Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 4 de 4
Filter
Add filters








Year range
1.
J. pediatr. (Rio J.) ; 88(6): 531-534, nov.-dez. 2012. tab
Article in Portuguese | LILACS | ID: lil-662548

ABSTRACT

OBJETIVO: Verificar a presença da mutação ΔF508 no gene cystic fibrosis transmembrane conductance regulator na população de pacientes com fibrose cística, diagnosticados pelo teste de sódio e cloro no suor, em acompanhamento no Ambulatório de Pneumologia Pediátrica da Universidade Estadual de Campinas, centro de referência no tratamento da fibrose cística. MÉTODOS: Foram analisadas 167 amostras de DNA de pacientes com fibrose cística. O genótipo dos pacientes foi determinado pela técnica de reação da polimerase e realizado cálculo para a frequência dos alelos e genótipos da mutação ΔF508. RESULTADOS: A frequência genotípica encontrada foi, respectivamente, para os genótipos -/-, ΔF508/- e ΔF508/ΔF508: 43,7% (73 pacientes), 32,9% (55 pacientes) e 23,4% (39 pacientes). Do total de 334 alelos analisados, foi observada a frequência de 201 (60,18%) alelos para a ausência da mutação ΔF508 e de 133 (39,82%) para a presença da mutação ΔF508. O cálculo do equilíbrio de Hardy-Weinberg foi realizado, e obtivemos o valor de qui-quadrado = 16,34 (p < 0,001). A população analisada está fora do equilíbrio. Os valores esperados são, para os respectivos genótipos -/-, ΔF508/- e ΔF508/ΔF508: 32,22% (60,48 pacientes), 47,93% (80,04 pacientes) e 15,86% (26,48 pacientes). CONCLUSÕES: Na população analisada, a mutação ΔF508 se mostrou menos prevalente em relação ao alelo sem a mutação. A frequência encontrada neste estudo foi semelhante à de outras regiões do Brasil e do mundo, principalmente devido à origem predominantemente caucasoide da população incluída no estudo.


OBJECTIVE: To verify the presence of ΔF508 mutation in the cystic fibrosis transmembrane conductance regulator gene among patients with cystic fibrosis diagnosed by the sweat test for sodium and chlorine and followed at the Pediatric Pneumology Outpatient Clinic of Universidade Estadual de Campinas, Brazil, a referral center for the treatment of cystic fibrosis. METHODS: The study analyzed 167 DNA samples from cystic fibrosis patients. Patients' genotype was determined by polymerase chain reaction, and allele and genotype frequencies of ΔF508 mutation were calculated. RESULTS: The genotype frequencies found for -/-, ΔF508/-, and ΔF508/ΔF508 genotypes were respectively: 43.7% (73 patients), 32.9% (55 patients), and 23.4% (39 patients). Of the 334 alleles analyzed, we observed a frequency of 201 (60.18%) alleles for the absence of ΔF508 mutation and of 133 (39.82%) for the presence of ΔF508 mutation. Hardy-Weinberg equilibrium was calculated, obtaining a chi-square value = 16.34 (p < 0.001). The study population was out of equilibrium. The expected values for -/-, ΔF508/-, and ΔF508/ΔF508 genotypes were respectively: 32.22% (60.48 patients), 47.93% (80.04 patients), and 15.86% (26.48 patients). CONCLUSIONS: In the analyzed population, ΔF508 mutation was less prevalent than the allele without this mutation. The frequency observed in this study was similar to that from other areas in Brazil and in the world, mainly due to the predominantly Caucasian origin of the population included in the study.


Subject(s)
Humans , Cystic Fibrosis Transmembrane Conductance Regulator/genetics , Cystic Fibrosis/genetics , Mutation/genetics , Referral and Consultation , Alleles , Brazil/ethnology , Cystic Fibrosis/ethnology , White People/ethnology , Genotype , Polymerase Chain Reaction
2.
Clinics ; 60(2): 131-134, Apr. 2005. ilus
Article in English | LILACS | ID: lil-398467

ABSTRACT

OBJETIVO: Analisar a freqüência da mutação delta F508 (DF508) em 108 pacientes não aparentados, com fibrose cística e comparou os resultados com os dados de outros estudos brasileiros. A fibrose cística (CF) constitui a doença genética mais comum em populações caucasianas, sendo a DF508 a mais freqüente dentre as mutações relacionadas à doença. MÉTODO: A freqüência da DF508 foi analisada por meio da Reação em Cadeia da Polimerase (PCR) seguida de detecção em géis de poliacrilamida a 8%. RESULTADOS: Vinte e três dos 108 pacientes foram homozigotos para a mutação (21,3%), 50 foram heterozigotos (46,3%) e os 35 restantes não eram portadores da DF508 (32,4%). Em termos de alelos, foram observados 96 mutados (44,45%) e 120 do tipo selvagem (55,55%), ou seja, não portadores da mutação. CONCLUSAO: A freqüência de 44,45% de alelos mutados encontrada no estudo é mais elevada que os 33,0% descritos em pesquisa realizada em São Paulo em 1993, e ligeiramente mais baixa que os 48,0% encontrados em relatos mais recentes. Além disso, nossos resultados corroboraram a idéia de que a freqüência da mutação DF508 é mais baixa no Brasil em comparação a países europeus e nos Estados Unidos da América (cerca de 70,0%), provavelmente devido a maior miscigenação racial. Estas observações terão que ser consideradas antes da implementação de testes genéticos de triagem no Brasil.


Subject(s)
Humans , Cystic Fibrosis Transmembrane Conductance Regulator/genetics , Cystic Fibrosis/genetics , Mutation/genetics , Brazil/ethnology , Cystic Fibrosis/ethnology , Polymerase Chain Reaction
4.
Braz. j. med. biol. res ; 26(10): 1037-40, Oct. 1993. ilus, tab
Article in English | LILACS | ID: lil-148779

ABSTRACT

Cystic fibrosis (CF) nonrelated patients (N = 24) from S ao Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33 per cent (15/48 chromosomes). The genotype distribution among the patients showed 12.5 per cent (N = 3) of delta F 508 homozygotes, 37.5 per cent (N = 9) of delta F heterozygotes and 50 per cent (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75 per cent to 80 per cent ) and is similar to that described in Southern Europe (25 per cent to 50 per cent ) which is consistent with the origins of this population


Subject(s)
Humans , Cystic Fibrosis/genetics , Gene Frequency/genetics , Mutation/genetics , Base Sequence , Brazil/ethnology , Cystic Fibrosis/ethnology , Genetics, Population , Genotype , Molecular Sequence Data , Polymerase Chain Reaction
SELECTION OF CITATIONS
SEARCH DETAIL