Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 51
Filter
1.
Article in English | WPRIM | ID: wpr-878413

ABSTRACT

OBJECTIVES@#A study was conducted to investigate the molecular mechanism of chromodomain helicase/ATPase DNA binding protein 1-like gene (CHD1L) influencing the invasion and metastasis of tongue squamous cell carcinoma and to provide a new target for clinical inhibition of invasion and metastasis of tongue squamous cell carcinoma.@*METHODS@#Ualcan website was used to analyze the expression of CHD1L in normal epithelial tissue and primary head and neck squamous cell carcinoma and to analyze the effect of lymph node metastasis on the expression of CHD1L in tissues with head and neck squamous cell carcinoma. The relationship between CHD1L expression and the survival rate of patients with head and neck squamous cell carcinoma was tested by the GEPIA website. Western blot was used to quantify the levels of CHD1L protein in human tongue squamous cell carcinoma CAL27 and immortalized human skin keratinocyte cell HaCaT. After knocking down CAL27 in human tongue squamous cell carcinoma cells with an RNA interference plasmid, the cells were designated as SiCHD1L/CAL27 and Scr/CAL27. Western blot was utilized to detect the expression of CHD1L in each group of cells. The change in CAL27 cell proliferation ability was tested by EdU proliferation test after CHD1L knockdown. The change of cell migration ability of each group cells was tested through the wound healing assay. Western blot was used to detect epithelial-mesenchymal transition (EMT) marker E-cadherin and Vimentin protein expression levels.@*RESULTS@#Ualcan database showed that the expression of CHD1L in primary head and neck squamous cell carcinoma tissues was higher than in normal epithelial tissues and in head and neck squamous cell carcinoma tissues with lymph node metastasis. GEPIA website analysis showed that the overall survival rate of patients with head and neck squamous cell carcinoma with high expression of CHD1L was significantly lower than that of patients with low expression. Western blot results showed that CHD1L expression in human tongue squamous carcinoma cells CAL27 was higher than that of human normal skin cells HaCaT. CHD1L expression in SiCHD1L/CAL27 cells was much lower than that in Scr/CAL27 cells. Results of EdU proliferation experiments showed the significant reduction in the cell proliferation ability of the SiCHD1L/CAL27 cells. Results of the wound healing experiments showed the reduction in the migration capacity of the SiCHD1L/CAL27 cells. The expression of E-cadherin increased, whereas that of Vimentin decreased, in SiCHD1L/CAL27 cells.@*CONCLUSIONS@#CHD1L promoted the EMT, proliferation, migration, and invasion ability of tongue squamous cell carcinoma cells.


Subject(s)
Adenosine Triphosphatases , Carcinoma, Squamous Cell/genetics , Cell Line, Tumor , Cell Movement , Cell Proliferation , DNA Helicases , DNA-Binding Proteins , Epithelial-Mesenchymal Transition , Gene Expression Regulation, Neoplastic , Head and Neck Neoplasms , Humans , Neoplasm Invasiveness/genetics , Tongue , Tongue Neoplasms/genetics
2.
Article in Chinese | WPRIM | ID: wpr-880084

ABSTRACT

OBJECTIVE@#To analyze the clinical characteristics and treatment effects of children with acute megakaryoblastic leukemia without down syndrome (non-DS-AMKL).@*METHODS@#The clinical data of 19 children with non-DS-AMKL treated in the Pediatric Hematology Ward in Sun Yat-sen Memorial Hospital of Sun Yat-sen University from May 2008 to April 2018 were analyzed retrospectively. The clinical characteristics, laboratory test and treatment methods of the children were concluded. All patients were followed up to evaluate the effect of treatment.@*RESULTS@#The 19 cases of children included nine male and ten female, the median age of onset was 2 years old. The clinical manifestations showed nonspecific. The median white blood cell of peripheral blood was 15.88×10@*CONCLUSION@#Non-DS-AMKL was rare in children and difficult to be diagnosed. Determination of MICM classification as early as possible was helpful for diagnosis, and genetic testing played an important role for diagnosis and prognosis evaluation. Early hematopoietic stem cell transplantation in patients with CR after chemotherapy might be an effective way to cure AMKL.


Subject(s)
Child , Child, Preschool , DEAD-box RNA Helicases , DNA Helicases , Down Syndrome , Female , Humans , Leukemia, Megakaryoblastic, Acute/genetics , Male , Prognosis , Retrospective Studies , Trisomy
3.
Article in Chinese | WPRIM | ID: wpr-879519

ABSTRACT

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.


Subject(s)
CHARGE Syndrome/genetics , Child , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Genetic Variation , Humans , Mutation , Phenotype
4.
Article in Chinese | WPRIM | ID: wpr-828943

ABSTRACT

OBJECTIVE@#To observe the expression of HELQ and RAD51C in normal endometrial and endometrial stromal sarcoma (ESS) and analyze their correlation with the clinical features of the patients.@*METHODS@#The expressions of HELQ and RAD51C proteins were detected by immunohistochemical staining in normal endometrial tissues (14 cases) and tumor tissues from patients with ESS (37 cases) treated in Hunan Provincial Cancer Hospital from January, 2013 to December, 2016. The correlations of the expressions of the two proteins with the patients'age, FIGO staging, tissue type, tumor size, and lymph node metastasis were analyzed.@*RESULTS@#Immunohistochemical staining showed that the expressions of HELQ and RAD51C were both decreased in ESS patients compared with the normal group, and there was a positive correlation between HELQ and RAD51C expression ( < 0.05). HELQ expression in ESS was correlated with the tumor size and type. The expressions of HELQ and RAD51C were not correlated with the patients' age, FIGO stage and status of lymph node metastasis ( > 0.05).@*CONCLUSIONS@#Homologous recombination- directed DNA repair involving HELQ and RAD51C may participate in the occurrence and progression of ESS.


Subject(s)
DNA Helicases , DNA-Binding Proteins , Endometrial Neoplasms , Endometrium , Female , Humans , Lymphatic Metastasis , Sarcoma, Endometrial Stromal
5.
Article in Chinese | WPRIM | ID: wpr-828524

ABSTRACT

OBJECTIVE@#To observe the expression of HELQ and RAD51C in normal endometrial and endometrial stromal sarcoma (ESS) and analyze their correlation with the clinical features of the patients.@*METHODS@#The expressions of HELQ and RAD51C proteins were detected by immunohistochemical staining in normal endometrial tissues (14 cases) and tumor tissues from patients with ESS (37 cases) treated in Hunan Provincial Cancer Hospital from January, 2013 to December, 2016. The correlations of the expressions of the two proteins with the patients'age, FIGO staging, tissue type, tumor size, and lymph node metastasis were analyzed.@*RESULTS@#Immunohistochemical staining showed that the expressions of HELQ and RAD51C were both decreased in ESS patients compared with the normal group, and there was a positive correlation between HELQ and RAD51C expression ( < 0.05). HELQ expression in ESS was correlated with the tumor size and type. The expressions of HELQ and RAD51C were not correlated with the patients' age, FIGO stage and status of lymph node metastasis ( > 0.05).@*CONCLUSIONS@#Homologous recombination- directed DNA repair involving HELQ and RAD51C may participate in the occurrence and progression of ESS.


Subject(s)
DNA Helicases , Genetics , DNA-Binding Proteins , Genetics , Endometrial Neoplasms , Diagnosis , Endometrium , Female , Gene Expression Regulation, Neoplastic , Humans , Lymphatic Metastasis , Sarcoma, Endometrial Stromal
6.
Rev. chil. pediatr ; 90(5): 533-538, oct. 2019. tab, graf
Article in Spanish | LILACS | ID: biblio-1058180

ABSTRACT

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.


INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.


Subject(s)
Humans , Female , Infant, Newborn , DNA Helicases/genetics , DNA-Binding Proteins/genetics , CHARGE Syndrome/physiopathology , Phenotype , CHARGE Syndrome/diagnosis , CHARGE Syndrome/genetics , Mutation
7.
Journal of Experimental Hematology ; (6): 1001-1007, 2019.
Article in Chinese | WPRIM | ID: wpr-771848

ABSTRACT

OBJECTIVE@#To investigate the methylation status of CHD5 gene promoter in bone marrow from acute myeloid leukemia (AML) patients, and the underlying mechanism for initiating the pathogenesis of AML via p19/p53/p21 pathway.@*METHODS@#Methylation status of the CHD5 gene promoter was detected by using methylation-specific polymerase chain reaction (MSPCR) in bone marrow from AML patients, and the iron-deficiency anemia (IDA) samples were served as control. The expression of CHD5, p19, p53 and p21 was determined by real-time quantitative reverse transcriptase PCR and Western blot.@*RESULTS@#The methylation of CHD5 gene in bone marrow from AML patients increased significantly (39.06%) as compared with control group (6.67%). The methylation of CHD5 gene significantly correlated with chromosome karyotype differentiation (P<0.01), but did not correlate with the patient's sex, age and clinical classification (P>0.05). The mRNA expression of CHD5 gene in AML decreased, compared with control group, the mRNA and protein expression of p19, p53 and p21 in AML with CHD5 methylation promoter decreased.@*CONCLUSION@#The hypermeltylation of CHD5 gene promoter in AML patients can lead to decrease of CHD5, p19, p53 and p21 expression levels which may reduce the inhibitory effect on proliferation of leukemia cells through the regulation of p19, p53 and p21 pathway, thus promotes the occurence of AML.


Subject(s)
Cyclin-Dependent Kinase Inhibitor p16 , Cyclin-Dependent Kinase Inhibitor p21 , DNA Helicases , DNA Methylation , Humans , Leukemia, Myeloid, Acute , Nerve Tissue Proteins , Promoter Regions, Genetic , Tumor Suppressor Protein p53
8.
Protein & Cell ; (12): 333-350, 2018.
Article in English | WPRIM | ID: wpr-757991

ABSTRACT

Hutchinson-Gilford progeria syndrome (HGPS) and Werner syndrome (WS) are two of the best characterized human progeroid syndromes. HGPS is caused by a point mutation in lamin A (LMNA) gene, resulting in the production of a truncated protein product-progerin. WS is caused by mutations in WRN gene, encoding a loss-of-function RecQ DNA helicase. Here, by gene editing we created isogenic human embryonic stem cells (ESCs) with heterozygous (G608G/+) or homozygous (G608G/G608G) LMNA mutation and biallelic WRN knockout, for modeling HGPS and WS pathogenesis, respectively. While ESCs and endothelial cells (ECs) did not present any features of premature senescence, HGPS- and WS-mesenchymal stem cells (MSCs) showed aging-associated phenotypes with different kinetics. WS-MSCs had early-onset mild premature aging phenotypes while HGPS-MSCs exhibited late-onset acute premature aging characterisitcs. Taken together, our study compares and contrasts the distinct pathologies underpinning the two premature aging disorders, and provides reliable stem-cell based models to identify new therapeutic strategies for pathological and physiological aging.


Subject(s)
Aging , Genetics , Physiology , DNA Helicases , Genetics , Human Embryonic Stem Cells , Metabolism , Physiology , Humans , Kinetics , Lamin Type A , Genetics , Mesenchymal Stem Cells , Metabolism , Physiology , Mutation , Progeria , Genetics , Werner Syndrome , Genetics
9.
Chinese Journal of Biotechnology ; (12): 1985-1995, 2018.
Article in Chinese | WPRIM | ID: wpr-771410

ABSTRACT

Several putative transcription factor binding sites (TFBSs) exist in the PCV2 rep gene promoter. To explore if porcine circovirus type 2 (PCV2) could regulate the viral replication by using these TFBSs, we conducted electrophoretic mobility shift assay (EMSA), DNA-pull down and liquid chromatography-tandem mass spectrometric (LC-MS/MS) assays. EMSA confirmed the binding activity of the rep gene promoter with nuclear proteins of host cells. DNA-pull down and LC-MS/MS identified the porcine transcription factor AP-2δ (poTFAP2δ) could bind the PCV2 rep gene promoter. Dual-luciferase reporter assay, quantitative real-time PCR, Western blotting and indirect immunofluorescent assay demonstrated that poTFAP2δ could not only promote the activity of the rep gene promoter, but also enhance the transcription/translation activity of the rep/cap gene and the virus titer of PCV2 during the entire life cycle of PCV2 infection. This study revealed the molecular mechanism of PCV2 using host proteins to enhance the viral replication, provided a new perspective for studying the pathogenic mechanism of PCV2 from virus and host interactions, and provided a theoretical basis for developing highly effective PCV2 vaccines.


Subject(s)
Animals , Cell Line , Chromatography, Liquid , Circoviridae Infections , Circovirus , DNA Helicases , Diabetes Mellitus, Type 2 , Promoter Regions, Genetic , Swine , Tandem Mass Spectrometry , Transcription Factor AP-2 , Virus Replication
10.
Article in Chinese | WPRIM | ID: wpr-687968

ABSTRACT

<p><b>OBJECTIVE</b>To analyze two Chinese pediatric patients with multiple malformations and growth and development delay.</p><p><b>METHODS</b>Both patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.</p><p><b>RESULTS</b>High-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.</p><p><b>CONCLUSION</b>Two patients were diagnosed with CHARGE syndrome by high-throughput sequencing.</p>


Subject(s)
CHARGE Syndrome , Genetics , DNA Helicases , Genetics , DNA-Binding Proteins , Genetics , Genetic Testing , High-Throughput Nucleotide Sequencing , Humans , Infant , Male , Mutation
11.
Braz. j. med. biol. res ; 51(9): e7588, 2018. tab, graf
Article in English | LILACS | ID: biblio-951758

ABSTRACT

Previous studies suggested that chromodomain helicase DNA-binding proteins (CHDs), including CHD 1-8, were associated with several human diseases and cancers including lymphoma, liver cancer, colorectal cancer, stomach cancer, etc. To date, little research on CHD 9 in human cancers has been reported. In this study, we assessed the prognostic value of CHD 9 in patients with colorectal cancer (CRC). We screened for CHD 9 expression using immunohistochemical analysis in 87 surgical CRC specimens and found that the expression was upregulated in 81.5% of the cases, while 7.4% were decreased; in the remaining 11.1% of the cases, levels were not altered. Kaplan-Meier analysis showed that patients with high CHD 9 expression had better prognosis than those with low CHD 9 expression (54.5 vs 32.1%, P=0.034). Subsequently, Cox multi-factor survival regression analysis revealed that expression of CHD 9 protein was an independent predictor for CRC, with a hazard ratio of 0.503 (P=0.028). In addition, we found that CHD 9 expression was positively correlated with MSH2 (rs=0.232, P=0.036). We speculated that CHD9 might be a putative tumor suppressor gene, and could inhibit the development of CRC by participating in DNA repair processes. Our findings suggest that CHD 9 could be a novel prognostic biomarker and a therapeutic target for CRC. Further studies are needed to detect the effect of CHD 9 on cellular function and the expression of mismatch repair genes.


Subject(s)
Humans , Male , Adult , Middle Aged , Aged , Aged, 80 and over , Young Adult , Transcription Factors/metabolism , Colorectal Neoplasms/metabolism , Biomarkers, Tumor/metabolism , DNA-Binding Proteins/metabolism , Prognosis , Transcription Factors/genetics , Immunohistochemistry , Colorectal Neoplasms/genetics , Colorectal Neoplasms/pathology , Biomarkers, Tumor/genetics , Gene Expression Regulation, Neoplastic , Trans-Activators , DNA Helicases , DNA-Binding Proteins/genetics , Kaplan-Meier Estimate , Neoplasm Staging
12.
Article in Chinese | WPRIM | ID: wpr-300420

ABSTRACT

<p><b>OBJECTIVE</b>To investigate the effect of oridonin on the human acute lymphocytic leukemia cell line Jurkat and its mechanism.</p><p><b>METHODS</b>Jurkat cells were cultured in vitro and treated with various concentrations (0, 1.25, 2.5, 5, and 10 μmol/L) of oridonin for different lengths of time (24, 48, and 72 hours). The proliferation of Jurkat cells was analyzed by MTT assay. The changes in nuclear morphology were evaluated by fluorescence microscopy at 12 hours after treatment with various concentrations of oridonin. The expression levels of Brg1, P53, and C-myc were determined by semi-quantitative Western blot in Jurkat cells treated with various concentrations of oridonin for 24 hours or 5 μmol/L oridonin for various lengths of time (0, 2, 6, 12, and 24 hours). The expression levels of P53 and C-myc and proliferation of Jurkat cells were evaluated after Brg1 expression was knocked down by Brg1-specific siRNA.</p><p><b>RESULTS</b>Compared with the control group, the proliferation of oridonin-treated Jurkat cells was significantly inhibited in a concentration- and time-dependent manner (P<0.05). According to the florescence microscopic analysis, oridonin treatment led to nuclear pyknosis in Jurkat cells. Compared with the control group, Jurkat cells treated with 5 μmol/L oridonin had reduced expression of Brg1 and C-myc but elevated expression of P53. Brg1 knock-down led to a significant reduction in proliferation of Jurkat cells (P<0.05), up-regulated expression of P53, and down-regulated expression of C-myc.</p><p><b>CONCLUSIONS</b>Oridonin can inhibit the proliferation of Jurkat cells, probably via the Brg1 signaling pathway.</p>


Subject(s)
Antineoplastic Agents, Phytogenic , Pharmacology , Cell Proliferation , DNA Helicases , Physiology , Diterpenes, Kaurane , Pharmacology , Dose-Response Relationship, Drug , Down-Regulation , Humans , Jurkat Cells , Nuclear Proteins , Physiology , Precursor Cell Lymphoblastic Leukemia-Lymphoma , Drug Therapy , Proto-Oncogene Proteins c-myc , Signal Transduction , Physiology , Transcription Factors , Physiology , Tumor Suppressor Protein p53
13.
Article in Chinese | WPRIM | ID: wpr-246841

ABSTRACT

BRG1 (Brahma-related gene 1, BRG1) is the ATPase subunit of SWI/SNF chromatin remodeling complexes, which plays an important role in cell cycle regulation, DNA repair and tumor development. Unlike the evidence as tumor suppressor genes in the past reports, latest researches show that BRG1 plays an important role in sustaining the growth of leukemia cells in acute myeloid leukemia, and these effects on normal hematopoietic stem cells are dispensable. Further studies of the role and mechanism of BRG1 in acute myeloid leukemia will contribute to the development of a new and promising targeted therapy strategy. This article reviews the role of BRG1 on leukemia cells and leukemia stem cells in AML and discusses the related mechanism, which providing some reference for the targeted treatment strategy of AML.


Subject(s)
Chromatin , Chromatin Assembly and Disassembly , DNA Helicases , Genetics , Humans , Leukemia, Myeloid, Acute , Genetics , Neoplastic Stem Cells , Cell Biology , Nuclear Proteins , Genetics , Transcription Factors , Genetics
14.
Chinese Journal of Pediatrics ; (12): 56-60, 2016.
Article in Chinese | WPRIM | ID: wpr-351449

ABSTRACT

<p><b>OBJECTIVE</b>Cockayne syndrome is a rare disease and difficult to be recognized. This study aimed to expand the knowledge of the clinical and molecular characteristics of the children with Cockayne syndrome (CS).</p><p><b>METHOD</b>Clinical data of two siblings with classic CS of Guangzhou Women and Children's Medical Center from July 2013 to November 2014 were obtained and analyzed. The whole DNA of peripheral blood was collected from two CS siblings and their parents. Amplification of all exons and adjacent introns for ERCC6 gene was conducted using PCR, and measurement of reaction product was performed to find mutation sites by two-way sequencing.</p><p><b>RESULT</b>Two affected siblings were males, and came from unconsanguineous parents, 7 years and 5 months old and 4 years and 8 months old, respectively. They were in treatment because of developmental and mental retardation for years. When they were younger than one year of age, their heights and weight were within normal limits. However, poor growth of height and weight and psychomotor retardation appeared after one and a half years of age, as well as skin and eye sensitivity to sunshine, hearing impairment, optic nerve atrophy, microcephaly, and deep-set eyes. The proband's height was 90.8 cm, and weight 9.1 kg, head circumference 41 cm, and chest circumference 44 cm when he was taken to hospital. The elder brother of the proband had a height of 92 cm, weight 11.2 kg, head circumference 41 cm, and chest circumference 44 cm when he was taken to hospital. When the proband was four and a half years old, ventricular enlargement, hypomyelination, and brain atrophy were detected for his elder brother at 7 years of age by cranial MRI. MRS imaging indicated that damages occurred at the left and right sides of dorsal thalamus, lobus insularis, along with the left half circle of central neurons. Symmetrical calcification on bilateral basal ganglia was found on the brain CT scan. Pathogenic compound heterozygous c. 1357C > T (p.Arg453Ter) and c. 1607T > G (p.Leu536Trp) mutations of ERCC6 gene were identified in the two siblings which were separately inherited from their unaffected parents.</p><p><b>CONCLUSION</b>CS children are usually normal at birth, however, they have severe clinical characteristics such as poor growth, psychomotor retardation, cerebral injury, microcephalus, deep-set eyes, and skin sensitivity to sunshine. ERCC6 gene mutation usually occurs, and it is easy to misdiagnose CS as cerebral palsy, primary microcephaly, and so on.</p>


Subject(s)
Asian Continental Ancestry Group , Child , Child, Preschool , Cockayne Syndrome , Genetics , DNA Helicases , Genetics , DNA Mutational Analysis , DNA Repair Enzymes , Genetics , Exons , Heterozygote , Humans , Magnetic Resonance Imaging , Male , Mutation , Poly-ADP-Ribose Binding Proteins , Polymerase Chain Reaction , Siblings
15.
Article in English | WPRIM | ID: wpr-69709

ABSTRACT

Glioblastoma (GBM) can be classified into molecular subgroups, on the basis of biomarker expression. Here, we classified our cohort of 163 adult GBMs into molecular subgroups according to the expression of proteins encoded by genes of alpha thalassemia/mental retardation syndrome X-linked (ATRX), isocitrate dehydrogenase (IDH) and TP53. We focused on the survival rate of molecular subgroups, depending on each and various combination of these biomarkers. ATRX, IDH1 and p53 protein expression were evaluated immunohistochemically and Kaplan-Meier analysis were carried out in each group. A total of 15.3% of enrolled GBMs demonstrated loss of ATRX expression (ATRX-), 10.4% expressed an aberrant IDH1 R132H protein (IDH1+), and 48.4% exhibited p53 overexpression (p53+). Survival differences were statistically significant when single protein expression or different combinations of expression of these proteins were analyzed. In conclusion, in the case of single protein expression, the patients with each IDH1+, or ATRX-, or p53- GBMs showed better survival than patients with counterparts protein expressed GBMs. In the case of double protein pairs, the patients with ATRX-/p53-, ATRX-/IDH1+, and IDH1+/p53- GBMs revealed better survival than the patients with GBMs with the remained pairs. In the case of triple protein combinations, the patients with ATRX-/p53-/IDH+ showed statistically significant survival gain than the patients with remained combination of proteins-expression status. Therefore, these three biomarkers, individually and as a combination, can stratify GBMs into prognostically relevant subgroups and have strong prognostic values in adult GBMs.


Subject(s)
Adult , Aged , Biomarkers, Tumor/metabolism , Brain Neoplasms/diagnosis , DNA Helicases/metabolism , Disease-Free Survival , Glioblastoma/diagnosis , Humans , Immunohistochemistry , Isocitrate Dehydrogenase/metabolism , Kaplan-Meier Estimate , Middle Aged , Nuclear Proteins/metabolism , Retrospective Studies , Tumor Suppressor Protein p53/genetics , Young Adult
16.
Protein & Cell ; (12): 749-760, 2016.
Article in English | WPRIM | ID: wpr-757388

ABSTRACT

The BCCIP (BRCA2- and CDKN1A-interacting protein) is an important cofactor for BRCA2 in tumor suppression. Although the low expression of BCCIP is observed in multiple clinically diagnosed primary tumor tissues such as ovarian cancer, renal cell carcinoma and colorectal carcinoma, the mechanism of how BCCIP is regulated in cells is still unclear. The human INO80/YY1 chromatin remodeling complex composed of 15 subunits catalyzes ATP-dependent sliding of nucleosomes along DNA. Here, we first report that BCCIP is a novel target gene of the INO80/YY1 complex by presenting a series of experimental evidence. Gene expression studies combined with siRNA knockdown data locked candidate genes including BCCIP of the INO80/YY1 complex. Silencing or over-expressing the subunits of the INO80/YY1 complex regulates the expression level of BCCIP both in mRNA and proteins in cells. Also, the functions of INO80/YY1 complex in regulating the transactivation of BCCIP were confirmed by luciferase reporter assays. Chromatin immunoprecipitation (ChIP) experiments clarify the enrichment of INO80 and YY1 at +0.17 kb downstream of the BCCIP transcriptional start site. However, this enrichment is significantly inhibited by either knocking down INO80 or YY1, suggesting the existence of both INO80 and YY1 is required for recruiting the INO80/YY1 complex to BCCIP promoter region. Our findings strongly indicate that BCCIP is a potential target gene of the INO80/YY1 complex.


Subject(s)
Calcium-Binding Proteins , Genetics , Metabolism , Cell Cycle Proteins , Genetics , Metabolism , Chromatin Assembly and Disassembly , Physiology , DNA Helicases , Genetics , Metabolism , HeLa Cells , Humans , Multiprotein Complexes , Genetics , Metabolism , Nuclear Proteins , Genetics , Metabolism , Promoter Regions, Genetic , Physiology , Transcription, Genetic , Physiology , YY1 Transcription Factor , Genetics , Metabolism
17.
Article in Chinese | WPRIM | ID: wpr-291613

ABSTRACT

<p><b>OBJECTIVE</b>To put the insight into the trichloroethylene (TCE)-induced effect on the differential expression of subcellular proteins in human normal liver cell line (L-02).</p><p><b>METHODS</b>The membrane proteins and nuclear proteins of TCE-treated (8.0 mmol/L) group and controls were extracted by subcellular proteome extraction kit, respectively. The TCE-induced differentially expressions were analyzed by a two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) and matrix-assisted laser desorption/ionization tandem time-of-flight spectrometry (MALDI-TOF-MS). Bioinformatics analysis was used to reveal the biological processes and predict transmembrane domains of differential expressed proteins. The expression of ATP synthase subunit beta (ATP5B), heterogeneous nuclear ribonucleoprotein H2 (hnRNP H2) and far up steam element-binding protein 1 (FUBP1) were measured under TCE treatment by Western blot.</p><p><b>RESULTS</b>After TCE treatment for 24 h in L-02 cells, 14 membrane proteins and 18 nuclear proteins were identified as differential expression. After treated with TCE in concentrations of 0, 2.0, 4.0 and 8.0 mmol/L for 24 h, the relative levels of ATP5B expression were 1.00±0.03, 1.21±0.14, 1.25±0.12 and 1.48±0.17 (F = 8.51, P = 0.007), the relative levels of hnRNP H2 expression were 1.00±0.09, 1.22±0.15, 1.43±0.21, 1.53±0.17 (F = 6.57, P = 0.015), respectively; the relative levels of FUBP1 expression were 1.00±0.11, 0.91±0.07, 0.73±0.04 and 0.67±0.03 (F = 15.81, P = 0.001), respectively, which were consistent with the results in proteomics. The bioinformatics analysis showed that the most dominant biological process were involved in RNA processing (10 proteins, P = 2.46×10(-6)), especially in RNA splicing (9 proteins, P = 1.77×10(-7)).</p><p><b>CONCLUSION</b>The exposure of TCE could alter the expression of membrane proteins and nuclear proteins in L-02 cells. These abnormal expressed proteins involved in RNA splicing would provide novel clues for further understanding of TCE-induced hepatotoxicity.</p>


Subject(s)
Blotting, Western , Cell Line , DNA Helicases , DNA-Binding Proteins , Hepatocytes , Heterogeneous-Nuclear Ribonucleoprotein Group F-H , Humans , Mitochondrial Proton-Translocating ATPases , Proteome , Proteomics , RNA Processing, Post-Transcriptional , Spectrometry, Mass, Matrix-Assisted Laser Desorption-Ionization , Trichloroethylene
18.
Chinese Journal of Pediatrics ; (12): 45-50, 2015.
Article in Chinese | WPRIM | ID: wpr-293876

ABSTRACT

<p><b>OBJECTIVE</b>Schimke immuno-osseous dysplasia (SIOD), is an autosomal recessive inherited disease caused by SMARCAL1 (MIM:20606622) mutations, while in about half of the patients no any mutation in SMARCAL1 could be found. This disease involves multiple systems and is characterized by short and dissymmetric stature with spondyloepiphyseal dysplasia, progressive renal failure, lymphopenia with recurrent infections, and hyperpigmented macules. This study aimed to analyze SMARCAL1 gene of 2 unrelated suspected SIOD children, to make definite diagnosis, and find more SMARCAL1 mutation types of Chinese SIOD.</p><p><b>METHOD</b>Two suspected Chinese Han male SIOD children who visited our hospital from 2008 to 2014, aged 3 y 6 m and 7 y 8 m, both were short and had spondyloepiphyseal dysplasia, progressive renal failure, lymphopenia with recurrent infections. After informed consent, they and their parents's DNA were extracted from blood. PCRs for all 16 exons of SMARCAL1 were performed and PCR products were purified by 2% gel electrophoresis and sequenced directly. Pathogenicity of missense variations was confirmed by SIFT and sequencing SMARCAL1 of fifty normal controls.</p><p><b>RESULT</b>(1) Four gene variations were found in the two children: Two reported missense mutations c.1129G>C, p.Glu377Gln and c.1933C>T, p. Arg645Cys. Two splicing mutations c.1334+1G>A and c.2142-1 G>A were detected. (2) c.1129G>C, p.Glu377Gln were reported as a disease-causing mutations before, but it was an single nucleotide polymorphism (SNP) which was found in 15 of 50 normal controls. (3) Two novel splicing mutations were found in this study: c.1334+1G>A and c.2142-1 G>A.</p><p><b>CONCLUSION</b>(1) We detected 3 disease-causing mutations in 2 SIOD children by SMARCAL1 gene analysis, while 2 splicing mutations were novel mutations. (2) c.1129G>C, p.Glu377Gln was a SNP but not a disease-causing mutation at least in Chinese population.</p>


Subject(s)
Arteriosclerosis , Genetics , Base Sequence , Child , Child, Preschool , DNA Helicases , Genetics , Exons , Humans , Immunologic Deficiency Syndromes , Genetics , Lymphopenia , Male , Mutation , Mutation, Missense , Nephrotic Syndrome , Genetics , Osteochondrodysplasias , Genetics , Polymorphism, Single Nucleotide , Pulmonary Embolism , Genetics , Renal Insufficiency
19.
Chinese Journal of Pathology ; (12): 859-863, 2015.
Article in Chinese | WPRIM | ID: wpr-278512

ABSTRACT

<p><b>OBJECTIVE</b>To study the clinicopathologic features of small cell carcinoma of ovary, hypercalcemic type (SCCOHT) and to evaluate the diagnostic significance of loss of SMARCA4 expression.</p><p><b>METHODS</b>The clinicopathologic characteristics of 5 cases of SCCOHT were reviewed. The expression of SMARCA4 protein was detected by immunohistochemistry in the cases of SCCOHT and 240 cases of other primary malignant tumors of ovary and peritoneum.</p><p><b>RESULTS</b>The mean and medium age of these patients was 30 years and 28 years, respectively. The presenting symptoms included abdominal pain, distention and a pelvic mass. Hypercalcemia was found in 3 patients. The maximum diameter of tumors ranged from 13.5 to 22.0 cm. Extraovarian spread was demonstrated in all of the patients on presentation. Histologically, the tumors were composed of closely packed small round cells with scanty cytoplasm, hyperchromatic nuclei and irregular chromatin clumps. The tumor cells grew in sheets, nests, cords or trabecular pattern. Follicle-like spaces were observed in 4 cases. Three of the tumors contained large cells with abundant eosinophilic cytoplasm. Spindle cell morphology was found in 1 case. There were 2 cases with myxoid or hyaline stroma. Four out of five of SCCOHT cases showed loss of SMARCA4 protein while only 6.3% (15/240) of the other primary malignant tumors of ovary and peritoneum , including undifferentiated carcinoma (1/5), high-grade serous carcinoma (4.6%, 5/109), endometrioid carcinoma (7.7%, 2/26), clear cell carcinoma (1/9), mucinous carcinoma (1/5), mixed carcinoma (4.9%, 3/61), carcinosarcoma (1/9) and high-grade serous carcinoma of peritoneum (1/9), were negative.</p><p><b>CONCLUSIONS</b>SCCOHT is a rare malignant tumor and often misdiagnosed as other types of ovarian small cell tumor. Loss expression of SMARCA4 protein is characteristic and facilitates the diagnosis and differential diagnosis of SCCOHT.</p>


Subject(s)
Adenocarcinoma, Mucinous , Adult , Carcinoma, Small Cell , Genetics , Metabolism , Pathology , DNA Helicases , Genetics , Metabolism , Female , Humans , Hypercalcemia , Pathology , Immunohistochemistry , Neoplasms, Glandular and Epithelial , Genetics , Metabolism , Pathology , Nuclear Proteins , Genetics , Metabolism , Ovarian Neoplasms , Genetics , Metabolism , Pathology , Transcription Factors , Genetics , Metabolism
20.
Article in English | WPRIM | ID: wpr-64356

ABSTRACT

CHARGE syndrome MIM #214800 is an autosomal dominant syndrome involving multiple congenital malformations. Clinical symptoms include coloboma, heart defects, choanal atresia, retardation of growth or development, genital hypoplasia, and ear anomalies or deafness. Mutations in the chromodomain helicase DNA binding protein 7 (CHD7) gene have been found in 65-70% of CHARGE syndrome patients. Here, we describe a 16-month-old boy with typical CHARGE syndrome, who was referred for CHD7 gene analysis. Sequence analysis and multiplex ligation-dependent probe amplification were performed. A heterozygous 38,304-bp deletion encompassing exon 3 with a 4-bp insertion was identified. There were no Alu sequences adjacent to the breakpoints, and no sequence microhomology was observed at the junction. Therefore, this large deletion may have been mediated by non-homologous end joining. The mechanism of the deletion in the current case differs from the previously suggested mechanisms underlying large deletions or complex genomic rearrangements in the CHD7 gene, and this is the first report of CHD7 deletion by this mechanism worldwide.


Subject(s)
Alu Elements/genetics , Base Sequence , CHARGE Syndrome/diagnosis , DNA/chemistry , DNA End-Joining Repair , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Exons , Gene Dosage , Heterozygote , Humans , Infant , Male , Multiplex Polymerase Chain Reaction , Mutation , Sequence Analysis, DNA , Sequence Deletion
SELECTION OF CITATIONS
SEARCH DETAIL