ABSTRACT
Resumo Este trabalho se propõe a verificar o impacto das concessões à iniciativa privada dos serviços de saneamento sobre o acesso à água e ao esgoto tratados, bem como sobre as tarifas cobradas por esses serviços. O presente estudo se faz relevante à luz das recentes alterações legislativas no setor, à guisa da Lei n. 14.026/2020, e da necessidade de universalização do saneamento. Como método, foi utilizado o modelo diferenças em diferenças, para dados de 3.536 municípios brasileiros retirados do Sistema Nacional de Informações sobre Saneamento (SNIS), abrangendo o período de 1998 a 2019. Os resultados mostram impacto positivo e estatisticamente significativo dos prestadores privados (em relação aos públicos) sobre o acesso aos serviços de água, esgoto e tratamento de esgoto. Ademais, foi observado impacto positivo e estatisticamente significativo na tarifa praticada quando da concessão à iniciativa privada dos serviços, em comparação aos preços cobrados por prestadores públicos.
Abstract This paper aims to verify the impact of water and sewer services privatization on access and the tariffs charged for them. This paper is relevant mainly due to the sector's recent legal changes that resulted in Law n. 14.026/2020 and the need to universalize sanitation services in Brazil. The differences-in-differences method was employed to estimate the impact, using data from 3.536 Brazilian municipalities extracted from SNIS, the Brazilian National Sanitation Information System, for the years 1998-2019. The results show private sector operators' positive and statistically significant impact (compared to their public peers) on water and sewage services - including sewer treatment. Also, it detected a positive and statistically significant effect on the tariffs charged for those services once privatization occurs, compared to the prices charged by public sector operators.
Resumen Este trabajo se propone evaluar el impacto de las concesiones a la iniciativa privada de los servicios de saneamiento en el acceso al agua y al alcantarillado y su tratamiento, así como en las tarifas que se cobren por estos servicios. El trabajo se hace relevante a la luz de los recientes cambios legislativos en el sector, como la Ley n.o 14.026 de 2020 y de la necesidad de universalizar el saneamiento. Para el análisis se utilizó el modelo de diferencias con datos de 3536 municipios brasileños extraídos del Sistema Nacional de Información sobre Saneamiento (SNIS) que cubren el período 1998-2019. Los resultados indicaron un impacto positivo y estadísticamente significativo de los proveedores privados (en relación con los públicos) en el acceso a los servicios de agua, alcantarillado y tratamiento del alcantarillado. Además, se observó un impacto positivo y estadísticamente significativo en la tarifa cuando los servicios se concesionaron a la iniciativa privada en comparación con los precios que cobraban los proveedores públicos.
Subject(s)
Humans , Privatization , Sanitation Services Tariffs , Mortality , Basic Sanitation , Waterborne Diseases , Water Supply , Child , Communicable Disease Control , Sewerage CoverageABSTRACT
A resistência antimicrobiana está se tornando um grande desafio para saúde pública devido ao aumento da resistência aos beta-lactâmicos em geral. Os isolados de Salmonella spp. e Escherichia coli são os mais frequentes agentes causadores de doenças de transmissão hídrica e alimentar, mas também podem causar doenças invasivas graves, principalmente em imunodeprimidos, idosos e crianças. Ambos os patógenos vêm apresentando perfis de resistência as principais classes de antibióticos, nestes casos é necessária a busca de uma nova opção terapêutica, como por exemplo, as polimixinas. Em 2015, surgiu o primeiro relato da resistência às polimixinas mediado pelo gene mcr (mobile colistin resistance), que se disseminou por diversos continentes e ocasionou uma grande preocupação global em saúde pública. O objetivo deste trabalho foi identificar e caracterizar os mecanismos que medeiam à resistência à polimixinas em cepas de Salmonella spp. e E. coli Patogênica extraintestinal (ExPEC). Foi realizado a triagem pelo teste da gota e teste da CIM frente a colistina e polimixina B no total de 1026 isolados de Salmonella enterica e 159 isolados de ExPEC. Nos isolados resistentes foi verificado a presença de mutações nos genes (pmrA/B, phoP/Q) associados à resistência às polimixinas, e através da PCR foi feita a identificação dos genes de resistência plasmidial (mcr). Das 124 cepas de Salmonella resistentes a colistina e polimixina B, apenas um isolado foi positivo para o gene mcr-1, e este gene foi detectado em um plasmídeo do grupo IncX4. A cepa 2018.466 foi caracterizada como S. Choleraesuis proveniente de sangue de origem humana. Foram identificados 44 isolados de Salmonella spp. apresentando mutações em pmrA e pmrB. Dos 56 isolados de ExPEC resistentes a colistina, 21 isolados apresentaram o gene mcr-1. Este gene foi detectado em plasmídeos do grupo IncX4 (n=17) e em plasmídeos do grupo IncF (n=4). Cinco isolados de E.coli não apresentaram mutações nos genes estudados,sendo que três eram positivos para o gene mcr-1, enquanto as demais cepas apresentaram mutações em pmrA/B e phoP/Q. A tipagem pela PFGE foi realizada nos isolados de E.coli positivos para o gene mcr-1, com o objetivo de verificar a diversidade genética encontrada entre elas. Foram identificados 18 perfis genéticos, sem um clone principal...(AU)
Antimicrobial resistance is becoming a major public health challenge due to increasing resistance to beta-lactams in general. Salmonella spp. and Escherichia coli are the most frequent causative agents of diseases transmitted by water and food, but they can also cause serious invasive diseases, especially in immunosuppressed individuals, the elderly and children. Both pathogens have shown resistance profiles to the main classes of antibiotics, in these cases it is necessary to search for a new therapeutic option, such as polymyxins. In 2015, the first report of resistance to polymyxins mediated by the mcr gene (mobile colistin resistance) appeared, which spread across several continents and caused a major global concern in public health. The objective of this work was to identify and characterize the mechanisms that mediate resistance to polymyxins in strains of Salmonella spp. and extraintestinal pathogenic E. coli (ExPEC). Screening by drop test and MIC test against colistin and polymyxin B was performed on a total of 1026 Salmonella enterica isolates and 159 ExPEC isolates. In the resistant isolates, the presence of mutations in the genes (pmrA/B, phoP/Q) associated with resistance to polymyxins was verified, and through PCR the plasmid resistance genes (mcr) were identified. Of the 124 Salmonella strains resistant to colistin and polymyxin B, only one isolate was positive for the mcr-1 gene, and this gene was detected in a plasmid from the IncX4 group. Strain 2018.466 was characterized as S. Choleraesuis from blood of human origin. Forty-four Salmonella spp. showing mutations in pmrA and pmrB. Of the 56 colistin-resistant ExPEC isolates, 21 isolates harbored the mcr-1 gene. This gene was detected in plasmids from the IncX4 group (n=17) and in plasmids from the IncF group (n=4). Five E.coli isolates did not show mutations in the genes studied, three of which were positive for the mcr-1 gene, while the other strains showed mutations in pmrA/B and phoP/Q. Typing by PFGE was performed on E.coli isolates positive for the mcr-1 gene, with the objective of verifying the genetic diversity found among them. Eighteen genetic profiles were identified, without a main clone...(AU)
Subject(s)
Salmonella Infections , Polymyxins , Escherichia coli Infections/epidemiology , Waterborne Diseases , Extraintestinal Pathogenic Escherichia coli , Anti-Bacterial AgentsABSTRACT
The aim of this study was to investigate an outbreak caused by protozoa, which occurred in a municipality in the Brazil southern region. The investigations were carried out analyzing 47 fresh stool samples and 26 water samples by parasitological and molecular methods, as well as, direct immunofluorescence. After the filtrations of water samples and purification of stool samples, the concentrates were evaluated microscopically for presence of parasites. Molecular analyses were performed by polymerase chain reaction (PCR) for DNA detection of Giardia spp., Cryptosporidium parvum, C. hominis and Cyclospora cayetanensis. Out of 26 water samples, 30.8% (8/26) had waterborne protozoa and C. cayetanensis was the most prevalent (15.5%). Out of the 47 stool samples, 23.4% (11/47) were infected with C. cayetanensis and Giardia spp. The results showed that backwash water samples from filters of the Water Treatment Station were contaminated with C. cayetanensis, C. hominis and Giardia spp., suggesting the contamination of water sources with human waste brought by sewage. These results show the importance of protozoa investigation in water and stool samples by laboratory methodologies principally in outbreaks causing acute diarrheal disease (AU).
O objetivo do presente estudo foi investigar um surto causado por protozoários, ocorrido em um município da região sul do Brasil. As investigações foram realizadas analisando 47 amostras de fezes frescas e 26 amostras de água por métodos parasitológicos, moleculares e de imunofluorscência direta. Após as filtrações das amostras de água e purificação das amostras de fezes, os concentrados foram avaliados microscopicamente a procura de parasitas. A seguir, foram analisadas, pela reação em cadeia da polimerase (PCR), a detecção de DNA de Giardia spp., Cryptosporidium parvum, C. hominis e Cyclospora cayetanensis. Das 26 amostras de água, 30,8% (8/26) apresentaram protozoários de veiculação hídrica, sendo que, C. cayetanensis foi o mais prevalente (15,5%). Das 47 amostras de fezes, 23,4% (11/47) estavam infectadas por C. cayetanensis e Giardia spp. Os resultados mostraram que as águas de retrolavagem dos filtros da Estação de Tratamento de Água estavam contaminadas com C. cayetanensis, C. hominis e Giardia spp. sugerindo a contaminação dos mananciais com dejetos humanos trazidos pelo esgoto. Estes resultados mostram a importância da investigação de protozoários em água e fezes por metodologias laboratoriais, principalmente em surtos que causam doença diarreica aguda (AU).
Subject(s)
Protozoan Infections , Disease Outbreaks , Cryptosporidium , Cyclospora , Diarrhea , Waterborne Diseases , GiardiaABSTRACT
Introduction.Sodium hypochlorite is a crucial element in the water treatment process. We aimed to verify if schools that lack adequate access to water and don't provide hygiene education courses would improve water quality after an intervention program. Methods.Twenty schools from the rural area of Burkina Faso were equipped with electro-chlorinator devices that produce sodium hypochlorite and received training to make water drinkable. Data related to behavioral change was collected. In addition, microbiological analysis of fecal coliforms, total coliforms, and fecal streptococci was performed in the drinking water from water stations or water storage containers. These indicators were measured before and two years after the program in six schools that participated, paired with three control schools from the same region. Results.Before the intervention, no schools practiced treating their water. After intervention, schools did it daily. WASH courses and water treatment training were also observed in intervention schools. Only the samples belonging to the control schools contained microorganisms in the drinking water after the intervention, particularly fecal coliforms and total coliforms. Fecal streptococci were not detected in any of the samples analyzed. Before the intervention, 50% of water samples from the intervention group and 66% from the control group were contaminated with fecal coliforms. Conclusion.Schools became independent of external disinfectant production after receiving electro-chlorinator devices and proper training to comply with WASH measures. Our findings might be useful to public health practitioners trying to implement sustainable programs.
Subject(s)
Sodium Hypochlorite , Waterborne Diseases , Schools , Chlorinators , Public Health , EnvironmentABSTRACT
Este Manual é um instrumento que subsidia o treinamento em vigilância epidemiológica das doenças de transmissão hídrica e alimentar (VE-DTHA), direcionado para profissionais de saúde que atuam na investigação de surtos ou de casos de doenças de notificação compulsória relacionadas à transmissão hídrica e alimentar.
Subject(s)
Humans , Disease Outbreaks/prevention & control , Waterborne Diseases/epidemiology , Public Health Surveillance/methods , Foodborne Diseases/epidemiology , Brazil/epidemiology , Waterborne Diseases/prevention & control , Foodborne Diseases/prevention & controlABSTRACT
Introducción: La reemergencia y el control de algunas enfermedades de transmisión hídrica continúan siendo motivos de interés para los gobiernos sanitarios. Objetivo: Desarrollar acciones intersectoriales dirigidas al mejoramiento de la situación ambiental, el saneamiento básico y la calidad del agua. Métodos: Se desarrolló una investigación-acción participativa, con enfoque mixto. Se conformó un equipo multidisciplinario integrado por profesionales de la salud, miembros de la comunidad y del Gobierno Autónomo Descentralizado de Penipe, Chimborazo, Ecuador. La población estuvo constituida por 2089 habitantes que residían de forma permanente en el área urbana de la cabecera cantonal durante septiembre de 2016 y septiembre de 2017. La muestra (494 personas) se seleccionó por muestreo no probabilístico, la integraron individuos con edades entre 15 y 60 años, mentalmente aptos y que en el momento de la aplicación del instrumento se encontraban en su vivienda. Estas personas ofrecieron su consentimiento informado de participación y declararon residir de forma permanente en esa localidad. Para la recolección de los datos se empleó un cuestionario diseñado y validado por criterio de especialistas. Resultados: Predominaron las féminas de 21-30 años de edad y la autoidentificación étnica de mestiza. El consumo de agua hervida y su cloración constituyeron las prácticas más referidas por los encuestados, lo que resulta insuficiente para evitar la transmisibilidad de las enfermedades de transmisión hídrica. Conclusiones: La presencia de las enfermedades de transmisión hídricas en el cantón Penipe, Ecuador es un problema de la salud pública local que aún no ha sido resuelto, lo que justifica una intervención intersectorial que permita una educación para la salud incluyente, renovada y de carácter comunitario(AU)
Introduction: Re-emergence and control of some waterborne diseases are still an interest for sanitary governments. Objective: To develop intersectoral actions addressed to the improvement of the environmental situation, the basic sanitation and water quality. Methods: It was developed a participative research-action, with mixed approach. It was formed a multidisciplinary team made up by health professionals, members of the community and the Decentralized Autonomous Government of Penipe, Cimborazo, Ecuador. The population was formed by 2089 inhabitants living permanently in the urban area of the cantonal administrative center in the period from September 2016 to September 2017. The sample (494 people) was selected by non-probabilistic sampling, and it was made up by individuals in the ages from 15 to 60 years, mentally fit and that at the moment of the instrument's implementation were at their house. These people gave their informed consent for participating and declared to live permanently in that area. For data collection, it was used the questionnaire designed and validated by specialists criterion. Results: Females in the ages from 21 to 30 years and the ethnic auto-identification as mixed race predominated. Consumption of boiled water and its chlorination were the most common practices referred by those polled, which is insufficient to avoid transmissibility of waterborne diseases. Conclusions: The presence of water transmission diseases in cantón Penipe, in Ecuador is an unsolved local public health problem which justifies an intersectoral intervention that allows an inclusive, renewed and community focused health education(AU)
Subject(s)
Humans , Female , Adult , Parasitic Diseases/prevention & control , Water Quality/standards , Waterborne Diseases/prevention & control , EcuadorABSTRACT
Resumen Este artículo pretende analizar la evolución de la mortalidad por enfermedades transmitidas por el agua durante el primer decenio del siglo XXI, por grupos de edades, comparando dos países del cono sur: Argentina y Brasil. Se estiman Años de Esperanza de Vida Perdidos (AEVP) por causa de muerte en base a la técnica descripta por Eduardo Arriaga. Para todas las estimaciones de defunción se utilizan promedios móviles para establecer dos períodos: 2000-2002 y 2009-2011. Se observa una tendencia general a la disminución de la mortalidad por enfermedades relacionadas con el agua, tanto en Argentina como en Brasil, con una velocidad de reducción promedio de los años de vida perdidos cercana al 1% anual. Esta reducción no es uniforme para todas las enfermedades relacionadas a este grupo de causas; de hecho existen causas que aumentan su mortalidad en el período estudiado, aunque en su mayoría se trata de brotes epidémicos. Por otro lado, el grupo de causas analizado impacta más en las edades más vulnerables: los menores de 1 año y los mayores de 50 años. Las intervenciones aisladas que se hacen sobre la higiene del agua, no logran por sí solas alcanzar los niveles de éxito deseado frente a este tipo de afecciones, que dependen de otros factores asociados a las condiciones de salud, la calidad de vida y la educación sanitaria.
Abstract This article aims at analyzing the evolution of mortality from waterborne diseases during the first decade of the 21st century, by age groups, comparing two countries of the southern cone: Argentina and Brazil. The method of years of potential life lost (YPLL) due to death, based on the technique described by Eduardo Arriaga, was used. For all death estimates, moving averages are used to establish two periods: 2000-2002 and 2009-2011. There is a general trend towards a reduction in mortality because of water-related diseases, both in Argentina and Brazil, with an average reduction rate of years of life lost close to 1% per year. This reduction is not uniform for all diseases related to this group of causes; in fact, there are causes that increase their mortality in the period studied, although most are epidemic outbreaks. On the other hand, the group of causes analyzed impacts more on the most vulnerable ages: those under 1 year old and those over 50 years old. The isolated interventions made on the hygiene of the water do not reach the levels of desired success by themselves considering this type of affections, that depend on other factors associated to the health conditions, the quality of life and the health education.
Subject(s)
Humans , Male , Female , Water Quality Control , Health Education , Disease Outbreaks , Mortality , Water Purification , Waterborne DiseasesABSTRACT
El hipotiroidismo subclínico (HS), elevación de tirotrofina con hormonas tiroideas normales, junto al bocio, aumentó la frecuencia en las últimas décadas. Con el objetivo de relacionar la prevalencia de bocio y HS con el consumo de agua subterránea como factor de riesgo etiológico poblacional, se analizaron 879 historias clínicas de un centro médico de Glew, en el conurbano bonaerense Sur. Se estudió la población según edad (20-60 y 12-19 años) y tipo de agua consumida (potabilizada o napa subterránea). El agua subterránea fue consumida por el 70.5% del grupo de 20 a 60 años (n = 559, 79.9% mujeres) y por el 66.3% del grupo de 12 a 19 años (n = 57, 81.4% mujeres). En el grupo de 20 a 60 años la prevalencia de HS en consumidores de agua potabilizada y subterránea fue del 1% y 57.8% (p < 0.0001) y la de bocio de 3.8% y 38.9% (p < 0.0001), respectivamente; con un riesgo atribuible al agua subterránea de 57% para HS y 35% para bocio. En el grupo de 12 a 19 años, la prevalencia de HS fue 6.9% y 52.6% (p < 0.0001) y de bocio 13.8% y 77.2% para los grupos de agua potabilizada y subterránea, (p < 0.0001) respectivamente; con un riesgo atribuible al agua subterránea de 46% para HS y 61% para bocio. El análisis fisicoquímico mostró presencia de nitratos (entre 24 y 83 mg/l) en aguas de pozos y ausencia en agua potable. La prevalencia aumentada de HS y bocio podrían deberse a la acción disruptora tiroidea de los nitratos.
Subclinical hypothyroidism (SH), elevation of the level of thyrotrophin with normal thyroid hormones, along with goiter (glandular size > 25g), increased in recent decades. In order to relate the prevalence of goiter and SH with the consumption of groundwater, as a population etiological risk factor, we analyzed 879 clinical histories from a medical center in the city of Glew in the South Buenos Aires suburbs. The population was studied according to age (20 to 60 and 12 to 19 years) and type of water consumed (potable water or groundwater). Groundwater was consumed by 70.5% of the group from 20 to 60 years old (n = 559, 79.9% women) and by 66.3% of the group from 12 to 19 years old (n = 57, 81.4% women In the group of 20 to 60 years, the prevalence of SH in potable water and groundwater users was 1% and 57.8% (p < 0.0001) and the goiter rate of 3.8% and 38.9% (p < 0.0001) respectively; with an attributable risk to groundwater of 57% for HS, and 35% for goiter In the group of 12 to 19 years, the prevalence of SH was 6.9% and 52.6% (p < 0.0001) and goiter 13.8% and 77.2% for the water and groundwater groups (p>0.0001) respectively, with an attributable risk of 46% for HS y 61% for goiter. The physicochemical analysis showed the presence of nitrates in the range of 24 to 83 mg/l in groundwater and absence in potable water. The increased prevalence of HS and goiter could be due to the thyroid disrupting action of nitrates.
Subject(s)
Humans , Male , Female , Child , Adolescent , Adult , Middle Aged , Young Adult , Drinking Water/chemistry , Groundwater/chemistry , Waterborne Diseases/etiology , Goiter/etiology , Hypothyroidism/etiology , Argentina/epidemiology , Water Quality , Thyrotropin/blood , Prevalence , Cross-Sectional Studies , Risk Factors , Analysis of Variance , Sex Distribution , Age Distribution , Statistics, Nonparametric , Waterborne Diseases/epidemiology , Goiter/epidemiology , Hypothyroidism/epidemiology , Nitrates/analysisABSTRACT
The HEV is a known cause of water-borne outbreaks of acute non-A non-B hepatitis in developing countries, which affects young people and may result in high mortality in pregnant women. In recent decades, however, HEV genotypes 3 and 4 have been known as a cause of sporadic zoonotic infections in older males from swine HEV worldwide. Most acute HEV infections are self-limited. On the other hand, in immunosuppressed patients, including solid organ transplant recipients, chronic HEV infections may exist and progress to liver cirrhosis or decompensation. Therefore, physicians need to recognize HEV as a major pathogen for acute and chronic hepatitis of unknown causes and investigate this disease.
Subject(s)
Female , Humans , Male , Developing Countries , Diagnosis , Disease Outbreaks , Genotype , Hand , Hepatitis E virus , Hepatitis E , Hepatitis , Hepatitis, Chronic , Liver Cirrhosis , Mortality , Pregnant Women , Swine , Transplants , Waterborne Diseases , ZoonosesABSTRACT
OBJECTIVES: It was supposed to analyze status and affecting factors in water and food-borne communicable disease by screening entrants with diarrhea symptom at the point of entry in Korea METHODS: Symptomatic travelers with water and food-borne communicable diseases who entered Korea were diagnosed by a health declaration and detection of causative agents in water and food using laboratory tests. Among those entered in 2017, the affecting factors in the incidence of communicable diseases among those who had diarrhea at the entry into Korea, were analyzed, with frequency and chi-square test. RESULTS: The number of travel entrants with gastrointestinal communicable diseases increased by 40.19% from 2013 to 2017. The percentage of causative agents of water and food-borne communicable diseases was the highest at 69.2% from July to September. The rate of detection of causative agents of communicable disease pathogens in travelers from Southeast Asia entering Korea was 70.2%, which was higher than people arriving from East Asia and Central Asia (57.5%; p < 0.001). CONCLUSION: The positive ratio of causative agents of water and food-borne communicable diseases was high among travelers that had entered Korea from July to September, with a high number among entrants from Southeast Asia. Based on the positive detection of causative agents, the entry period and countries visited were statistically significant affecting factors (p < 0.001).
Subject(s)
Asia , Asia, Southeastern , Communicable Diseases , Diarrhea , Asia, Eastern , Foodborne Diseases , Incidence , Korea , Mass Screening , Quarantine , Water , Waterborne DiseasesABSTRACT
The HEV is a known cause of water-borne outbreaks of acute non-A non-B hepatitis in developing countries, which affects young people and may result in high mortality in pregnant women. In recent decades, however, HEV genotypes 3 and 4 have been known as a cause of sporadic zoonotic infections in older males from swine HEV worldwide. Most acute HEV infections are self-limited. On the other hand, in immunosuppressed patients, including solid organ transplant recipients, chronic HEV infections may exist and progress to liver cirrhosis or decompensation. Therefore, physicians need to recognize HEV as a major pathogen for acute and chronic hepatitis of unknown causes and investigate this disease.
Subject(s)
Female , Humans , Male , Developing Countries , Diagnosis , Disease Outbreaks , Genotype , Hand , Hepatitis E virus , Hepatitis E , Hepatitis , Hepatitis, Chronic , Liver Cirrhosis , Mortality , Pregnant Women , Swine , Transplants , Waterborne Diseases , ZoonosesABSTRACT
RESUMEN El crecimiento de la población mundial ha incrementado la demanda de agua, por otro lado, el cambio climático nos muestra que las fuentes de agua que antes eran seguras actualmente ya no lo son. Existen desigualdades entre las zonas urbanas y rurales, así el 96% de la población mundial urbana utiliza fuentes de agua potable frente al 84% de la población rural, mientras que el 82% de la población urbana frente al 51% de la población rural utiliza instalaciones de saneamiento. En el Perú el 80,4% de viviendas se provee de agua por red pública. En el área urbana, este servicio cubre 83,2%; mientras que en el área rural el 71,3% de las viviendas cuenta con servicio higiénico conectado a red pública. Todo lo anterior condiciona la presencia de enfermedades infecciosas relacionadas con el agua como las diarreas, malaria, dengue, leptospirosis, hepatitis virales A y E, cuya clasificación, se muestra en este artículo. En el mundo las diarreas son la tercera causa de muerte entre menores de cinco años y más de 340 000 niños menores de cinco años mueren por enfermedades diarreicas. Una de las metas de los Objetivos de Desarrollo Sostenible (ODS) es la relacionada al acceso universal al agua potable, saneamiento e higiene, lo que no puede lograrse sin prestar la debida atención a las desigualdades en el acceso observadas entre diferentes grupos, evitando las consecuencias de estas deficiencias tanto en nuestro país como en el mundo.
ABSTRACT The growth of the world population has increased the demand for water. On the other hand, climate change shows us that the water sources that were previously safe are not anymore. There are inequalities between urban and rural areas, thus 96% of the urban world population uses drinking water sources compared to 84% of the rural population, while 82% of the urban population versus 51% of the rural population use sanitation facilities. In Peru, 80.4% of homes are supplied with water through a public network. In the urban area, this service covers 83.2%; while in the rural area 71.3% of homes have a toilet service connected to the public network. All the above conditions the presence of water-related infectious diseases, such as diarrhea, malaria, dengue, leptospirosis, viral hepatitis A, and E, whose classification is shown in this article. In the world, diarrhea is the third cause of death among children under five years of age and more than 340,000 children under the age of five die from diarrheal diseases due to poor sanitation. One of the goals of the SDGs is related to universal access drinking water, sanitation and hygiene, which cannot be achieved without due attention to the inequalities in access observed between different groups, avoiding the consequences of these deficiencies both in our country and in the world.
Subject(s)
Humans , Water Microbiology , Water/parasitology , Communicable Diseases/epidemiology , Waterborne Diseases/epidemiology , Peru/epidemiology , Communicable Diseases/etiologyABSTRACT
RESUMEN Objetivo Analizar los resultados del Índice de Riesgo de la Calidad del Agua para Consumo Humano (IRCA) para los 116 municipios del Departamento de Cundinamarca, del año 2007 a 2013. Materiales y Métodos Información recolectada de los 116 municipios del Departamento de Cundinamarca, seleccionados y clasificados en función de los datos porcentuales del IRCA. Resultados Se observa una disminución del promedio anual del IRCA, lo cual refleja un mejoramiento de la calidad del agua entregada en el departamento; sin embargo, un 26,7% de municipios no reportan información de la zona rural y un 56,9% de los municipios reportan un IRCA superior a 5, que aunque se ubican en Riesgo Bajo, son un agua no apta para consumo humano. Conclusiones Se propone una nueva ponderación de los parámetros evaluados en el IRCA, con el fin de permitir que este índice sea más representativo del riesgo a la salud y, como estudios futuros un análisis estadístico concienzudo sobre el tamaño de la muestra que permita que los resultados obtenidos sean confiables para los tomadores de decisiones sobre el mejoramiento de la calidad del agua potable.(AU)
ABSTRACT Objective To analyze the results of the Water Quality Risk Index (IRCA) in the 116 municipalities of the department of Cundinamarca, between 2007 and 2013. Materials and Methods Information collected from the 116 municipalities of the department of Cundinamarca, selected and classified according to the percentage data retrieved by IRCA. Results A decrease of the annual IRCA average is observed, which reflects an improvement of the water quality delivered in the department. However, 26.7% of the municipalities do not report information from their rural areas, and 56.9% of the municipalities report IRCA figures over 5, which means that even though they are at low risk, they receive water unfit for human consumption. Conclusions A new weighting method for the parameters evaluated with the IRCA is proposed to make this index more representative of the risk to health. In addition, future studies should carry out a thorough statistical analysis on the size of the sample that allows the obtained results to be reliable for decision makers to improve the quality of drinking water.(AU)
Subject(s)
Humans , Water Supply/standards , Water Quality Standards , Waterborne Diseases/epidemiology , Epidemiology, Descriptive , Colombia/epidemiology , Water Purification/standardsABSTRACT
OBJECTIVES: There was an outbreak of foodborne and waterborne disease among high school students at Okcheon in June, 2018. First attack occurred June 5(th) but seven days later it was notified. The purpose of this investigation was to evaluate the pathogen of outbreak and cause of delayed notification. METHODS: First, we did a questionnaire survey for 61 cases and 122 controls to find what symptoms they had and whether they ate foods or drank water from June 2(nd) to June 12(th). Second, we investigated the environment of cafeteria and drinking water. Third, we examined specimen of cases and environment to identify bacteria or virus. RESULTS: Attack rate of this outbreak was 7.8%. Drinking water was strongly suspected as a source of infection in questionnaire survey but we could not find the exact time of exposure. Norovirus was identified in specimen of cases (2 students), drinking water (at main building and dormitory) and cafeteria (knife, dishtowel, hand of chef) CONCLUSIONS: We decided norovirus as the pathogen of this outbreak based on the clinical features of cases with diarrhea vomiting, abdominal pain and recovery within 2 or 3 days after onset, outbreak due to drinking water and microbiologic examination, And the cause of delayed notification might be the non-existence of the nurse teacher at that time and the lack of understanding of teachers on immediate notification under the outbreak. To prevent the delayed notification, notification system about outbreak of foodborne and waterborne disease in school is needed to be improved.
Subject(s)
Humans , Abdominal Pain , Bacteria , Diarrhea , Drinking Water , Hand , Norovirus , Vomiting , Water , Waterborne DiseasesABSTRACT
Resumo: O presente estudo teve como objetivo avaliar a associação entre condições socioeconômicas, de saneamento básico e de cobertura por equipes de saúde da família (EqSF) sobre as internações por doenças de veiculação hídrica no Brasil. A análise das condições socioeconômicas e de saneamento se deu por meio de um estudo ecológico com dados da Pesquisa Nacional por Amostra de Domicílios (PNAD) e do Departamento de Informática do SUS (DATASUS) - observações dos Estados e Distrito Federal - para o ano de 2013. A relação das EqSF com as internações foi avaliada por meio da estimação de regressão simples, com dados coletados no DATASUS e Departamento de Atenção Básica do Ministério da Saúde, para o período de 1998 a 2014. A existência de coleta de esgoto por rede geral, a baixa escolaridade e a cobertura por EqSF influenciaram, com significância estatística (p < 0,05), as internações avaliadas. Pela análise do risco atribuível, estimou-se que no Brasil, tomando-se como base os dados de 2013, 57.574 (16,3%) das internações por doenças selecionadas poderiam ter sido evitadas, caso as condições de esgotamento sanitário fossem adequadas. Seriam ainda evitados os gastos com o tratamento delas, calculado em R$ 20.372.559,90 e os dias perdidos com as internações, 172.722. Sugere-se que a adoção integrada de políticas de saneamento, educação e assistência à saúde que considerem as desigualdades regionais contribuirá para a melhoria das condições de saúde da população.
Abstract: The current study aimed to assess the association between socioeconomic conditions, basic sanitation, and coverage by family health teams and hospitalizations for waterborne diseases. The analysis of socioeconomic conditions and sanitation was based on an ecological study with data from the Brazilian National Household Sample Survey (PNAD) and the Brazilian Health Informatics Departament (DATASUS) database (observations for the States and Federal District) for the year 2013. Associations between family health teams and hospitalization were assessed by simple regressions, with data from DATASUS and the Department of Primary Care of Ministry of Health from 1998 to 2014. Connection to the public sewage system, low schooling, and family health team coverage were significantly associated (p < 0.05) with hospitalizations for waterborne diseases. Based on attributable risk analysis, for Brazil as a whole in 2013, 57,574 (16.3%) of hospital admissions for waterborne diseases could have been avoided by adequate sewage disposal, which would also have avoided BRL 20,372,559.90 in treatment costs and 172,722 days lost to hospitalization. The results emphasize the importance of integrated sanitation policies, education, and health care that consider regional inequalities, thereby contributing to improvement of the population's health conditions.
Resumen: El objetivo del presente estudio fue evaluar la asociación entre condiciones socioeconómicas, de saneamiento básico y de cobertura por equipos de salud de la familia sobre los internamientos por enfermedades de transmisión hídrica en Brasil. El análisis de las condiciones socioeconómicas y de saneamiento se realizó mediante un estudio ecológico, con datos de la Encuesta Nacional por Muestra de Domicilios (PNAD) y del Sistema de Información del Sistema Único de Salud (DATASUS) -observaciones de los Estados y Districto Federal- durante el año 2013. La relación de los equipos de salud de la familia con los internamientos se evaluó gracias a la estimación de regresión simple, con los datos recogidos en el DATASUS y el Departamento de Atención Básica del Ministerio de la Salud, para el período de 1998 a 2014. La existencia de desagües para los residuos, mediante una red general de alcantarillado, la baja escolaridad y la cobertura por equipos de salud de la familia influenciaron con significancia estadística (p < 0,05) los internamientos evaluados. Por el análisis del riesgo atribuible, se estimó que en Brasil, tomando como base los datos de 2013, 57.574 (16,3%) de los internamientos por enfermedades seleccionadas podrían haber sido evitados, si las condiciones del alcantarillado fueran las adecuadas. Se evitarían incluso los gastos con su tratamiento, calculado en BRL 20.372.559,90, y los días perdidos con los internamientos en 172.722. Se sugiere que la adopción integrada de políticas de saneamiento, educación y asistencia a la salud, que consideren las desigualdades regionales, contribuiría a la mejoría de las condiciones de salud de la población.
Subject(s)
Humans , Child , Primary Health Care/statistics & numerical data , Sanitation/statistics & numerical data , Family Health/statistics & numerical data , Waterborne Diseases/mortality , Waterborne Diseases/transmission , Hospitalization/statistics & numerical data , Primary Health Care/economics , Sewage , Socioeconomic Factors , Brazil/epidemiology , Sanitation/economics , Family Health/economics , Morbidity , Educational Status , Waterborne Diseases/economics , Hospitalization/economicsABSTRACT
RESUMEN La leptospirosis es una enfermedad zoonótica de distribución mundial que puede transmitirse por contacto directo o indirecto con orina o tejidos de animales infectados. En Argentina, la leptospirosis es endémica en la provincia de Santa Fe y presenta brotes epidémicos durante las inundaciones. Sin embargo, se sabe muy poco sobre el papel que cumplen los roedores silvestres en la diseminación de la enfermedad en el país. El objetivo de este estudio fue identificar las especies hospederas de leptospiras patógenas entre los roedores presentes en un asentamiento ribereño de la provincia de Santa Fe. Se realizó un muestreo de roedores durante octubre de 2015. Los riñones de los animales capturados se analizaron por real-time PCR para el gen LipL32 de leptospiras patógenas. En los animales que resultaron positivos, se realizó test de microaglutinación (MAT) y tipificación molecular por amplificación del gen 16S rRNA y dos esquemas de MLST. Se capturaron 37 roedores de las especies Akodon azarae, Cavia aperea, Oligoryzomys flavescens, Rattus rattus y Scapteromys aquaticus. En el análisis por real-time PCR resultó positivo un macho de Scapteromys aquaticus. El suero de este individuo y del resto de los S. aquaticus capturados (n = 18) se analizaron por test de microaglutinación (MAT), y fueron no reactivos para los 10 serovares probados. La amplificación del gen 16S rRNA identificó la especie infectante como Leptospira interrogans, mientras que no se obtuvo amplificación para los dos esquemas de MLST. El hallazgo de este estudio aporta nueva información acerca de presencia de leptospiras patógenas en roedores silvestres, que es relevante para la zona por tratarse de una especie ampliamente distribuida en ambientes pantanosos e inundables de América del Sur.(AU)
ABSTRACT Leptospirosis is a globally distributed zoonosis that can be transmitted through direct or indirect contact with the urine or tissues of infected animals. In Argentina, leptospirosis is endemic in the province of Santa Fe and epidemic outbreaks occur during floods. However, very little is known about the role that wild rodents play in the spread of the disease in Argentina. The objective of this study was to identify the host species of pathogenic Leptospira among rodents in a riverine settlement in the province of Santa Fe. We conducted a trapping session in October 2015. Kidneys of the captured animals were analyzed by real-time PCR for the LipL32 gene of pathogenic Leptospira. Animals that were positive were subjected to microscopic agglutination test (MAT) and molecular typing by amplification of the 16S rRNA gene and two multilocus sequence typing (MLST) schemes. A total of 37 rodents of the species Akodon azarae, Cavia aperea, Oligoryzomys flavescens, Rattus rattus, and Scapteromys aquaticus were captured. Real-time PCR found one male Scapteromys aquaticus that was positive. The serum of this individual and of the rest of the S. aquaticus captured (n = 18) were analyzed by MAT and were non-reactive for the 10 serovars tested. Amplification of the 16S rRNA gene identified the infective species as Leptospira interrogans, while amplification could not be obtained for the two MLST schemes. The findings of this study contribute new information concerning the presence of pathogenic Leptospira in wild rodents, which is relevant in this region because the species is widely distributed in swampy and flood-prone environments of South America.(AU)
RESUMO A leptospirose é uma doença zoonótica de distribuição mundial transmitida pelo contato direto ou indireto com a urina ou os tecidos de animais infectados. Na Argentina, a leptospirose é endêmica na Província de Santa Fé com surtos epidêmicos ocorrendo com as enchentes. Sabe-se pouco sobre o papel dos roedores silvestres na propagação da doença no país. O objetivo deste estudo foi identificar as espécies hospedeiras de leptospiras patogênicas em roedores encontrados em um núcleo de povoamento ribeirinho na Província de Santa Fé. A amostragem dos roedores foi feita no mês de outubro de 2015. Os tecidos dos rins dos animais capturados foram analisados com a técnica de reação em cadeia da polimerase em tempo real (PCR-RT) quanto à presença do gene LipL32 de leptospiras patógenas. Para os animais com resultados positivos, foi realizado o teste de microaglutinação (MAT) e tipagem molecular baseada na amplificação do gene 16S rRNA e dois esquemas de tipagem por sequenciamento de locos múltiplos (MLST). Ao todo, foram capturados 37 roedores das espécies Akodon azarae, Cavia aperea, Oligoryzomys flavescens, Rattus e Scapteromys aquaticus. O ensaio de PCR-RT foi positivo em um roedor macho da espécie Scapteromys aquaticus. Os soros deste animal e dos outros S. aquaticus capturados (n = 18) foram analisados com o MAT e os resultados foram não reagentes para os 10 sorovares testados. A amplificação do gene 16S rRNA permitiu identificar a espécie infetante como sendo Leptospira interrogans e não houve amplificação nos dois esquemas de MLST. O achado deste estudo fornece um novo dado quanto à presença de leptospiras patogênicas em roedores silvestres, importante para esta área por se tratar de uma espécie de ampla distribuição em terras pantanosas e inundáveis da América do Sul.(AU)
Subject(s)
Humans , Animals , Disease Reservoirs/microbiology , Waterborne Diseases/epidemiology , Leptospira interrogans/isolation & purification , Leptospirosis/diagnosis , Argentina/epidemiology , RodentiaABSTRACT
RESUMEN Objetivo Analizar la relación de la cobertura de alcantarillado y tratamiento de aguas residuales con el comportamiento de las enfermedades de origen hídrico. Métodos Se realizó un estudio descriptivo de tipo retrospectivo, utilizando fuentes secundarias (revisión documental e información de bases de datos disponibles) sobre el comportamiento de la cobertura en saneamiento básico, tratamiento de aguas residuales domésticas en el país y la prevalencia de enfermedades relacionadas con la contaminación hídrica en el periodo 2008 a 2014. Resultados El país ha invertido en la puesta en marcha de sistemas de tratamiento de aguas residuales del 2011 al primer semestre de 2013, 1.100 millones de dólares, sin embargo la incidencia de enfermedades de origen hídrico como enfermedad diarreica aguda EDA, enfermedades transmitidas por alimentos ETA y fiebre tifoidea y paratifoidea, no han disminuido en el periodo 2008 a 2014, sólo la hepatitis A, ha registrado disminución. Discusión Se reconoce que la inversión en sistemas de acueducto y alcantarillado es relevante para el mejoramiento de las condiciones sanitarias de la población y para la disminución en la incidencia y la prevalencia de diversas alteraciones del estado de salud, sin embargo es necesario atender otros aspectos, tales como la educación en salud y el empoderamiento social, con el fin de avanzar en la creación de capacidades para afrontar esta problemática de manera más eficiente.(AU)
ABSTRACT Objective To analyze the relationship of sewerage coverage and wastewater treatment with waterborne disease behaviour. Methods A descriptive retrospective study was conducted using secondary sources (document review and information available in databases) about basic sanitation coverage, treatment of domestic sewage in the country and the prevalence of waterborne diseases during the period 2008-2014. Results The country invested USD 1,100 million in the implementation of wastewater treatment systems from 2011 until the first half of 2013. However, the incidence of waterborne diseases, such as acute diarrheal disease, foodborne diseases and typhoid and paratyphoid fever did not decrease during the period 2008-2014; only hepatitis A registered a decrease. Discussion Investment in water supply and sewerage systems is relevant to improve health conditions of the population and to reduce the incidence and prevalence of various health conditions; however, it is necessary to address other aspects such as health education and social empowerment to address this problem more efficiently.(AU)
Subject(s)
Humans , Basic Sanitation/policies , Waterborne Diseases/epidemiology , Water Supply , Sewerage , Epidemiology, Descriptive , Retrospective Studies , Colombia/epidemiologyABSTRACT
Introdução: A água tem sido considerada um importante veículo para a disseminação de surtos de toxoplasmose em vários países. Os oocistos de Toxoplasma gondii podem persistir no ambiente durante longos períodos, sendo altamente resistentes aos vários processos químicos de inativação, inclusive aos processos comuns de desinfecção utilizados pelos sistemas produtores de água. Pouco se tem registrado no país sobre a real extensão da contaminação dos recursos hídricos por Toxoplasma gondii, sendo que a sua detecção em amostras de águas é muito importante na implantação de ações preventivas. As metodologias existentes no momento para identificação e quantificação deste parasita nestes tipos de amostras não estão universalmente padronizadas e apresentam limitações. Objetivo: O presente estudo teve como objetivo verificar a possível presença do protozoário em águas superficiais de abastecimento público no Estado de São Paulo mediante a implantação de uma metodologia específica para a quantificação de oocistos de Toxoplasma gondii por reação quantitativa de PCR em tempo real nessas amostras. Método: Um total de 39 amostras de águas superficiais provenientes de 10 mananciais do Estado de São Paulo foram analisadas durante o período de maio a dezembro de 2015. Volumes de 20L da amostra foram concentrados por meio de filtração em cápsulas Envirocheck® HV (Pall Gelman Laboratory), sendo a cápsula filtrante tratada com uma solução dispersante, eluída e o eluato concentrado por centrifugação. O sedimento obtido após a centrifugação da amostra foi submetido à extração de DNA, sendo utilizado o kit de extração PowerSoil DNA isolation® (MO BIO Laboratories). A sequência alvo selecionada para detecção e quantificação de oocistos de Toxoplasma gondii através da reação quantitativa de PCR em tempo real foi um fragmento de 62 pares de bases do gene B1, sendo utilizado o seguinte conjunto de iniciadores: 5 CTAGTATCGTGCGGCAATGTG 3 (531-551) e 5GGCAGCGTCTCTTCCTCTTTT 3 (571-592). A sonda utilizada foi: 5 (6-FAM) CCACCTCGCCTCTTGG-(NFQ-MGB) 3. Resultados: Do total das amostras analisadas, 7,7 por cento (3/39) foram positivas para oocistos de Toxoplasma gondii e dentre os 10 mananciais estudados, detectou-se a ocorrência do protozoário em 30 por cento (3/10) dos mesmos. Conclusão: Os dados obtidos no presente estudo demonstram que o protozoário Toxoplasma gondii está circulando em águas superficiais de abastecimento público no Estado de São Paulo
Introduction: Water is an important vehicle for the spread of toxoplasmosis outbreaks in several countries. Toxoplasma gondii oocysts may remain for a long period in the environment and are highly resistant to chemical inactivation, including the routine classical disinfection procedures in water treatment facilities. Few reports have been published in Brazil about the real extent of the contamination of water resources by Toxoplasma gondii, which is of major importance to implement preventive actions. Methods for the identification and quantification of the parasite in water bodies are not standardized and have limitations. Objective: This study aimed to verify the presence of these protozoa in surface waters used as source for drinking water production in the State of São Paulo by implementing a specific methodology to quantify Toxoplasma gondii oocysts with quantitative real-time PCR. Method: Thirty nine samples of surface waters from 10 different sites in the State of São Paulo were analized from May to December 2015. Volumes of 20L of each sample were concentrated by filtration with capsule Envirocheck® HV (Pall Gelman Laboratory).The filter capsule was treated with a dispersant solution, eluted, and the eluate concentrated by centrifugation. DNA was extracted from the resulting pellet with PowerSoil DNA isolation® (MO BIO Laboratories) extraction kit. A fragment of 62 base pairs of the B1 gene was selected as target sequence for detection and quantitation the Toxoplasma gondii oocysts by the quantitative real-time PCR reaction, and the following primers: 5\' TAGTATCGTGCGGCAATGTG 3\' (531-551) and 5\'GGCAGCGTCTCTTCCTCTTTT 3\' (571-592) were used. The probe employed was 5 \'(6-FAM) CCACCTCGCCTCTTGG- (NFQ-MGB) 3\'. Results: Toxoplasma gondii oocysts were detected in 30 per cent (3/10) of the sites evaluated and 7.7 per cent (3/39) of all samples analyzed were positive. Conclusion: The results of the present study show that the protozoan Toxoplasma gondii is circulating in surface waters used as drinking water supply in the State of São Paulo
Subject(s)
Oocytes , Toxoplasma , Water Microbiology , Water Supply , DNA , Polymerase Chain Reaction , Waterborne DiseasesABSTRACT
BACKGROUND: Water – related diseases are worldwide health concern. Microbial contamination and contaminant products in water are a source of disease outbreaks and development of cumulative toxic effects. Ensuring safe water is one of the goals to be achieved at the global level. The aim of this study was to assess publications on drinking and recreational water from a health point of view to understand current problems and future research trends in this field. METHODS: Scopus, the largest scientific electronic database, was used to retrieve related articles and present the results as bibliometric tables and maps. Search query was modified manually using related terms to maximize accuracy. RESULTS: A total of 2267 publications were retrieved with an average of 16.82 citations per article. The h-index of retrieved articles was 88. Visual mapping showed that E. coli, diarrhea, cryptosporidiosis, fluoride, arsenic, cancer, chlorine, trihalomethane, and H. pylori were most frequently encountered terms in title and abstract of retrieved articles. The number of articles on water microbiology was a significant (P < 0.01) predictor of worldwide productivity of water – related disease publications. Journal of Water and Health ranked first in number of publications with 136 (6.00 %) articles. The United States of America ranked first in productivity with a total of 623 (27.48 %) articles. Germany (15.44 %), India (16.00 %) and China (20.66 %) had the least international collaboration in water-related disease research. Environmental Protection Agency and Centers for Disease Prevention and Control were among top ten productive institutions. In the top ten cited articles, there were three articles about arsenic, one about aluminum, one about trihalomethane, one about nitrate, one about toxoplasmosis, one about gastroenteritis, and the remaining two articles were general ones. CONCLUSIONS: There was a linear increase in the number of publications on water – related diseases in the last decade. Arsenic, in drinking water is a serious concern. Cryptosporidiosis and other infectious gastroenteritis remain a major health risk of exposure to contaminated water. Increased number of publications from Asian countries was not associated with a high percentage of international collaboration.
Subject(s)
Animals , Humans , Aluminum , Americas , Arsenic , Asian People , Bibliometrics , China , Chlorine , Cooperative Behavior , Cryptosporidiosis , Diarrhea , Disease Outbreaks , Drinking Water , Drinking , Efficiency , Fluorides , Gastroenteritis , Germany , India , Toxoplasmosis , Trihalomethanes , United States , United States Environmental Protection Agency , Water , Water Microbiology , Waterborne DiseasesABSTRACT
Toxoplasma gondii transmission via breastfeeding has been discussed; however, no cases have been confirmed to date. This article describes a case of acute toxoplasmosis diagnosed in a mother and her six-month-old breastfed infant. The study accounts for the possibility of breast milk transmission and directs both clinicians and pediatricians to the hypothesis that both patients acquired toxoplasmosis via water ingestion.
A transmissão do Toxoplasma gondii através do aleitamento materno tem sido discutida; no entanto, até o momento nenhum caso foi confirmado. Este artigo relata um caso de toxoplasmose aguda diagnosticada na mãe e no seu bebê com seis meses de vida, que estava em amamentação exclusiva. Embora apresente a possibilidade de transmissão pelo leite materno, o estudo chama a atenção de clínicos e pediatras para a mais provável hipótese de que ambos adquiriram toxoplasmose pela ingestão de água.