-diphenylethylene as the skeleton structure which have structural and active diversity. However, there are fewer studies on their metabolic process, which limits the in-depth research and development of such components. An UPLC-MS/MS method simultaneously determining contents of ten stilbenes was firstly established in this study and applied to study the ten stilbenes of peony seed coats in the serum of C57 mice.Piceatannol was the internal standard, and methanol was used for protein precipitation, UPLC-MS/MS with negative ion mode was used for analysis, and the method was validated.The serum samples were collected and detected after mice being oral administered with 800 mg·kg~(-1) peony seed coat extracts for 8 weeks. The results showed that suffruticosol A, suffruticosol B, suffruticosol C, trans-ε-viniferin, cis-gnetin H, trans-suffruticosol D and trans-gnetin H were detected in serum samples, and the highest is suffruticosol A. The method is simple and quick with high specificity and sensitivity, and it is suitable for quantitative determination of ten stilbenes in the serum of mice.


Subject(s)
Animals , Chromatography, High Pressure Liquid , Chromatography, Liquid , Mice , Paeonia , Reproducibility of Results , Seeds , Chemistry , Stilbenes , Tandem Mass Spectrometry
9.
Braz. J. Pharm. Sci. (Online) ; 56: e17784, 2020. tab, graf
Article in English | LILACS-Express | LILACS | ID: biblio-1089223

ABSTRACT

Two simple, selective and sensitive spectrophotometric methods were developed and validated for the determination of valganciclovir hydrochloride (VLGH) in pure drug and tablets. The first method was based on the reduction of iron(III) to iron(II) by VLGH and subsequent formation of iron(III)-ferricyanide complex (Prussian blue) in acid medium which was measured at 730 nm (method A). In the second method (method B), permanganate was reduced by VLGH to bluish green manganate in alkaline medium and the absorbance was measured at 610 nm. The absorbance measured in each case was related to VLGH concentration. The experimental conditions were carefully studied and optimized. Beer's law was obeyed over the concentration ranges of 2.5-20.0 and 2.0-40.0 µg mL-1 for method A and method B, respectively, with corresponding molar absorptivity values of 1.28×104 and 6.88×103 L mol-1 cm-1. The limits of detection (LOD) and quantification (LOQ) were 0.11 and 0.33 µg mL-1 (method A) and 0.21 and 0.64 µg mL-1 (method B). Within-day and between-day relative standard deviations (%RSD) at three different concentrations levels were < 2.4%, and the respective relative errors (%RE) were ≤ 3%. The proposed methods were successfully applied to the determination of VLGH in tablets, and the results confirmed that the proposed methods were equally precise and accurate as the official method.

10.
Int J Pharm Pharm Sci ; 2019 Oct; 11(10): 26-32
Article | IMSEAR | ID: sea-205960

ABSTRACT

Objective: The preliminary goal was to develop and validate 1st order derivative spectroscopic method for quantitative analysis of Pamabrom (PAMA) which is a xanthine diuretic and ibuprofen (IBU) which is a non-steroidal anti-inflammatory agent from its synthetic mixture. Methods: Analytical method was developed on Shimadzu double beam spectrophotometer equipped with UV probe 2.42 as software using methanol as solvent. Quantification of PAMA was carried out at zero cross over point of IBU that is 291 nm and for IBU, it was achieved at 278 nm which is zero cross over point of PAMA. Method was validated according to ICH Q2 R1 guidelines. Results: Method showed a linear response in the range of 2-12 µg/ml of PAMA and 20-120 µg/ml of IBU. Method was found to be accurate with recovery between 99.7–100.9 % for PAMA and 100.3–100.7 % for IBU. The method was found to be accurate and precise for quantitative analysis of PAMA and IBU. Conclusion: The developed method was successfully validated as per ICH Q2 R1 guidelines and was successfully applied for quantitative analysis of a synthetic mixture of PAMA and IBU.

11.
Article | IMSEAR | ID: sea-210598

ABSTRACT

The present article utilized analytical quality by design (AQbD) methodology to optimize chromatographic conditionsfor the routine analysis of Cholecalciferol (CHL). Taguchi orthogonal array design and Box–Behnken designwere employed to screen and optimize critical method parameters for augmenting the method performance. Theoptimal chromatographic separation was attained on Eurosphere® 100-5, C8 (250 × 4.6 mm i.d., 5 μm) column in anisocratic elution mode using methanol:acetonitrile (50:50, % v/v) as mobile phase at a flow rate of 1.0 ml/minutesand photodiode array detection at 265 nm. The optimized chromatographic method was successfully validated asper International Council for Harmonisation Q2 (R1) guidelines. The method was found to be linear (r2 = 0.9993)in the range of 20–100 IU/ml. Limit of detection and limit of quantitation were found to be 10 and 20 IU/ml. Theprecision, robustness, and ruggedness values were within the acceptance limits (relative standard deviation < 2). Thepercent recovery of in-house developed 400 IU mouth dissolving tablets and marketed Tayo 60k tablets were foundto be 99.89% and 101.46%, respectively. The forced degradation products were well resolved from the main peaksuggesting the stability-indicating the power of the method. In conclusion, the AQbD-driven method is highly suitablefor analysis of CHL in bulk and pharmaceutical formulations

12.
Int J Pharm Pharm Sci ; 2019 Jun; 11(6): 66-71
Article | IMSEAR | ID: sea-205913

ABSTRACT

Objective: Sitagliptin phosphate and metformin hydrochloride tablet is an FDA approved combination product for the treatment of diabetes mellitus type 2. There are no reported evidence for estimation of undesired (S)-sitagliptin in a combination product. The objective of this study was to develop a high sensitive liquid chromatography method for the determination of (S)-enantiomer of sitagliptin phosphate in a fixed dose combination formula of metformin and sitagliptin. Methods: The proposed novel high-performance liquid chromatography (HPLC) method uses programmed gradient elution of a mixture of ethanol-diethylamine(DEA) 100:0.1 (v/v) as mobile phase-A and a mixture of methanol-water 60:40 (v/v) as mobile phase-B. The chromatographic conditions were designed to nullify the metformin interference and in which sitagliptin enantiomers elute first and followed by metformin. A satisfactory resolution (≥2.5) between (S)-sitagliptin and active form (R)-sitagliptin was achieved with gradient elution on Chiralpak IA column (5μm, 4 × 250 mm) at a flow rate of 0.5 ml/min and the detector wavelength set at 265 nm. The injection volume set as 10 µl. The developed method has been validated as per the International Conference on Harmonisation (ICH) guidelines. Results: The proposed HPLC method for determination of (S)-sitagliptin, showed good linearity in the concentration range of 0.5 µg/ml to 13.6 µg/ml and capable to quantify accurately up to the lowest level (LOQ) of 0.017%. The validated method was successfully applied to quantify the (S)-sitagliptin for different marketed formulations of sitagliptin with metformin and sitagliptin alone, and the corresponding recovery values were found to be in the range of 95.1% to 98.4%. Conclusion: The proposed validated HPLC method was found to be suitable for the quantitative determination of (S)-sitagliptin in the formulations of sitagliptin with metformin and sitagliptin alone.

13.
Rev. bras. farmacogn ; 29(3): 333-338, May-June 2019. tab, graf
Article in English | LILACS-Express | LILACS | ID: biblio-1020586

ABSTRACT

ABSTRACT Stingless bees (Apoidea) are widely distributed and commercially cultivated in artificial hives in fruit gardens. Their propolis are commonly used in traditional medicine to treat various diseases (e.g., abscesses, inflammations, and toothaches) and as a constituent of numerous health products. Thus, this study aimed to (i) develop and validate a high-performance thin layer chromatography method for the quantitation of major active constituents (α- and γ-mangostins) in propolis produced by five stingless bee species (Tetragonula fuscobalteata Cameron, T. laeviceps Smith, T. pagdeni Schwarz, Lepidotrigona terminata Smith, and L. ventralis Smith) cultivated in Thai mangosteen orchards and (ii) determine an optimal extraction solvent. Separation was performed on a silica gel 60 F254 plate using toluene/ethyl acetate/formic acid (8:2:0.1, v/v/v) as a mobile phase, and the developed method was validated to assure its linearity, precision, accuracy, and limits of detection/quantitation. Propolis extract from T. fuscobalteata exhibited the highest mangostin content, and acetone was shown to be more a more effective extraction solvent than dichloromethane, ethanol, or methanol. Thus, the simplicity and reliability of the developed method make it well suited for the routine analysis (e.g., for quality control) of commercial products containing stingless bee propolis.

14.
Article | IMSEAR | ID: sea-206286

ABSTRACT

An accurate RP-HPLC method developed for the estimation of Neratinib in bulk and tablet dosage form. The method is and validated for parameters linearity, accuracy, suitability, specificity, precession, LOD, LOQ and robustness. An Altima column (150 mm × 4.6 mm × 5µ) used for chromatographic separation within a runtime of 6 min. The mobile phase buffer (monopotassium phosphate) and acetonitrile (60:40 v/v) with 0.1% formic acid is used. The flow rate maintained at 1.0 ml/min with the effluents monitored at 215 nm. The Neratinib analyzed at retention time of 4.001. The concentration linear over 30-180µg/ml with regression equation y = 6065.6x + 795.43 and regression co-efficient 0.999.

15.
Chinese Journal of Endemiology ; (12): 747-750, 2019.
Article in Chinese | WPRIM | ID: wpr-790920

ABSTRACT

Objective To verify the feasibility and application value of arsenic-cerium catalytic spectrophotometry for determination of iodine in serum.Methods The blood samples of adults were collected and the iodine standard curve of 0-300 μg/L was prepared.Referring to "The Method for Determination of Chemical Substances in Biomaterials",the present method was tested in terms of linear relationship,minimum detection limit,precision and accuracy.Results The correlation coefficient of the method was-0.999 7--0.999 4 (n =6) and the minimum detection limit was 5.13 μg/L in the range of 0-300 μg/L standard curve.Precision verification displayed that the variable coefficient of three different iodine concentration serum samples were 0.89%,1.88%,0.67%.And the accuracy verification displayed that the recovery of iodine standard was 93.90%-107.04%,and the total average recovery was 99.48%.Conclusion The method has been proved to be of good linearity,high precision and high accuracy in the determination of serum iodine,which meets the requirements of biological sample analysis.

16.
Chinese Pharmaceutical Journal ; (24): 2028-2033, 2019.
Article in Chinese | WPRIM | ID: wpr-857821

ABSTRACT

OBJECTIVE: To validate the HILIC-UPLC method for N-glycan profile analysis of therapeutic antibodies. METHODS: The interlaboratory method validation was performed according to ICH_Q2_R1 guideline and general principles of China Pharmacopoeia (2015 edition) 9101. The validation items included specificity, linearity, accuracy, precision, quantitation limit, range and robustness. RESULTS: The method showed good specificity, accuracy, precision and robustness, and showed a good linearity at a protein range from 100 to 400 μg. The r2 of linear regression equation was above 0.98, and the recoveries were between 86% and 117%. Both the RSDs of peak area percentage and retention time were below 10%, which indicated good precision. The lower quantitation limit of the method was 0.040%, and the range was from 0.040% to 78.751%, which means that single peak at this range could be quantified accurately. Furthermore, robustness evaluation under a series of conditions showed that this method was robust, where the RSD of peak area percentage was below 5% and RSD of retention time was below 1%. CONCLUSION: Interlaboratory validation of HILIC-UPLC provides a methodological verification basis for the improvement of Chinese Pharmacopoeia standards.

17.
Chinese Pharmaceutical Journal ; (24): 2001-2009, 2019.
Article in Chinese | WPRIM | ID: wpr-857818

ABSTRACT

OBJECTIVE: To validate a PCR-Taqman probe method for detection of residual DNA of NS0 host cells. METHODS: Multiple pairs of primers and probes were designed and synthesized for the NS0 genome repeat sequence, and the optimal primer probe combination was selected through experiments. Pretreatment kit (magnetic bead method) was used to enrich and purify the host cell DNA residue in the sample.According to the requirements of ICH and China Pharmacopoeia general principle No. 9101, validation of the detection method including linearity and range, accuracy,precision, specificity, quantitative limit and reference DNA calibration was carried out for self-developed residual CHO host cell DNA quantitation kit (PCR-Taqman probe).Using the intermediate product and drug substance of the monoclonal antibody process produced by NS0 cells, the test performance of the kit was verified, and five independent laboratories were organized to coordinate the calibration. RESULTS: NS0 cell DNA detection (Taqman method) forward primer sequence was CCCCTTCAGCTCCTTGGGTA, reverse primer sequence was GCCTGGCAAATACAGAAGTGG, and probe sequence was FAM-AGGGCCCCCAATGGAGGAGCT-TAMRA. The standard curve of DNA was in the range of 3 fg•μL-1 to 300 pg•μL-1 with good linearity (r2>0. 99). The deviation of the mean from the true value was less than 15% at six different concentrations. The quantitative limit was 3 fg•μL-1.The DNA calibration result of the internal reference sample was 30 μg•mL-1. Good precision (RSD≤30%) was obtained. The q-PCR method was specific for CHO DNA, which showed no responses to the DNA of E. coli, human genome DNA(kidney epithelium 293T cells), and CHO genome DNA(Chinese hamster ovary cells). In addition, the detection recovery rate was in the range of 70% to 130% with RSD less than 15% for the intermediate products and drug substance in the production process. The RSD of the five collaborative laboratories was less than 30%. CONCLUSION: The self-developed residual NS0 host cell DNA quantitation kit (PCR-Taqman probe) has good specificity, sensitivity and accuracy, and can meet the requirements of host DNA residue detection.

18.
São Paulo; s.n; s.n; 2019. 108 p. graf, tab.
Thesis in Portuguese | LILACS | ID: biblio-1049631

ABSTRACT

Os acidentes de trânsito consistem em um grave problema de saúde pública, principalmente nos países em desenvolvimento. No Brasil, um dos recordistas mundiais nesse tipo de acidente, somente no ano de 2017 o número de mortos por essa causa foi de aproximadamente 35 mil, sendo que por volta de 12 mil eram motociclistas ou passageiros de moto. Dirigir sob efeito de substâncias psicoativas como drogas ilícitas e algumas classes de medicamentos pode aumentar significativamente o risco de ocorrências de acidentes automotivos. Pesquisas mostram que diversos fármacos psicoativos alteram a capacidade motora e cognitiva dos usuários, porém os únicos estudos brasileiros feitos com motociclistas avaliam a prevalência de uso de drogas ilícitas em usuários hospitalizados, não havendo assim trabalhos sobre o uso de outras substâncias psicoativas na população em geral de motociclistas. Visando a importância desse fato, o presente projeto avaliou a prevalência de drogas ilícitas (canabinoides, estimulantes e anfetaminas) e de fármacos psicoativos pertencentes às classes dos anti-histamínicos, relaxantes musculares, benzodiazepínicos e anorexígenos nas amostras de fluido oral de motociclistas na cidade de São Paulo. Para tal, foi desenvolvido um método analítico que utiliza a técnica de cromatografia líquida acoplada à espectrometria de massas. Além do desenvolvimento de um novo método analítico que poderá ser utilizado para o monitoramento de motoristas em geral, foram obtidos dados da prevalência do uso de drogas e medicamentos pelos motociclistas na cidade São Paulo, contribuindo assim para o desenvolvimento de medidas preventivas, políticas públicas e para o esclarecimento sobre os riscos de dirigir sob efeito de substâncias psicoativas


Traffic accidents are a serious public health problem, especially in developing countries. In Brazil, one of the world record holders in this kind of accident, in 2017 the number of death due to this cause was approximately 35 thousand, and nearly 12 thousand were motorcyclists or motorcycle passengers. Driving under the influence of psychoactive substances such as illicit drugs and some prescription drugs can significantly increase the risk of motor vehicle accidents. Researches shows that several psychoactive drugs alter the motor and cognitive capacity of users, but the few studies done in Brazil with motorcyclists evaluate the prevalence of illicit drug use in hospitalized users, thus there is no work on the use of other psychoactive substances in the general population of bikers. Considering the importance of this fact, the present project evaluated the prevalence of illicit drugs (cannabinoids, stimulants, and amphetamines) and psychoactive prescription drugs belonging to the classes of antihistamines, muscle relaxants, benzodiazepines and anorectics in motorcyclist's oral fluid samples in the city of São Paulo. Therefore, an analytical method has been developed using liquid chromatography coupled to mass spectrometry. A new analytical method was developed and validated and may be used to monitor drivers in general. Data about drugs prevalence and drug use by motorcyclists in São Paulo city were obtained contributing to the development of preventive measures, public policies and for clarification on the risks of driving under the influence of psychoactive substances


Subject(s)
Humans , Male , Female , Adolescent , Adult , Middle Aged , Motorcycles/classification , Analytical Methods/analysis , Biological Specimen Banks , Substance-Related Disorders/prevention & control , Psychotropic Drugs/adverse effects , Illicit Drugs/adverse effects , Validation Study
19.
Rev. bras. farmacogn ; 28(2): 145-150, Mar.-Apr. 2018. tab, graf
Article in English | LILACS-Express | LILACS | ID: biblio-958854

ABSTRACT

ABSTRACT Pluchea indica (L.) Less., Asteraceae, is a medicinal plant which contains a high amount of phenolic compounds such as caffeoylquinic acid derivatives. The leaves have been traditionally used as a nerve tonic and extensively as herbal tea. This study aimed to develop and validate an HPLC method to quantitatively analyze six caffeoylquinic acid derivatives, viz. 3-O-caffeoylquinic acid, 4-O-caffeoylquinic acid, 5-O caffeoylquinic acid, 3,4-O-dicaffeoylquinic acid, 3,5-O-dicaffeoylquinic acid, and 4,5-O-dicaffeoylquinic acid in P. indica leaf extract. HPLC was carried out in a Hypersil BDS C18-column eluted with 0.5% acetic acid in water and methanol using gradient elution with a flow rate of 1 ml/min and detection at 326 nm. The method validation was performed to assure its linearity, precision, accuracy and limits of detection and quantitation. Several extraction techniques including maceration, decoction, digestion, Soxhlet extraction, and ultrasound extraction, were used to extract active constituents. The ultrasound extraction with 50% ethanol yielded the highest concentration of these caffeoylquinic acid derivatives in the P. indica leaf extract. Our developed HPLC method is simple and reliable for a routine analysis of the six caffeoylquinic acids in P. indica leaves and could potentially be applied to be used in commercial herbal products.

20.
Article in English | WPRIM | ID: wpr-742404

ABSTRACT

An ultra performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) method was developed and validated for the quantification of donepezil in human plasma. Donepezil and donepezil-D4 were extracted from human plasma by liquid-liquid extraction using a mixture of hexane and ethyl acetate (70:30 v/v). The extracted samples were analyzed using a Thermo Hypersil Gold C18 column with 5% acetic acid in 20 mM ammonium acetate buffer (pH 3.3) and 100% acetonitrile as a mobile phase with the 60:40 (v:v) isocratic method, at a flow rate of 0.3 mL/min. The injection volume was 3 µL, and the total run time was 3 min. Inter- and intra-batch accuracies ranged from 98.0% to 110.0%, and the precision was below 8%. The developed method was successfully applied to the quantification of donepezil in human plasma. The mean (standard deviation) maximum concentration and the median (range) time to maximum concentration were 8.6 (2.0) ng/mL and 2.0 h (1.0~5.0 h), respectively, in healthy Koreans after oral administration of 5 mg donepezil.


Subject(s)
Acetic Acid , Administration, Oral , Ammonium Compounds , Humans , Liquid-Liquid Extraction , Mass Spectrometry , Methods , Plasma
SELECTION OF CITATIONS
SEARCH DETAIL