Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 64
Filter
1.
Chinese Journal of Pathology ; (12): 52-57, 2024.
Article in Chinese | WPRIM | ID: wpr-1012424

ABSTRACT

Objective: To investigate the clinicopathological features and treatment of gastric alpha-fetoprotein (AFP)-producing adenocarcinoma with SWI/SNF complex deletion. Methods: Four cases of gastric AFP-producing adenocarcinoma with SWI/SNF complex deletion diagnosed in Zhongshan Hospital of Fudan University from January 2021 to December 2022 were collected, and their histomorphological characteristics, immunohistochemical (IHC), in situ hybridization of Epstein-Barr virus-encoded RNA (EBER), next-generation sequencing results, clinicopathological features and treatment were summarized, and literature review was conducted. Results: Among the 4 patients, there were three males and one female. They presented with abdominal pain, belching and melena. Serum AFP was significantly elevated in three patients, and endoscopy showed ulcerative lesions. Microscopically, the tumor cells showed mainly diffuse flaky or nest-like growth and typical characteristics of hepatoid adenocarcinoma. In two cases there were adenoid growth, and the tumor cells in these areas possessed clear cytoplasm, suggesting enteroblastic differentiation. The tumor cell nuclei were pleomorphic with large nucleoli and brisk mitoses. The IHC results showed that the tumor cells expressed AFP, GPC3 and SALL4, and there was retained expression of broad-spectrum keratin (CKpan) and E-cadherin. IHC detection of SWI/SNF complex subunits, namely INI1 (SMARCB1), BRG1 (SMARCA4), BRM (SMARCA2), ARID1A protein was performed. In all four cases the hepatoid adenocarcinoma region and enteroblastic differentiation region showed SMARCA2 deletion, and one case with enteroblastic differentiation also showed ARID1A deletion. SMARCB1 and SMARCA4 deletions were not seen. All the four cases were diffusely positive for p53 protein, and the Ki-67 proliferation index was 80%-90%. There were no mismatch repair deletion detected; one cases showed HER2 was strongly positive (3+), and EBER was negative. None of the four cases had mutations in the SWI/SNF complex-related subunits detected by next-generation sequencing. Among the four patients, two underwent palliative surgery due to distant metastasis at the time of surgery, two underwent radical resection. Postoperative adjuvant chemotherapy was given to three patients. Conclusions: AFP-producing adenocarcinoma is a rare subtype of gastric cancer, which can be combined with SWI/SNF complex deletion, and the pathomorphological manifestations are different from the classical SWI/SNF complex deletion of undifferentiated carcinoma with rhabdoid phenotype.


Subject(s)
Male , Humans , Female , alpha-Fetoproteins , Stomach Neoplasms/genetics , Epstein-Barr Virus Infections , Herpesvirus 4, Human , Adenocarcinoma/pathology , Biomarkers, Tumor/genetics , DNA Helicases/genetics , Nuclear Proteins , Transcription Factors/genetics , Glypicans
2.
Chinese Medical Journal ; (24): 176-183, 2023.
Article in English | WPRIM | ID: wpr-970052

ABSTRACT

BACKGROUND@#Juvenile amyotrophic lateral sclerosis (JALS) is an uncommon form of amyotrophic lateral sclerosis whose age at onset (AAO) is defined as prior to 25 years. FUS mutations are the most common cause of JALS. SPTLC1 was recently identified as a disease-causative gene for JALS, which has rarely been reported in Asian populations. Little is known regarding the difference in clinical features between JALS patients carrying FUS and SPTLC1 mutations. This study aimed to screen mutations in JALS patients and to compare the clinical features between JALS patients with FUS and SPTLC1 mutations.@*METHODS@#Sixteen JALS patients were enrolled, including three newly recruited patients between July 2015 and August 2018 from the Second Affiliated Hospital, Zhejiang University School of Medicine. Mutations were screened by whole-exome sequencing. In addition, clinical features such as AAO, onset site and disease duration were extracted and compared between JALS patients carrying FUS and SPTLC1 mutations through a literature review.@*RESULTS@#A novel and de novo SPTLC1 mutation (c.58G>A, p.A20T) was identified in a sporadic patient. Among 16 JALS patients, 7/16 carried FUS mutations and 5/16 carried respective SPTLC1 , SETX , NEFH , DCTN1 , and TARDBP mutations. Compared with FUS mutation patients, those with SPTLC1 mutations had an earlier AAO (7.9 ± 4.6 years vs. 18.1 ± 3.9 years, P  < 0.01), much longer disease duration (512.0 [416.7-607.3] months vs. 33.4 [21.6-45.1] months, P  < 0.01), and no onset of bulbar.@*CONCLUSION@#Our findings expand the genetic and phenotypic spectrum of JALS and help to better understand the genotype-phenotype correlation of JALS.


Subject(s)
Humans , Child, Preschool , Child , Adolescent , Young Adult , Amyotrophic Lateral Sclerosis/genetics , DNA Helicases/genetics , Genetic Association Studies , Multifunctional Enzymes/genetics , Mutation/genetics , RNA Helicases/genetics , RNA-Binding Protein FUS/genetics , Serine C-Palmitoyltransferase/genetics
3.
Asian Journal of Andrology ; (6): 152-157, 2023.
Article in English | WPRIM | ID: wpr-971026

ABSTRACT

Chromodomain-helicase-DNA-binding protein 1 (CHD1) deletion is among the most common mutations in prostate cancer (PCa), but its role remains unclear. In this study, RNA sequencing was conducted in PCa cells after clustered regularly interspaced palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9)-based CHD1 knockout. Gene set enrichment analysis (GSEA) indicated upregulation of hypoxia-related pathways. A subsequent study confirmed that CHD1 deletion significantly upregulated hypoxia-inducible factor 1α (HIF1α) expression. Mechanistic investigation revealed that CHD1 deletion upregulated HIF1α by transcriptionally downregulating prolyl hydroxylase domain protein 2 (PHD2), a prolyl hydroxylase catalyzing the hydroxylation of HIF1α and thus promoting its degradation by the E3 ligase von Hippel-Lindau tumor suppressor (VHL). Functional analysis showed that CHD1 deletion promoted angiogenesis and glycolysis, possibly through HIF1α target genes. Taken together, these findings indicate that CHD1 deletion enhances HIF1α expression through PHD2 downregulation and therefore promotes angiogenesis and metabolic reprogramming in PCa.


Subject(s)
Male , Humans , Von Hippel-Lindau Tumor Suppressor Protein/metabolism , DNA-Binding Proteins/metabolism , Prolyl Hydroxylases/metabolism , Hypoxia , Prostatic Neoplasms/pathology , Glycolysis , Hypoxia-Inducible Factor 1, alpha Subunit/metabolism , Cell Line, Tumor , DNA Helicases/metabolism
4.
Article in English | WPRIM | ID: wpr-971485

ABSTRACT

Endometrial cancer is the most common gynecological malignancy, affecting up to 3% of women at some point during their lifetime (Morice et al., 2016; Li and Wang, 2021). Based on the pathogenesis and biological behavioral characteristics, endometrial cancer can be divided into estrogen-dependent (I) and non-estrogen-dependent (II) types (Ulrich, 2011). Type I accounts for approximately 80% of cases, of which the majority are endometrioid carcinomas, and the remaining are mucinous adenocarcinomas (Setiawan et al., 2013). It is generally recognized that long-term stimulation by high estrogen levels with the lack of progesterone antagonism is the most important risk factor; meanwhile, there is no definite conclusion on the specific pathogenesis. The incidence of endometrial cancer has been on the rise during the past two decades (Constantine et al., 2019; Gao et al., 2022; Luo et al., 2022). Moreover, the development of assisted reproductive technology and antiprogestin therapy following breast cancer surgery has elevated the risk of developing type I endometrial cancer to a certain extent (Vassard et al., 2019). Therefore, investigating the influence of estrogen in type I endometrial cancer may provide novel concepts for risk assessment and adjuvant therapy, and at the same time, provide a basis for research on new drugs to treat endometrial cancer.


Subject(s)
Female , Humans , Proto-Oncogene Proteins c-akt , Phosphatidylinositol 3-Kinases , Endometrial Neoplasms , Estrogens , Breast Neoplasms , DNA Helicases
5.
Chinese Journal of Pathology ; (12): 447-453, 2023.
Article in Chinese | WPRIM | ID: wpr-985699

ABSTRACT

Objective: To investigate the clinicopathological features and immunohistochemical phenotypes of gastric SMARCA4-deficient undifferentiated carcinoma, and to discuss the daily diagnostics of this entity and analyze its prognosis. Methods: The cases of gastric SMARCA4-deficient undifferentiated carcinoma diagnosed at the Department of Pathology, Peking University Cancer Hospital, China from January 2010 to August 2022 were collected. The histological sections were reviewed, the immunohistochemical results and clinicopathological features were analyzed, and relevant literature was reviewed. Results: Pure foci of undifferentiated carcinoma were seen in 7 cases, and 1 case was accompanied by a moderately differentiated tubular adenocarcinoma component. Undifferentiated carcinoma foci showed similar sheet-like or solid diffuse growth pattern, medium-sized tumor cells characterized by 1-2 nucleoli, and abundant cytoplasm and rhabdoid appearance. The average patient age was 65±8 years. Six patients were male and 2 were female. Immunohistochemical staining showed that undifferentiated carcinoma of all 8 tumors were negative for SMARCA4 (BRG1). Among 7 patients who underwent SMARCA2 (BRM) and SMARCB1 (INI1) staining, 4 cases showed loss of BRM expression, 2 cases showed weakly positive staining, and 1 case was diffusely positive, but all 7 cases were diffusely strong positive for INI1. The neuroendocrine marker, synaptophysin, was weakly positive in 5 cases, while CgA and CD56 were negative in 8 cases. Ki-67 index was more than 70%. Two cases were mismatch repair deficient and showed the loss of MLH1/PMS2 expression, while 1 case showed only MSH2 loss. PD-L1 staining showed that combined positive score (CPS)≥1 in 4 cases (CPS ranging from 1 to 55) and CPS<1 in the other 3 cases. Four patients had clinical stage Ⅳ disease. Two of them died within 3 months after diagnosis. Conclusions: Gastric SMARCA4-deficient undifferentiated carcinoma/rhabdoid carcinoma is a rare group of highly malignant tumors with a poor prognosis. Loss of the core subunit of SWI/SNF complex may be associated with the development of dedifferentiated histological pattern and aggressive tumor progression, which may be more frequently accompanied with mismatch repair deficiency.


Subject(s)
Male , Female , Humans , Carcinoma/pathology , Adenocarcinoma , Colorectal Neoplasms , Cell Differentiation , Stomach Neoplasms , Biomarkers, Tumor , DNA Helicases , Nuclear Proteins , Transcription Factors
6.
Chinese Journal of Pathology ; (12): 665-670, 2023.
Article in Chinese | WPRIM | ID: wpr-985755

ABSTRACT

Objective: To investigate and elucidate the clinicopathological and prognostic characteristics of SMARCA4-deficient non-small cell lung cancer. Methods: The clinicopathological and prognostic data were collected in 127 patients with SMARCA4-deficient non-small cell lung cancer diagnosed in Shanghai Pulmonary Hospital, Shanghai, China from January 2020 to March 2022. The variation and expression of biomarkers related to treatment were retrospectively reviewed. Results: One hundred and twenty-seven patients were eligible for enrollment. Among them 120 patients (94.5%) were male and 7 cases (5.5%) were female, while the average age was 63 years (range 42-80 years). There were 41 cases (32.3%) of stage Ⅰ cancer, 23 cases (18.1%) of stage Ⅱ, 31 cases (24.4%) of stage Ⅲ and 32 cases (25.2%) of stage Ⅳ. SMARCA4 expression detected by immunohistochemistry was completely absent in 117 cases (92.1%) and partially absent in 10 cases (7.9%). PD-L1 immunohistochemical analyses were performed on 107 cases. PD-L1 was negative, weakly positive and strongly positive in 49.5% (53/107), 26.2% (28/107) and 24.3% (26/107) of the cases, respectively. Twenty-one cases showed gene alterations (21/104, 20.2%). The KRAS gene alternation (n=10) was most common. Mutant-type SMARCA4-deficient non-small cell lung cancer was more commonly detected in females, and was associated with positive lymph nodes and advanced clinical stage (P<0.01). Univariate survival analysis showed that advanced clinical stage was a poor prognosis factor, and vascular invasion was a poor predictor of progression-free survival in patients with surgical resection. Conclusions: SMARCA4-deficient non-small cell lung cancer is a rare tumor with poor prognosis, and often occurs in elderly male patients. However, SMARCA4-deficient non-small cell lung cancers with gene mutations are often seen in female patients. Vascular invasion is a prognostic factor for disease progression or recurrence in patients with resectable tumor. Early detection and access to treatment are important for improving patient survivals.


Subject(s)
Humans , Male , Female , Aged , Adult , Middle Aged , Aged, 80 and over , Carcinoma, Non-Small-Cell Lung/pathology , B7-H1 Antigen/metabolism , Lung Neoplasms/pathology , Retrospective Studies , China , Prognosis , Biomarkers, Tumor/analysis , DNA Helicases/genetics , Nuclear Proteins/genetics , Transcription Factors/genetics
7.
Chinese Journal of Pathology ; (12): 1138-1143, 2023.
Article in Chinese | WPRIM | ID: wpr-1012378

ABSTRACT

Objective: To investigate the clinicopathological features and differential diagnosis of olfactory carcinoma (OC). Methods: Twenty-one cases of sinonasal tumors, including those initially diagnosed as olfactory neuroblastoma (ONB) and those with uncertain diagnosis, were collected from the Department of Pathology, the First Affiliated Hospital of University of Science and Technology of China (Anhui Provincial Hospital) from January 2016 to August 2022, among which 3 cases were reclassified as OC. The clinicopathological features were investigated, and the remaining 18 cases were used as control. Results: Of the three OC patients, 2 were male and 1 was female, with an average age of 57 years ranging from 35 to 74 years. Microscopically, the tumor cells were arranged in solid, nested or lobulated patterns with occasional palisading around the solid nests. The stroma was highly vascular with focal neurofibrillary areas. There were prominent rosettes or pseudorosettes formation. The tumor cells were mainly ovoid to spindly with scant to moderate amount of cytoplasm, one or several small nucleoli, and fine chromatin content. Brisk mitotic figures were seen. In all 3 cases of OC, there were scanty atypical glands and some were ciliated. Immunohistochemically, at least one epithelial marker and neuroendocrine marker were diffusely expressed in the tumor. Some of the tumor cells were positive for p40 and p63, and the sustentacular cells showed the expression of S-100 protein. All cases tested were negative for NUT, CD99 and desmin, with intact expression of SMARCA4 (BRG1) and SMARCB1 (INI-1). Ki-67 proliferation index varied from 20% to 80%. Follow-up after 16-18 months showed no mortality with tumor recurrence from 1 patient after 16 months. Conclusion: OC is a rare sinonasal tumor with neuroepithelial differentiation, its histomorphology is diverse, and the combination of immunohistochemical markers is essential for appropriate diagnosis.


Subject(s)
Humans , Male , Female , Middle Aged , Paranasal Sinus Neoplasms/chemistry , Biomarkers, Tumor/metabolism , Carcinoma/chemistry , Diagnosis, Differential , S100 Proteins , DNA Helicases/metabolism , Nuclear Proteins/metabolism , Transcription Factors/metabolism
8.
Article in Chinese | WPRIM | ID: wpr-986860

ABSTRACT

We explored clinicopathological features and treatment strategies for thoracic SMARCA4-deficient undifferentiated tumor (SMARCA4-UT). Thoracic SMARCA4-UT is a new entity recently acknowledged in the 2021 edition of World Health Organization Classification of Thoracic Tumors, and doctors are relatively unfamiliar with its diagnosis, treatment, and prognosis. Taking a case of SMARCA4-UT treated in Peking University First Hospital as an example, this multi-disciplinary discussion covered several hot issues on diagnosing and treating thoracic SMARCA4-UT, including histological features, immu- nohistochemical and molecular phenotype, immune checkpoint inhibitor (ICI) therapy, and pathological assessment of neoadjuvant therapy response. The patient was an older man with a long history of smoking and was admitted due to a rapidly progressing solid tumor in the lower lobe of the right lung. Histologically, tumor cells were epithelioid, undifferentiated, diffusely positive for CD34, and partially positive for SALL4.The expression of BRG1 protein encoded by SMARCA4 gene was lost in all of tumor cells, and next-generation sequencing(NGS)confirmed SMARCA4 gene mutation (c.2196T>G, p.Y732Ter). The pathological diagnosis reached as thoracic SMARCA4-UT, and the preoperative TNM stage was T1N2M0 (ⅢA). Tumor proportion score (TPS) detected by immunohistochemistry of programmed cell death 1-ligand 1 (PD-L1, clone SP263) was 2%. Tumor mutation burden (TMB) detected by NGS of 1 021 genes was 16. 3/Mb. Microsatellite detection showed the tumor was microsatellite stable (MSS). Neo-adjuvant therapy was implemented with the combined regimen of chemotherapy and ICI. Right lower lobectomy was performed through thoracoscopy after the two weeks' neoadjuvant. The pathologic assessment of lung tumor specimens after neoadjuvant therapy revealed a complete pathological response (CPR). The post-neoadjuvant tumor TNM stage was ypT0N0M0. Then, five cycles of adjuvant therapy were completed. Until October 2022, neither tumor recurrence nor metastasis was detected, and minimal residual disease (MRD) detection was negative. At present, it is believed that if BRG1 immunohistochemical staining is negative, regardless of whether SMARCA4 gene mutation is detected, it should be classified as SMARCA4-deficient tumors. SMARCA4-deficient tumors include a variety of carcinomas and sarcomas. The essential criteria for diagnosing SMARCA4-UT includes loss of BRG1 expression, speci-fic histological morphology, and exclude other common thoracic malignant tumors with SMARCA4-deficiency, such as squamous cell carcinoma, adenocarcinoma and large cell carcinoma. SMARCA4-UT is a very aggressive malignant tumor with a poor prognosis. It has almost no targeted therapy mutations, and little response to chemotherapy, but ICI is currently the only effective drug. The successful diagnosis and treatment for this case of SMARCA4-UT should enlighten significance for various kinds of SMARCA4-deficient tumors.


Subject(s)
Humans , Immune Checkpoint Inhibitors , Neoplasm Recurrence, Local , Lung Neoplasms/genetics , Thoracic Neoplasms/pathology , Adenocarcinoma , DNA Helicases , Nuclear Proteins , Transcription Factors
9.
Chinese Journal of Lung Cancer ; (12): 659-668, 2023.
Article in Chinese | WPRIM | ID: wpr-1010073

ABSTRACT

BACKGROUND@#The SMARCA4 mutation has been shown to account for at least 10% of non-small cell lung cancer (NSCLC). In the present, conventional radiotherapy and targeted therapy are difficult to improve outcomes due to the highly aggressive and refractory nature of SMARCA4-deficient NSCLC (SMARCA4-DNSCLC) and the absence of sensitive site mutations for targeted drug therapy, and chemotherapy combined with or without immunotherapy is the main treatment. Effective SMARCA4-DNSCLC therapeutic options, however, are still debatable. Our study aimed to investigate the efficacy and prognosis of programmed cell death 1 (PD-1) immune checkpoint inhibitors (ICIs) in combination with chemotherapy and chemotherapy in patients with stage III-IV SMARCA4-DNSCLC.@*METHODS@#46 patients with stage III-IV SMARCA4-DNSCLC were divided into two groups based on their treatment regimen: the chemotherapy group and the PD-1 ICIs plus chemotherapy group, and their clinical data were retrospectively analyzed. Efficacy assessment and survival analysis were performed in both groups, and the influencing factors for prognosis were explored for patients with SMARCA4-DNSCLC.@*RESULTS@#Male smokers are more likely to develop SMARCA4-DNSCLC. There was no significant difference in the objective response rate (76.5% vs 69.0%, P=0.836) between chemotherapy and the PD-1 ICIs plus chemotherapy or the disease control rate (100.0% vs 89.7%, P=0.286). The one-year overall survival rate in the group with PD-1 ICIs plus chemotherapy was 62.7%, and that of the chemotherapy group was 46.0%. The difference in median progression-free survival (PFS) between the PD-1 ICIs plus chemotherapy group and the chemotherapy group was statistically significant (9.3 mon vs 6.1 mon, P=0.048). The results of Cox regression analysis showed that treatment regimen and smoking history were independent influencing factors of PFS in patients with stage III-IV SMARCA4-DNSCLC, and family history was an individual influencing factor of overall survival in patients with stage III-IV SMARCA4-DNSCLC.@*CONCLUSIONS@#Treatment regimen may be a prognostic factor for patients with SMARCA4-DNSCLC, and patients with PD-1 ICIs plus chemotherapy may have a better prognosis.


Subject(s)
Humans , Male , Carcinoma, Non-Small-Cell Lung/genetics , Lung Neoplasms/genetics , Immune Checkpoint Inhibitors/therapeutic use , Programmed Cell Death 1 Receptor/genetics , Retrospective Studies , Antineoplastic Agents, Immunological/therapeutic use , Prognosis , DNA Helicases/genetics , Nuclear Proteins/genetics , Transcription Factors/genetics
10.
Article in Chinese | WPRIM | ID: wpr-981834

ABSTRACT

OBJECTIVE@#To explore the clinical feature and genetic etiology of a patient with normosmic idiopathic hypogonadotropic hypogonadism (nIHH) due to variant of CHD7 gene.@*METHODS@#A patient who had presented at Anhui Provincial Children's Hospital in October 2022 was selected as the study subject. Clinical data of the patient was collected. The patient and his parents were subjected to trio-whole exome sequencing. Candidate variant was verified by Sanger sequencing and bioinformatic analysis.@*RESULTS@#The patient had featured delayed development of secondary sexual characteristics but normal olfactory function. Genetic testing revealed that he has harbored a c.3052C>T (p.Pro1018Ser) missense variant of the CHD7 gene, for which both of his parents were of the wild type. The variant has not been recorded in the PubMed and HGMD databases. Analysis of amino acid sequences suggested that the variant site is highly conserved, and the variant may affect the stability of protein structure. Based on the guidelines from the American College of Medical Genetics and Genomics, the c.3032C>T variant was classified as a likely pathogenic (PS2+PM2_Supporting+PP2+PP3+PP4).@*CONCLUSION@#The delayed development of secondary sexual characteristics of the patient may be attributed to the c.3052C>T (p.Pro1018Ser) variant of the CHD7 gene. Above finding has expanded the variation spectrum of the CHD7 gene.


Subject(s)
Child , Humans , Male , Amino Acid Sequence , Computational Biology , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Genetic Testing , Genomics , Hypogonadism/genetics , Mutation
11.
Article in English | WPRIM | ID: wpr-982473

ABSTRACT

The cranial neural crest plays a fundamental role in orofacial development and morphogenesis. Accordingly, mutations with impact on the cranial neural crest and its development lead to orofacial malformations such as cleft lip and palate. As a pluripotent and dynamic cell population, the cranial neural crest undergoes vast transcriptional and epigenomic alterations throughout the formation of facial structures pointing to an essential role of factors regulating chromatin state or transcription levels. Using CRISPR/Cas9-guided genome editing and conditional mutagenesis in the mouse, we here show that inactivation of Kat5 or Ep400 as the two essential enzymatic subunits of the Tip60/Ep400 chromatin remodeling complex severely affects carbohydrate and amino acid metabolism in cranial neural crest cells. The resulting decrease in protein synthesis, proliferation and survival leads to a drastic reduction of cranial neural crest cells early in fetal development and a loss of most facial structures in the absence of either protein. Following heterozygous loss of Kat5 in neural crest cells palatogenesis was impaired. These findings point to a decisive role of the Tip60/Ep400 chromatin remodeling complex in facial morphogenesis and lead us to conclude that the orofacial clefting observed in patients with heterozygous KAT5 missense mutations is at least in part due to disturbances in the cranial neural crest.


Subject(s)
Animals , Mice , Chromatin Assembly and Disassembly , Cleft Lip/genetics , Cleft Palate/genetics , DNA Helicases/metabolism , DNA-Binding Proteins , Neural Crest/metabolism , Skull , Transcription Factors/metabolism
12.
Article in Chinese | WPRIM | ID: wpr-936363

ABSTRACT

OBJECTIVE@#To assess the value of m7G-lncRNAs in predicting the prognosis and microenvironment of colorectal cancer (CRC).@*METHODS@#We screened m7G-lncRNAs from TCGA to construct an m7G-lncRNAs risk model using multivariate Cox analysis, which was validated using ROC and C-index curves. Calibration and nomogram were used to predict the prognosis of CRC patients. Point-bar charts and K-M survival curves were used to assess the correlation of risk scores with the patients' clinical staging and prognosis. CIBERSORT and ESTIMATE were used to explore the association between the tumor microenvironment and immune cell infiltration in patients in high and low risk groups and the correlation of risk scores with microsatellite instability, stem cell index and immune checkpoint expression. A protein-protein interaction network was constructed, and the key targets regulated by m7G-lncRNAs were identified and validated in paired samples of CRC and adjacent tissues by immunoblotting.@*RESULTS@#We identified a total of 1722 m7G-lncRNAs from TCGA database, from which 12 lncRNAs were screened to construct the risk model. The AUCs of the risk model for predicting survival outcomes at 1, 3 and 5 years were 0.727, 0.747 and 0.794, respectively. The AUC of the nomogram for predicting prognosis was 0.794, and the predicted results were consistent with actual survival outcomes of the patients. The patients in the high-risk group showed more advanced tumor stages and a greater likelihood of high microsatellite instability than those in the low-risk group (P < 0.05). The tumor stemness index was negatively correlated with the risk score (r=-0.19; P=7.3e-05). Patients in the high-risk group had higher stromal cell scores (P=0.0028) and higher total scores (P=0.007) with lowered expressions of activated mast cells (r=-0.11; P=0.045) and resting CD4+ T cells (r=-0.14; P=0.01) and increased expressions of most immune checkpoints (P < 0.05). ATXN2 (P= 0.006) and G3BP1 (P=0.007) were identified as the key targets regulated by m7G-lncRNAs, and their expressions were both higher in CRC than in adjacent tissues.@*CONCLUSION@#The risk model based on 12 m7G-lncRNAs has important prognostic value for CRC and can reflect the microenvironment and the efficacy of immunotherapy in the patients.


Subject(s)
Humans , Biomarkers, Tumor/metabolism , Colonic Neoplasms , DNA Helicases/metabolism , Gene Expression Regulation, Neoplastic , Microsatellite Instability , Poly-ADP-Ribose Binding Proteins/metabolism , Prognosis , RNA Helicases/metabolism , RNA Recognition Motif Proteins/metabolism , RNA, Long Noncoding/metabolism , Tumor Microenvironment
13.
Article in Chinese | WPRIM | ID: wpr-928425

ABSTRACT

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.


Subject(s)
Humans , CHARGE Syndrome/genetics , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Genetic Testing , Heterozygote , Mutation , Phenotype , Exome Sequencing
14.
Article in Chinese | WPRIM | ID: wpr-880084

ABSTRACT

OBJECTIVE@#To analyze the clinical characteristics and treatment effects of children with acute megakaryoblastic leukemia without down syndrome (non-DS-AMKL).@*METHODS@#The clinical data of 19 children with non-DS-AMKL treated in the Pediatric Hematology Ward in Sun Yat-sen Memorial Hospital of Sun Yat-sen University from May 2008 to April 2018 were analyzed retrospectively. The clinical characteristics, laboratory test and treatment methods of the children were concluded. All patients were followed up to evaluate the effect of treatment.@*RESULTS@#The 19 cases of children included nine male and ten female, the median age of onset was 2 years old. The clinical manifestations showed nonspecific. The median white blood cell of peripheral blood was 15.88×10@*CONCLUSION@#Non-DS-AMKL was rare in children and difficult to be diagnosed. Determination of MICM classification as early as possible was helpful for diagnosis, and genetic testing played an important role for diagnosis and prognosis evaluation. Early hematopoietic stem cell transplantation in patients with CR after chemotherapy might be an effective way to cure AMKL.


Subject(s)
Child , Child, Preschool , Female , Humans , Male , DEAD-box RNA Helicases , DNA Helicases , Down Syndrome , Leukemia, Megakaryoblastic, Acute/genetics , Prognosis , Retrospective Studies , Trisomy
15.
Article in English | WPRIM | ID: wpr-878413

ABSTRACT

OBJECTIVES@#A study was conducted to investigate the molecular mechanism of chromodomain helicase/ATPase DNA binding protein 1-like gene (CHD1L) influencing the invasion and metastasis of tongue squamous cell carcinoma and to provide a new target for clinical inhibition of invasion and metastasis of tongue squamous cell carcinoma.@*METHODS@#Ualcan website was used to analyze the expression of CHD1L in normal epithelial tissue and primary head and neck squamous cell carcinoma and to analyze the effect of lymph node metastasis on the expression of CHD1L in tissues with head and neck squamous cell carcinoma. The relationship between CHD1L expression and the survival rate of patients with head and neck squamous cell carcinoma was tested by the GEPIA website. Western blot was used to quantify the levels of CHD1L protein in human tongue squamous cell carcinoma CAL27 and immortalized human skin keratinocyte cell HaCaT. After knocking down CAL27 in human tongue squamous cell carcinoma cells with an RNA interference plasmid, the cells were designated as SiCHD1L/CAL27 and Scr/CAL27. Western blot was utilized to detect the expression of CHD1L in each group of cells. The change in CAL27 cell proliferation ability was tested by EdU proliferation test after CHD1L knockdown. The change of cell migration ability of each group cells was tested through the wound healing assay. Western blot was used to detect epithelial-mesenchymal transition (EMT) marker E-cadherin and Vimentin protein expression levels.@*RESULTS@#Ualcan database showed that the expression of CHD1L in primary head and neck squamous cell carcinoma tissues was higher than in normal epithelial tissues and in head and neck squamous cell carcinoma tissues with lymph node metastasis. GEPIA website analysis showed that the overall survival rate of patients with head and neck squamous cell carcinoma with high expression of CHD1L was significantly lower than that of patients with low expression. Western blot results showed that CHD1L expression in human tongue squamous carcinoma cells CAL27 was higher than that of human normal skin cells HaCaT. CHD1L expression in SiCHD1L/CAL27 cells was much lower than that in Scr/CAL27 cells. Results of EdU proliferation experiments showed the significant reduction in the cell proliferation ability of the SiCHD1L/CAL27 cells. Results of the wound healing experiments showed the reduction in the migration capacity of the SiCHD1L/CAL27 cells. The expression of E-cadherin increased, whereas that of Vimentin decreased, in SiCHD1L/CAL27 cells.@*CONCLUSIONS@#CHD1L promoted the EMT, proliferation, migration, and invasion ability of tongue squamous cell carcinoma cells.


Subject(s)
Humans , Adenosine Triphosphatases , Carcinoma, Squamous Cell/genetics , Cell Line, Tumor , Cell Movement , Cell Proliferation , DNA Helicases , DNA-Binding Proteins , Epithelial-Mesenchymal Transition , Gene Expression Regulation, Neoplastic , Head and Neck Neoplasms , Neoplasm Invasiveness/genetics , Tongue , Tongue Neoplasms/genetics
16.
Article in Chinese | WPRIM | ID: wpr-879519

ABSTRACT

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.


Subject(s)
Child , Humans , CHARGE Syndrome/genetics , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Genetic Variation , Mutation , Phenotype
17.
Article in Chinese | WPRIM | ID: wpr-828524

ABSTRACT

OBJECTIVE@#To observe the expression of HELQ and RAD51C in normal endometrial and endometrial stromal sarcoma (ESS) and analyze their correlation with the clinical features of the patients.@*METHODS@#The expressions of HELQ and RAD51C proteins were detected by immunohistochemical staining in normal endometrial tissues (14 cases) and tumor tissues from patients with ESS (37 cases) treated in Hunan Provincial Cancer Hospital from January, 2013 to December, 2016. The correlations of the expressions of the two proteins with the patients'age, FIGO staging, tissue type, tumor size, and lymph node metastasis were analyzed.@*RESULTS@#Immunohistochemical staining showed that the expressions of HELQ and RAD51C were both decreased in ESS patients compared with the normal group, and there was a positive correlation between HELQ and RAD51C expression ( < 0.05). HELQ expression in ESS was correlated with the tumor size and type. The expressions of HELQ and RAD51C were not correlated with the patients' age, FIGO stage and status of lymph node metastasis ( > 0.05).@*CONCLUSIONS@#Homologous recombination- directed DNA repair involving HELQ and RAD51C may participate in the occurrence and progression of ESS.


Subject(s)
Female , Humans , DNA Helicases , Genetics , DNA-Binding Proteins , Genetics , Endometrial Neoplasms , Diagnosis , Endometrium , Gene Expression Regulation, Neoplastic , Lymphatic Metastasis , Sarcoma, Endometrial Stromal
18.
Article in Chinese | WPRIM | ID: wpr-828943

ABSTRACT

OBJECTIVE@#To observe the expression of HELQ and RAD51C in normal endometrial and endometrial stromal sarcoma (ESS) and analyze their correlation with the clinical features of the patients.@*METHODS@#The expressions of HELQ and RAD51C proteins were detected by immunohistochemical staining in normal endometrial tissues (14 cases) and tumor tissues from patients with ESS (37 cases) treated in Hunan Provincial Cancer Hospital from January, 2013 to December, 2016. The correlations of the expressions of the two proteins with the patients'age, FIGO staging, tissue type, tumor size, and lymph node metastasis were analyzed.@*RESULTS@#Immunohistochemical staining showed that the expressions of HELQ and RAD51C were both decreased in ESS patients compared with the normal group, and there was a positive correlation between HELQ and RAD51C expression ( < 0.05). HELQ expression in ESS was correlated with the tumor size and type. The expressions of HELQ and RAD51C were not correlated with the patients' age, FIGO stage and status of lymph node metastasis ( > 0.05).@*CONCLUSIONS@#Homologous recombination- directed DNA repair involving HELQ and RAD51C may participate in the occurrence and progression of ESS.


Subject(s)
Female , Humans , DNA Helicases , DNA-Binding Proteins , Endometrial Neoplasms , Endometrium , Lymphatic Metastasis , Sarcoma, Endometrial Stromal
19.
Rev. chil. pediatr ; 90(5): 533-538, oct. 2019. tab, graf
Article in Spanish | LILACS | ID: biblio-1058180

ABSTRACT

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.


INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.


Subject(s)
Humans , Female , Infant, Newborn , DNA Helicases/genetics , DNA-Binding Proteins/genetics , CHARGE Syndrome/physiopathology , Phenotype , CHARGE Syndrome/diagnosis , CHARGE Syndrome/genetics , Mutation
20.
Journal of Experimental Hematology ; (6): 1001-1007, 2019.
Article in Chinese | WPRIM | ID: wpr-771848

ABSTRACT

OBJECTIVE@#To investigate the methylation status of CHD5 gene promoter in bone marrow from acute myeloid leukemia (AML) patients, and the underlying mechanism for initiating the pathogenesis of AML via p19/p53/p21 pathway.@*METHODS@#Methylation status of the CHD5 gene promoter was detected by using methylation-specific polymerase chain reaction (MSPCR) in bone marrow from AML patients, and the iron-deficiency anemia (IDA) samples were served as control. The expression of CHD5, p19, p53 and p21 was determined by real-time quantitative reverse transcriptase PCR and Western blot.@*RESULTS@#The methylation of CHD5 gene in bone marrow from AML patients increased significantly (39.06%) as compared with control group (6.67%). The methylation of CHD5 gene significantly correlated with chromosome karyotype differentiation (P<0.01), but did not correlate with the patient's sex, age and clinical classification (P>0.05). The mRNA expression of CHD5 gene in AML decreased, compared with control group, the mRNA and protein expression of p19, p53 and p21 in AML with CHD5 methylation promoter decreased.@*CONCLUSION@#The hypermeltylation of CHD5 gene promoter in AML patients can lead to decrease of CHD5, p19, p53 and p21 expression levels which may reduce the inhibitory effect on proliferation of leukemia cells through the regulation of p19, p53 and p21 pathway, thus promotes the occurence of AML.


Subject(s)
Humans , Cyclin-Dependent Kinase Inhibitor p16 , Cyclin-Dependent Kinase Inhibitor p21 , DNA Helicases , DNA Methylation , Leukemia, Myeloid, Acute , Nerve Tissue Proteins , Promoter Regions, Genetic , Tumor Suppressor Protein p53
SELECTION OF CITATIONS
SEARCH DETAIL