Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.

m7G-lncRNAs are potential biomarkers for prognosis and tumor microenvironment in patients with colon cancer / 南方医科大学学报

OBJECTIVE@#To assess the value of m7G-lncRNAs in predicting the prognosis and microenvironment of colorectal cancer (CRC).@*METHODS@#We screened m7G-lncRNAs from TCGA to construct an m7G-lncRNAs risk model using multivariate Cox analysis, which was validated using ROC and C-index curves. Calibration and nomogram were used to predict the prognosis of CRC patients. Point-bar charts and K-M survival curves were used to assess the correlation of risk scores with the patients' clinical staging and prognosis. CIBERSORT and ESTIMATE were used to explore the association between the tumor microenvironment and immune cell infiltration in patients in high and low risk groups and the correlation of risk scores with microsatellite instability, stem cell index and immune checkpoint expression. A protein-protein interaction network was constructed, and the key targets regulated by m7G-lncRNAs were identified and validated in paired samples of CRC and adjacent tissues by immunoblotting.@*RESULTS@#We identified a total of 1722 m7G-lncRNAs from TCGA database, from which 12 lncRNAs were screened to construct the risk model. The AUCs of the risk model for predicting survival outcomes at 1, 3 and 5 years were 0.727, 0.747 and 0.794, respectively. The AUC of the nomogram for predicting prognosis was 0.794, and the predicted results were consistent with actual survival outcomes of the patients. The patients in the high-risk group showed more advanced tumor stages and a greater likelihood of high microsatellite instability than those in the low-risk group (P < 0.05). The tumor stemness index was negatively correlated with the risk score (r=-0.19; P=7.3e-05). Patients in the high-risk group had higher stromal cell scores (P=0.0028) and higher total scores (P=0.007) with lowered expressions of activated mast cells (r=-0.11; P=0.045) and resting CD4+ T cells (r=-0.14; P=0.01) and increased expressions of most immune checkpoints (P < 0.05). ATXN2 (P= 0.006) and G3BP1 (P=0.007) were identified as the key targets regulated by m7G-lncRNAs, and their expressions were both higher in CRC than in adjacent tissues.@*CONCLUSION@#The risk model based on 12 m7G-lncRNAs has important prognostic value for CRC and can reflect the microenvironment and the efficacy of immunotherapy in the patients.

Effect of chromodomain helicase/ATPase DNA binding protein 1-like gene on the invasion and metastasis of tongue squamous cell carcinoma CAL27 cells / 华西口腔医学杂志

OBJECTIVES@#A study was conducted to investigate the molecular mechanism of chromodomain helicase/ATPase DNA binding protein 1-like gene (CHD1L) influencing the invasion and metastasis of tongue squamous cell carcinoma and to provide a new target for clinical inhibition of invasion and metastasis of tongue squamous cell carcinoma.@*METHODS@#Ualcan website was used to analyze the expression of CHD1L in normal epithelial tissue and primary head and neck squamous cell carcinoma and to analyze the effect of lymph node metastasis on the expression of CHD1L in tissues with head and neck squamous cell carcinoma. The relationship between CHD1L expression and the survival rate of patients with head and neck squamous cell carcinoma was tested by the GEPIA website. Western blot was used to quantify the levels of CHD1L protein in human tongue squamous cell carcinoma CAL27 and immortalized human skin keratinocyte cell HaCaT. After knocking down CAL27 in human tongue squamous cell carcinoma cells with an RNA interference plasmid, the cells were designated as SiCHD1L/CAL27 and Scr/CAL27. Western blot was utilized to detect the expression of CHD1L in each group of cells. The change in CAL27 cell proliferation ability was tested by EdU proliferation test after CHD1L knockdown. The change of cell migration ability of each group cells was tested through the wound healing assay. Western blot was used to detect epithelial-mesenchymal transition (EMT) marker E-cadherin and Vimentin protein expression levels.@*RESULTS@#Ualcan database showed that the expression of CHD1L in primary head and neck squamous cell carcinoma tissues was higher than in normal epithelial tissues and in head and neck squamous cell carcinoma tissues with lymph node metastasis. GEPIA website analysis showed that the overall survival rate of patients with head and neck squamous cell carcinoma with high expression of CHD1L was significantly lower than that of patients with low expression. Western blot results showed that CHD1L expression in human tongue squamous carcinoma cells CAL27 was higher than that of human normal skin cells HaCaT. CHD1L expression in SiCHD1L/CAL27 cells was much lower than that in Scr/CAL27 cells. Results of EdU proliferation experiments showed the significant reduction in the cell proliferation ability of the SiCHD1L/CAL27 cells. Results of the wound healing experiments showed the reduction in the migration capacity of the SiCHD1L/CAL27 cells. The expression of E-cadherin increased, whereas that of Vimentin decreased, in SiCHD1L/CAL27 cells.@*CONCLUSIONS@#CHD1L promoted the EMT, proliferation, migration, and invasion ability of tongue squamous cell carcinoma cells.

Analysis of Clinical Characteristics and Prognosis in Children with Acute Megakaryoblastic Leukemia without Down Syndrome / 中国实验血液学杂志

OBJECTIVE@#To analyze the clinical characteristics and treatment effects of children with acute megakaryoblastic leukemia without down syndrome (non-DS-AMKL).@*METHODS@#The clinical data of 19 children with non-DS-AMKL treated in the Pediatric Hematology Ward in Sun Yat-sen Memorial Hospital of Sun Yat-sen University from May 2008 to April 2018 were analyzed retrospectively. The clinical characteristics, laboratory test and treatment methods of the children were concluded. All patients were followed up to evaluate the effect of treatment.@*RESULTS@#The 19 cases of children included nine male and ten female, the median age of onset was 2 years old. The clinical manifestations showed nonspecific. The median white blood cell of peripheral blood was 15.88×10@*CONCLUSION@#Non-DS-AMKL was rare in children and difficult to be diagnosed. Determination of MICM classification as early as possible was helpful for diagnosis, and genetic testing played an important role for diagnosis and prognosis evaluation. Early hematopoietic stem cell transplantation in patients with CR after chemotherapy might be an effective way to cure AMKL.

Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Expressions of HELQ and RAD51C in endometrial stromal sarcoma and their clinical significance / 南方医科大学学报

OBJECTIVE@#To observe the expression of HELQ and RAD51C in normal endometrial and endometrial stromal sarcoma (ESS) and analyze their correlation with the clinical features of the patients.@*METHODS@#The expressions of HELQ and RAD51C proteins were detected by immunohistochemical staining in normal endometrial tissues (14 cases) and tumor tissues from patients with ESS (37 cases) treated in Hunan Provincial Cancer Hospital from January, 2013 to December, 2016. The correlations of the expressions of the two proteins with the patients'age, FIGO staging, tissue type, tumor size, and lymph node metastasis were analyzed.@*RESULTS@#Immunohistochemical staining showed that the expressions of HELQ and RAD51C were both decreased in ESS patients compared with the normal group, and there was a positive correlation between HELQ and RAD51C expression ( < 0.05). HELQ expression in ESS was correlated with the tumor size and type. The expressions of HELQ and RAD51C were not correlated with the patients' age, FIGO stage and status of lymph node metastasis ( > 0.05).@*CONCLUSIONS@#Homologous recombination- directed DNA repair involving HELQ and RAD51C may participate in the occurrence and progression of ESS.

Expressions of HELQ and RAD51C in endometrial stromal sarcoma and their clinical significance / 浙江大学学报·医学版

OBJECTIVE@#To observe the expression of HELQ and RAD51C in normal endometrial and endometrial stromal sarcoma (ESS) and analyze their correlation with the clinical features of the patients.@*METHODS@#The expressions of HELQ and RAD51C proteins were detected by immunohistochemical staining in normal endometrial tissues (14 cases) and tumor tissues from patients with ESS (37 cases) treated in Hunan Provincial Cancer Hospital from January, 2013 to December, 2016. The correlations of the expressions of the two proteins with the patients'age, FIGO staging, tissue type, tumor size, and lymph node metastasis were analyzed.@*RESULTS@#Immunohistochemical staining showed that the expressions of HELQ and RAD51C were both decreased in ESS patients compared with the normal group, and there was a positive correlation between HELQ and RAD51C expression ( < 0.05). HELQ expression in ESS was correlated with the tumor size and type. The expressions of HELQ and RAD51C were not correlated with the patients' age, FIGO stage and status of lymph node metastasis ( > 0.05).@*CONCLUSIONS@#Homologous recombination- directed DNA repair involving HELQ and RAD51C may participate in the occurrence and progression of ESS.

Espectro fenotípico de Síndrome de CHARGE neonatal / Phenotypic spectrum of neonatal CHARGE syndrome

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.

INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.

Methylation of CHD5 Gene Promoter Regulates p19/p53/p21 Pathway to Facilitate Pathogenesis of Acute Myeloid Leukemia / 中国实验血液学杂志

OBJECTIVE@#To investigate the methylation status of CHD5 gene promoter in bone marrow from acute myeloid leukemia (AML) patients, and the underlying mechanism for initiating the pathogenesis of AML via p19/p53/p21 pathway.@*METHODS@#Methylation status of the CHD5 gene promoter was detected by using methylation-specific polymerase chain reaction (MSPCR) in bone marrow from AML patients, and the iron-deficiency anemia (IDA) samples were served as control. The expression of CHD5, p19, p53 and p21 was determined by real-time quantitative reverse transcriptase PCR and Western blot.@*RESULTS@#The methylation of CHD5 gene in bone marrow from AML patients increased significantly (39.06%) as compared with control group (6.67%). The methylation of CHD5 gene significantly correlated with chromosome karyotype differentiation (P＜0.01), but did not correlate with the patient's sex, age and clinical classification (P＞0.05). The mRNA expression of CHD5 gene in AML decreased, compared with control group, the mRNA and protein expression of p19, p53 and p21 in AML with CHD5 methylation promoter decreased.@*CONCLUSION@#The hypermeltylation of CHD5 gene promoter in AML patients can lead to decrease of CHD5, p19, p53 and p21 expression levels which may reduce the inhibitory effect on proliferation of leukemia cells through the regulation of p19, p53 and p21 pathway, thus promotes the occurence of AML.

Decreased expression of chromodomain helicase DNA-binding protein 9 is a novel independent prognostic biomarker for colorectal cancer

Previous studies suggested that chromodomain helicase DNA-binding proteins (CHDs), including CHD 1-8, were associated with several human diseases and cancers including lymphoma, liver cancer, colorectal cancer, stomach cancer, etc. To date, little research on CHD 9 in human cancers has been reported. In this study, we assessed the prognostic value of CHD 9 in patients with colorectal cancer (CRC). We screened for CHD 9 expression using immunohistochemical analysis in 87 surgical CRC specimens and found that the expression was upregulated in 81.5% of the cases, while 7.4% were decreased; in the remaining 11.1% of the cases, levels were not altered. Kaplan-Meier analysis showed that patients with high CHD 9 expression had better prognosis than those with low CHD 9 expression (54.5 vs 32.1%, P=0.034). Subsequently, Cox multi-factor survival regression analysis revealed that expression of CHD 9 protein was an independent predictor for CRC, with a hazard ratio of 0.503 (P=0.028). In addition, we found that CHD 9 expression was positively correlated with MSH2 (rs=0.232, P=0.036). We speculated that CHD9 might be a putative tumor suppressor gene, and could inhibit the development of CRC by participating in DNA repair processes. Our findings suggest that CHD 9 could be a novel prognostic biomarker and a therapeutic target for CRC. Further studies are needed to detect the effect of CHD 9 on cellular function and the expression of mismatch repair genes.

Genetic analysis of two children patients affected with CHARGE syndrome / 中华医学遗传学杂志

<p><b>OBJECTIVE</b>To analyze two Chinese pediatric patients with multiple malformations and growth and development delay.</p><p><b>METHODS</b>Both patients were subjected to targeted gene sequencing, and the results were analyzed with Ingenuity Variant Analysis software. Suspected pathogenic variations were verified by Sanger sequencing.</p><p><b>RESULTS</b>High-throughput sequencing showed that both patients have carried heterozygous variants of the CHD7 gene. Patient 1 carried a nonsense mutation in exon 36 (c.7957C>T, p.Arg2653*), while patient 2 carried a nonsense mutation of exon 2 (c.718C>T, p.Gln240*). Sanger sequencing confirmed the above mutations in both patients, while their parents were of wild-type for the corresponding sites, indicating that the two mutations have happened de novo.</p><p><b>CONCLUSION</b>Two patients were diagnosed with CHARGE syndrome by high-throughput sequencing.</p>

Porcine transcription factor AP-2δ promotes porcine circovirus type 2 replication through enhancing the activity of the rep gene promoter / 生物工程学报

Several putative transcription factor binding sites (TFBSs) exist in the PCV2 rep gene promoter. To explore if porcine circovirus type 2 (PCV2) could regulate the viral replication by using these TFBSs, we conducted electrophoretic mobility shift assay (EMSA), DNA-pull down and liquid chromatography-tandem mass spectrometric (LC-MS/MS) assays. EMSA confirmed the binding activity of the rep gene promoter with nuclear proteins of host cells. DNA-pull down and LC-MS/MS identified the porcine transcription factor AP-2δ (poTFAP2δ) could bind the PCV2 rep gene promoter. Dual-luciferase reporter assay, quantitative real-time PCR, Western blotting and indirect immunofluorescent assay demonstrated that poTFAP2δ could not only promote the activity of the rep gene promoter, but also enhance the transcription/translation activity of the rep/cap gene and the virus titer of PCV2 during the entire life cycle of PCV2 infection. This study revealed the molecular mechanism of PCV2 using host proteins to enhance the viral replication, provided a new perspective for studying the pathogenic mechanism of PCV2 from virus and host interactions, and provided a theoretical basis for developing highly effective PCV2 vaccines.

Differential stem cell aging kinetics in Hutchinson-Gilford progeria syndrome and Werner syndrome

Hutchinson-Gilford progeria syndrome (HGPS) and Werner syndrome (WS) are two of the best characterized human progeroid syndromes. HGPS is caused by a point mutation in lamin A (LMNA) gene, resulting in the production of a truncated protein product-progerin. WS is caused by mutations in WRN gene, encoding a loss-of-function RecQ DNA helicase. Here, by gene editing we created isogenic human embryonic stem cells (ESCs) with heterozygous (G608G/+) or homozygous (G608G/G608G) LMNA mutation and biallelic WRN knockout, for modeling HGPS and WS pathogenesis, respectively. While ESCs and endothelial cells (ECs) did not present any features of premature senescence, HGPS- and WS-mesenchymal stem cells (MSCs) showed aging-associated phenotypes with different kinetics. WS-MSCs had early-onset mild premature aging phenotypes while HGPS-MSCs exhibited late-onset acute premature aging characterisitcs. Taken together, our study compares and contrasts the distinct pathologies underpinning the two premature aging disorders, and provides reliable stem-cell based models to identify new therapeutic strategies for pathological and physiological aging.

Oridonin inhibits proliferation of Jurkat cells via the down-regulation of Brg1 / 中国当代儿科杂志

<p><b>OBJECTIVE</b>To investigate the effect of oridonin on the human acute lymphocytic leukemia cell line Jurkat and its mechanism.</p><p><b>METHODS</b>Jurkat cells were cultured in vitro and treated with various concentrations (0, 1.25, 2.5, 5, and 10 μmol/L) of oridonin for different lengths of time (24, 48, and 72 hours). The proliferation of Jurkat cells was analyzed by MTT assay. The changes in nuclear morphology were evaluated by fluorescence microscopy at 12 hours after treatment with various concentrations of oridonin. The expression levels of Brg1, P53, and C-myc were determined by semi-quantitative Western blot in Jurkat cells treated with various concentrations of oridonin for 24 hours or 5 μmol/L oridonin for various lengths of time (0, 2, 6, 12, and 24 hours). The expression levels of P53 and C-myc and proliferation of Jurkat cells were evaluated after Brg1 expression was knocked down by Brg1-specific siRNA.</p><p><b>RESULTS</b>Compared with the control group, the proliferation of oridonin-treated Jurkat cells was significantly inhibited in a concentration- and time-dependent manner (P<0.05). According to the florescence microscopic analysis, oridonin treatment led to nuclear pyknosis in Jurkat cells. Compared with the control group, Jurkat cells treated with 5 μmol/L oridonin had reduced expression of Brg1 and C-myc but elevated expression of P53. Brg1 knock-down led to a significant reduction in proliferation of Jurkat cells (P<0.05), up-regulated expression of P53, and down-regulated expression of C-myc.</p><p><b>CONCLUSIONS</b>Oridonin can inhibit the proliferation of Jurkat cells, probably via the Brg1 signaling pathway.</p>

Clinical and molecular analysis of two Chinese siblings with Cockayne syndrome / 中华儿科杂志

<p><b>OBJECTIVE</b>Cockayne syndrome is a rare disease and difficult to be recognized. This study aimed to expand the knowledge of the clinical and molecular characteristics of the children with Cockayne syndrome (CS).</p><p><b>METHOD</b>Clinical data of two siblings with classic CS of Guangzhou Women and Children's Medical Center from July 2013 to November 2014 were obtained and analyzed. The whole DNA of peripheral blood was collected from two CS siblings and their parents. Amplification of all exons and adjacent introns for ERCC6 gene was conducted using PCR, and measurement of reaction product was performed to find mutation sites by two-way sequencing.</p><p><b>RESULT</b>Two affected siblings were males, and came from unconsanguineous parents, 7 years and 5 months old and 4 years and 8 months old, respectively. They were in treatment because of developmental and mental retardation for years. When they were younger than one year of age, their heights and weight were within normal limits. However, poor growth of height and weight and psychomotor retardation appeared after one and a half years of age, as well as skin and eye sensitivity to sunshine, hearing impairment, optic nerve atrophy, microcephaly, and deep-set eyes. The proband's height was 90.8 cm, and weight 9.1 kg, head circumference 41 cm, and chest circumference 44 cm when he was taken to hospital. The elder brother of the proband had a height of 92 cm, weight 11.2 kg, head circumference 41 cm, and chest circumference 44 cm when he was taken to hospital. When the proband was four and a half years old, ventricular enlargement, hypomyelination, and brain atrophy were detected for his elder brother at 7 years of age by cranial MRI. MRS imaging indicated that damages occurred at the left and right sides of dorsal thalamus, lobus insularis, along with the left half circle of central neurons. Symmetrical calcification on bilateral basal ganglia was found on the brain CT scan. Pathogenic compound heterozygous c. 1357C > T (p.Arg453Ter) and c. 1607T > G (p.Leu536Trp) mutations of ERCC6 gene were identified in the two siblings which were separately inherited from their unaffected parents.</p><p><b>CONCLUSION</b>CS children are usually normal at birth, however, they have severe clinical characteristics such as poor growth, psychomotor retardation, cerebral injury, microcephalus, deep-set eyes, and skin sensitivity to sunshine. ERCC6 gene mutation usually occurs, and it is easy to misdiagnose CS as cerebral palsy, primary microcephaly, and so on.</p>

Human INO80/YY1 chromatin remodeling complex transcriptionally regulates the BRCA2- and CDKN1A-interacting protein (BCCIP) in cells

The BCCIP (BRCA2- and CDKN1A-interacting protein) is an important cofactor for BRCA2 in tumor suppression. Although the low expression of BCCIP is observed in multiple clinically diagnosed primary tumor tissues such as ovarian cancer, renal cell carcinoma and colorectal carcinoma, the mechanism of how BCCIP is regulated in cells is still unclear. The human INO80/YY1 chromatin remodeling complex composed of 15 subunits catalyzes ATP-dependent sliding of nucleosomes along DNA. Here, we first report that BCCIP is a novel target gene of the INO80/YY1 complex by presenting a series of experimental evidence. Gene expression studies combined with siRNA knockdown data locked candidate genes including BCCIP of the INO80/YY1 complex. Silencing or over-expressing the subunits of the INO80/YY1 complex regulates the expression level of BCCIP both in mRNA and proteins in cells. Also, the functions of INO80/YY1 complex in regulating the transactivation of BCCIP were confirmed by luciferase reporter assays. Chromatin immunoprecipitation (ChIP) experiments clarify the enrichment of INO80 and YY1 at +0.17 kb downstream of the BCCIP transcriptional start site. However, this enrichment is significantly inhibited by either knocking down INO80 or YY1, suggesting the existence of both INO80 and YY1 is required for recruiting the INO80/YY1 complex to BCCIP promoter region. Our findings strongly indicate that BCCIP is a potential target gene of the INO80/YY1 complex.

Research Progress on the Role of Chromatin Remodeling Factor BRG1 in Acute Myeloid Leukemia / 中国实验血液学杂志

BRG1 (Brahma-related gene 1, BRG1) is the ATPase subunit of SWI/SNF chromatin remodeling complexes, which plays an important role in cell cycle regulation, DNA repair and tumor development. Unlike the evidence as tumor suppressor genes in the past reports, latest researches show that BRG1 plays an important role in sustaining the growth of leukemia cells in acute myeloid leukemia, and these effects on normal hematopoietic stem cells are dispensable. Further studies of the role and mechanism of BRG1 in acute myeloid leukemia will contribute to the development of a new and promising targeted therapy strategy. This article reviews the role of BRG1 on leukemia cells and leukemia stem cells in AML and discusses the related mechanism, which providing some reference for the targeted treatment strategy of AML.

Immunohistochemical Analysis of ATRX, IDH1 and p53 in Glioblastoma and Their Correlations with Patient Survival

Glioblastoma (GBM) can be classified into molecular subgroups, on the basis of biomarker expression. Here, we classified our cohort of 163 adult GBMs into molecular subgroups according to the expression of proteins encoded by genes of alpha thalassemia/mental retardation syndrome X-linked (ATRX), isocitrate dehydrogenase (IDH) and TP53. We focused on the survival rate of molecular subgroups, depending on each and various combination of these biomarkers. ATRX, IDH1 and p53 protein expression were evaluated immunohistochemically and Kaplan-Meier analysis were carried out in each group. A total of 15.3% of enrolled GBMs demonstrated loss of ATRX expression (ATRX-), 10.4% expressed an aberrant IDH1 R132H protein (IDH1+), and 48.4% exhibited p53 overexpression (p53+). Survival differences were statistically significant when single protein expression or different combinations of expression of these proteins were analyzed. In conclusion, in the case of single protein expression, the patients with each IDH1+, or ATRX-, or p53- GBMs showed better survival than patients with counterparts protein expressed GBMs. In the case of double protein pairs, the patients with ATRX-/p53-, ATRX-/IDH1+, and IDH1+/p53- GBMs revealed better survival than the patients with GBMs with the remained pairs. In the case of triple protein combinations, the patients with ATRX-/p53-/IDH+ showed statistically significant survival gain than the patients with remained combination of proteins-expression status. Therefore, these three biomarkers, individually and as a combination, can stratify GBMs into prognostically relevant subgroups and have strong prognostic values in adult GBMs.

Investigation of trichloroethylene-induced effects on subcellular proteomes in L-02 hepatic cells / 中华预防医学杂志

<p><b>OBJECTIVE</b>To put the insight into the trichloroethylene (TCE)-induced effect on the differential expression of subcellular proteins in human normal liver cell line (L-02).</p><p><b>METHODS</b>The membrane proteins and nuclear proteins of TCE-treated (8.0 mmol/L) group and controls were extracted by subcellular proteome extraction kit, respectively. The TCE-induced differentially expressions were analyzed by a two-dimensional fluorescence difference gel electrophoresis (2D-DIGE) and matrix-assisted laser desorption/ionization tandem time-of-flight spectrometry (MALDI-TOF-MS). Bioinformatics analysis was used to reveal the biological processes and predict transmembrane domains of differential expressed proteins. The expression of ATP synthase subunit beta (ATP5B), heterogeneous nuclear ribonucleoprotein H2 (hnRNP H2) and far up steam element-binding protein 1 (FUBP1) were measured under TCE treatment by Western blot.</p><p><b>RESULTS</b>After TCE treatment for 24 h in L-02 cells, 14 membrane proteins and 18 nuclear proteins were identified as differential expression. After treated with TCE in concentrations of 0, 2.0, 4.0 and 8.0 mmol/L for 24 h, the relative levels of ATP5B expression were 1.00±0.03, 1.21±0.14, 1.25±0.12 and 1.48±0.17 (F = 8.51, P = 0.007), the relative levels of hnRNP H2 expression were 1.00±0.09, 1.22±0.15, 1.43±0.21, 1.53±0.17 (F = 6.57, P = 0.015), respectively; the relative levels of FUBP1 expression were 1.00±0.11, 0.91±0.07, 0.73±0.04 and 0.67±0.03 (F = 15.81, P = 0.001), respectively, which were consistent with the results in proteomics. The bioinformatics analysis showed that the most dominant biological process were involved in RNA processing (10 proteins, P = 2.46×10(-6)), especially in RNA splicing (9 proteins, P = 1.77×10(-7)).</p><p><b>CONCLUSION</b>The exposure of TCE could alter the expression of membrane proteins and nuclear proteins in L-02 cells. These abnormal expressed proteins involved in RNA splicing would provide novel clues for further understanding of TCE-induced hepatotoxicity.</p>

SMARCAL1 gene analysis of 2 Chinese Schimke immuno-osseous dysplasia children / 中华儿科杂志

<p><b>OBJECTIVE</b>Schimke immuno-osseous dysplasia (SIOD), is an autosomal recessive inherited disease caused by SMARCAL1 (MIM:20606622) mutations, while in about half of the patients no any mutation in SMARCAL1 could be found. This disease involves multiple systems and is characterized by short and dissymmetric stature with spondyloepiphyseal dysplasia, progressive renal failure, lymphopenia with recurrent infections, and hyperpigmented macules. This study aimed to analyze SMARCAL1 gene of 2 unrelated suspected SIOD children, to make definite diagnosis, and find more SMARCAL1 mutation types of Chinese SIOD.</p><p><b>METHOD</b>Two suspected Chinese Han male SIOD children who visited our hospital from 2008 to 2014, aged 3 y 6 m and 7 y 8 m, both were short and had spondyloepiphyseal dysplasia, progressive renal failure, lymphopenia with recurrent infections. After informed consent, they and their parents's DNA were extracted from blood. PCRs for all 16 exons of SMARCAL1 were performed and PCR products were purified by 2% gel electrophoresis and sequenced directly. Pathogenicity of missense variations was confirmed by SIFT and sequencing SMARCAL1 of fifty normal controls.</p><p><b>RESULT</b>(1) Four gene variations were found in the two children: Two reported missense mutations c.1129G>C, p.Glu377Gln and c.1933C>T, p. Arg645Cys. Two splicing mutations c.1334+1G>A and c.2142-1 G>A were detected. (2) c.1129G>C, p.Glu377Gln were reported as a disease-causing mutations before, but it was an single nucleotide polymorphism (SNP) which was found in 15 of 50 normal controls. (3) Two novel splicing mutations were found in this study: c.1334+1G>A and c.2142-1 G>A.</p><p><b>CONCLUSION</b>(1) We detected 3 disease-causing mutations in 2 SIOD children by SMARCAL1 gene analysis, while 2 splicing mutations were novel mutations. (2) c.1129G>C, p.Glu377Gln was a SNP but not a disease-causing mutation at least in Chinese population.</p>