Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 1.164
Filter
1.
Braz. j. med. biol. res ; 54(2): e9549, 2021. tab, graf
Article in English | LILACS, ColecionaSUS | ID: biblio-1142579

ABSTRACT

Single nucleotide polymorphisms (SNPs) have important application value in the research of population genetics, hereditary diseases, tumors, and drug development. Conventional methods for detecting SNPs are typically based on PCR or DNA sequencing, which is time-consuming, costly, and requires complex instrumentation. In this study, we present a duplex probe-directed recombinase amplification (duplex-PDRA) assay that can perform real-time detection of two SNPs (rs6983267 and rs1447295) in four reactions in two tubes at 39°C within 30 min. The sensitivity of duplex-PDRA was 2×103-104 copies per reaction and no cross-reactivity was observed. A total of 382 clinical samples (179 prostate cancer patients and 203 controls) from northern China were collected and tested by duplex-PDRA assay and direct sequencing. The genotyping results were completely identical. In addition, the association analysis of two SNPs with prostate cancer risk and bone metastasis was conducted. We found that the TT genotype of rs6983267 (OR: 0.42; 95%CI: 0.23-0.78; P=0.005) decreased the risk of prostate cancer, while the CA genotype of rs1447295 (OR: 1.89; 95%CI: 1.20-2.96; P=0.005) increased the risk of prostate cancer. However, no association between the two SNPs (rs6983267 and rs1447295) and bone metastasis in prostate cancer was found in this study (P>0.05). In conclusion, the duplex-PDRA assay is an effective method for the simultaneous detection of two SNPs and shows great potential for widespread use in research and clinical settings.


Subject(s)
Humans , Male , Prostatic Neoplasms/genetics , Chromosomes, Human, Pair 8/genetics , DNA Mutational Analysis/methods , Polymorphism, Single Nucleotide , Case-Control Studies , China , Genetic Predisposition to Disease , Recombinases , Genotype
2.
Article in Chinese | WPRIM | ID: wpr-879606

ABSTRACT

OBJECTIVE@#To explore the genetic variation of a Chinese family affected with congenital insensitivity to pain with anhidrosis and albinism.@*METHODS@#Whole exome sequencing (WES) was carried out to screen potential variants within genomic DNA extracted from the proband and his parents. Whole genome sequencing (WGS) was applied when variants were not found completely. Suspected variants were validated by Sanger sequencing.@*RESULTS@#WES has identified a heterozygous c.1729G>C (p.G577R) variant of NTRK1 gene and two heterozygous variants of OCA2 gene, namely c.1363A>G (p.R455G) and c.1182+1G>A. WGS has identified two additional heterozygous variants c.(851-798C>T; 851-794C>G) in deep intronic regions of the NTRK1 gene.@*CONCLUSION@#The compound heterozygous variants of the NTRK1 gene probably underlay the congenital insensitivity to pain with anhidrosis. And the compound heterozygous variants of the OCA2 gene probably underlay the albinism in the proband. In the case where no variant is detected by WES in the coding region, WGS should be considered to screen potential variants in the whole genome.


Subject(s)
Albinism , Child , DNA Mutational Analysis , Hereditary Sensory and Autonomic Neuropathies/genetics , Heterozygote , Humans , Membrane Transport Proteins , Mutation , Pedigree
3.
Article in Chinese | WPRIM | ID: wpr-879597

ABSTRACT

OBJECTIVE@#To carry out genetic testing and prenatal diagnosis for 29 Chinese pedigrees affected with tuberous sclerosis complex (TSC) and assess efficacy of combined next generation sequencing (NGS) and multiple ligation-dependent probe amplification (MLPA) for the diagnosis.@*METHODS@#NGS and MLPA were used in conjunct to detect variants of TSC1 and TSC2 genes among the probands of the pedigrees. Paternity test was carried out to exclude maternal DNA contamination. Prenatal diagnosis was provided to 14 couples based on the discoveries in the probands.@*RESULTS@#Twenty-seven variants were identified in the TSC1 and TSC2 genes among the 29 pedigrees, which yielded a detection rate of 93.1%. Respectively, 5 (18.5%) and 22 (81.5%) variants were identified in the TSC1 and TSC2 genes. Twelve variants were unreported previously. Prenatal diagnosis showed that five fetuses were affected with TSC, whilst the remaining nine were unaffected.@*CONCLUSION@#Above finding has expanded the spectrum of TSC1 and TSC2 gene variants. Combined NGS and MLPA has enabled diagnosis of TSC with efficiency and accuracy.


Subject(s)
DNA Mutational Analysis , Female , Genetic Testing , Humans , Mutation , Pregnancy , Prenatal Diagnosis , Tuberous Sclerosis/genetics , Tuberous Sclerosis Complex 1 Protein/genetics , Tuberous Sclerosis Complex 2 Protein/genetics
4.
Article in Chinese | WPRIM | ID: wpr-879552

ABSTRACT

OBJECTIVE@#To report on the clinical, metabolic and genetic characteristics of a child with carnitine palmitoyl transferase 1A (CPT1A) deficiency.@*METHODS@#Clinical data and the level of acylcarnitine for a child who initially presented as epilepsy were analyzed. Genomic DNA was extracted from peripheral blood samples of the child and her parents and subjected to next-generation sequencing (NGS).@*RESULTS@#Mass spectrometry of blood acylcarnitine indicated increased carnitine 0 (C0) and significantly increased C0/ (C16+C18). DNA sequencing revealed that the child has carried compound heterozygous variants of the CPT1A gene, namely c.1846G>A and c.2201T>C, which were respectively inherited from her mother and father.@*CONCLUSION@#CPT1A presenting initially as epilepsy was unreported previously. Analysis of blood acylcarnitine C0 and C0/ (C16 + C18) ratio and NGS are necessary for the identification and diagnosis of CPT1A deficiency. The c.1846G>A and c.2201T>C variants of the CPT1A gene probably underlay the disease in this child. Above finding has also enriched the spectrum of CPT1A gene variants.


Subject(s)
Carnitine/blood , Carnitine O-Palmitoyltransferase/genetics , Child , DNA Mutational Analysis , Female , Humans , Hypoglycemia/genetics , Lipid Metabolism, Inborn Errors/genetics
5.
Article in Chinese | WPRIM | ID: wpr-879525

ABSTRACT

OBJECTIVE@#To carry out genetic testing for an abortus suspected with Cornelia de Lange syndrome (CdLS).@*METHODS@#History of gestation and the family was taken. Combined with prenatal ultrasonography and the phenotype of the abortus, a diagnosis was made for the proband. Fetal tissue and peripheral blood samples of its parents were collected for the extraction of genomic DNA. Whole exome sequencing was carried out to detect mutations related to the phenotype. Suspected mutations were verified in the parents through Sanger sequencing.@*RESULTS@#Prenatal ultrasound found that the forearms and hands of the fetus were anomalous, in addition with poorly formed vermis cerebellum, slight micrognathia, and increased echo of bilateral renal parenchyma. Examination of the abortus has noted upper limb and facial malformations. Whole exome sequencing revealed that the fetus carried a heterozygous c.2118delG (p.Lys706fs) frameshift mutation of the NIPBL gene. The same mutation was not found in either parent.@*CONCLUSION@#The heterozygous c.2118delG (p.Lys706fs) frameshift mutation of the NIPBL gene probably underlies the CdLS in the fetus. Above finding has provided a basis for the genetic counseling for the family.


Subject(s)
Cell Cycle Proteins/genetics , DNA Mutational Analysis , De Lange Syndrome/pathology , Female , Fetus , Humans , Male , Mutation , Phenotype , Pregnancy , Whole Exome Sequencing
6.
Article in Chinese | WPRIM | ID: wpr-879520

ABSTRACT

OBJECTIVE@#To detect the mutation site in a pedigree affected with autosomal dominant polycystic kidney disease (ADPKD) and verify its impact on the protein function.@*METHODS@#Peripheral blood samples were collected from the proband and his pedigree members for the extraction of genomic DNA. Mutational analysis was performed on the proband through whole-exome sequencing. Suspected variant was verified by Sanger sequencing. A series of molecular methods including PCR amplification, restriction enzyme digestion, ligation and transformation were also used to construct wild-type and mutant eukaryotic expression vectors of the PKD2 gene, which were transfected into HEK293T and HeLa cells for the observation of protein expression and cell localization.@*RESULTS@#The proband was found to harbor a c.2051dupA (p. Tyr684Ter) frame shift mutation of the PKD2 gene, which caused repeat of the 2051st nucleotide of its cDNA sequence and a truncated protein. Immunofluorescence experiment showed that the localization of the mutant protein within the cell was altered compared with the wild-type, which may be due to deletion of the C-terminus of the PKD2 gene.@*CONCLUSION@#The c.2051dupA (p. Tyr684Ter) mutation of the PKD2 gene probably underlay the pathogenesis of ADPKD in this pedigree.


Subject(s)
DNA Mutational Analysis , Female , Frameshift Mutation , HEK293 Cells , HeLa Cells , Humans , Male , Pedigree , Polycystic Kidney, Autosomal Dominant/physiopathology , Protein Kinases/genetics , Protein Transport/genetics , Whole Exome Sequencing
7.
Article in Chinese | WPRIM | ID: wpr-879517

ABSTRACT

OBJECTIVE@#To analyze the results of concurrent hearing and deafness genetic screening and follow up of newborns.@*METHODS@#In total 33 911 babies born to 5 designated hospitals in Nanshan District of Shenzhen city from October 2017 to December 2019 were included. All subjects underwent concurrent hearing and deafness genetic screening covering 21 variants of 4 genes including GJB2, SLC26A4, GJB3 and Mt12SrRNA. For those with positive results, Sanger sequencing was carried out for confirmation.@*RESULTS@#93.32% subjects passed the first-round hearing screening, and 87.01% passed the recheck testing. The overall detection rate was 4.18%. The detection rates for GJB2, SLC26A4, GJB3 and Mt12srRNA variants were 1.98%, 1.58%, 0.37% and 0.25%, respectively. 126 and 84 subjects were found with high risk for delayed-onset and drug-induced hearing loss, respectively. In addition, 4 and 5 subjects were found to harbor homozygous/compound heterozygous variants of the GJB2 and SLC26A4 genes, respectively. Concurrent screening showed that subjects (with heterozygous variants) who did not passed the two round hearing test were as follows: GJB2 with 6.75% in the first round and 2.61% in the second round testing, SLC26A4 (3.3%/1.2%), GJB3 (0.72%/0.14%) and 12SrRNA (0.36%/Nil), respectively. Moreover, the No-pass rate in the subjects with homozygous or compound variants in single gene, heterozygous variant in single gene, heterozygous variant in multiple genes, and homozygous variant in GJB3 gene were significantly higher than the subjects with negative results of genetic screening.@*CONCLUSION@#Concurrent newborn genetic screening can enhance the effectiveness of hearing screening and enable earlier identification and intervention for children with hearing impairment. Follow-up can improve the diagnostic rate for children who are positive for the concurrent screening. Nevertheless, genetic and hearing screening cannot replace the diagnostic testing. It is necessary to conduct comprehensive analysis for the results of genetic and hearing screening and radiological examinations. Sanger sequencing and next-generation sequencing are critical for ascertain the diagnosis.


Subject(s)
China/epidemiology , DNA Mutational Analysis , Deafness/genetics , Follow-Up Studies , Genes/genetics , Genetic Testing/statistics & numerical data , Hearing/genetics , Hearing Tests/statistics & numerical data , Humans , Infant, Newborn , Mutation , Neonatal Screening
8.
Article in Chinese | WPRIM | ID: wpr-879478

ABSTRACT

OBJECTIVE@#To analyze the phenotype and genotype of a patient affected with inherited antithrombin deficiency.@*METHODS@#All exons and exon-intron boundaries of the AT genes were subjected to PCR amplification and Sanger sequencing. The influence of variants on the disease was predicted using bioinformatic software (MutationTaster).@*RESULTS@#The results of all coagulation tests were normal, though the antithrombin activity and antigen content of the proband and his father have decreased significantly (34%, 48% and 12.97 mg/dL, 15.60 mg/dL, respectively). His mother was normal. Genetic analysis revealed that the proband and his father both carried a heterozygous g.2736dupT variant of the AT gene. Bioinformatic analysis suggested that the variant may be pathogenic.@*CONCLUSION@#The proband and his father both had type I hereditary antithrombin deficiency caused by a g.2736dupT variant of the AT gene. The variant was unreported previously.


Subject(s)
Antithrombin III/genetics , Antithrombin III Deficiency/genetics , DNA Mutational Analysis , Genetic Testing , Heterozygote , Humans , Male , Mutation , Pedigree
9.
Article in Chinese | WPRIM | ID: wpr-879469

ABSTRACT

OBJECTIVE@#To detect additional variants for newborn carriers of single heterozygous variants of the GJB2 or SLC26A4 gene by genechip analysis in Changsha area, and explore the variation spectrum of deafness-related genes in this region.@*METHODS@#For 462 newborns carrying single heterozygous variants of the GJB2 or SLC26A4 gene, all exons of the genes were subjected to Sanger sequencing. The pathogenicity of the variants was analyzed by database and literature search.@*RESULTS@#For 305 newborns carrying a heterozygous GJB2 variant, 143 (46.49%) were found to carry additional variants, including 29 (9.51%) with c.109G>A likely pathogenic variant, and 1 (6.48%) with c.551G>A pathogenic variant. Among 153 newborns carrying single heterozygous variant of the SLC26A4 gene, 2 (1.31%) were found with a c.281C>T variant, and 1 (0.65%) with a c.1547_1548ins pathogenic variant. Among 4 newborns simultaneously carrying GJB2 and SLC26A4 variants, two were found to carry c.109G>A and c.844T>C variants (clinical significance unknown), respectively.@*CONCLUSION@#For newborns carrying single heterozygous variants of the GJB2 or SLC26A4 gene by genechip analysis, the detection rate for other variants is quite high. Sanger sequencing can significantly improve the detection rate of high-risk newborns and enrich the variant spectrum of deafness genes.


Subject(s)
Connexins/genetics , DNA Mutational Analysis , Deafness/genetics , Genetic Carrier Screening , Heterozygote , Humans , Infant, Newborn , Mutation , Oligonucleotide Array Sequence Analysis , Sulfate Transporters/genetics
10.
Article in Chinese | WPRIM | ID: wpr-828321

ABSTRACT

OBJECTIVE@#To determine the type and carrier rate of deafness-related variants in Dongguan, China.@*METHODS@#A total of 16 182 subjects were screened. Heel blood samples were collected from newborns, while peripheral venous blood samples were collected from the remainders. For each individual, 100 variations of 18 deafness susceptibility genes were detected.@*RESULTS@#In total 1631 deafness-related variants (including 5 homozygous mutations) were detected, which gave a detection rate of 10.08%. The detection rate of SLC26A4 gene variants was the highest (845 cases, 5.22%), which was followed by GJB2 (673 cases, 4.16%), GJB3 (100 cases, 0.62%), TMC1 (12 cases, 0.07%), and MYO15A (1 case, 0.01%). The detection rate for GJB2 c.235delC variant was the highest (524 cases, 3.24%), which was followed by SLC26A4 IVS7-2A>G variant (270 cases, 1.67%). Thirty three individuals (0.20%) carried two variants at the same time, 7 of them (0.04%) carried compound heterozygous variants of the same gene.@*CONCLUSION@#To expand the range of screening can help with determination of the carrier status and provision of early intervention and genetic counseling for the examinees.


Subject(s)
China , DNA Mutational Analysis , Deafness , Genetics , Genes , Genetic Counseling , Genetic Predisposition to Disease , Genetic Testing , Genetic Variation , Humans , Infant, Newborn , Mutation , RNA, Ribosomal
11.
Rev. argent. microbiol ; 51(4): 307-315, dic. 2019. graf
Article in Spanish | LILACS | ID: biblio-1057394

ABSTRACT

Resumen Se realizó un estudio epidemiológico molecular en una población de 9.422 donantes de sangre de la provincia de Corrientes (noreste de Argentina), con el fin de determinar la prevalencia del virus linfotrópico T del humano tipos 1 y 2 (human T-cell lymphotropic virus: HTLV-1/2), de identificar filogenéticamente a los subtipos/subgrupos de HTLV-1 y 2 encontrados y de realizar el análisis de mutaciones. Sobre la base de los resultados obtenidos, se demostró que tanto el HTLV-1 como el HTLV-2 se encuentran circulando en una población de bajo riesgo de Corrientes, si bien con una prevalencia similar a las de áreas no endémicas. Los estudios filogenéticos identificaron al subtipo Cosmopolita subgrupo Transcontinental (Aa) del HTLV-1 y al subtipo b del HTLV-2. Los donantes infectados no manifestaron antecedentes de riesgo tales como transfusiones, uso de drogas inyectables ni parejas sexuales de riesgo o seropositivas para HTLV-1/2. Estos resultados indican que estos virus fueron transmitidos de madre a hijo, posiblemente de generación en generación, y que estas cepas fueron introducidas en la población caucásica de esta región a partir de ascendientes originarios de áreas endémicas del país o por contacto producido tiempo atrás con individuos infectados de otros países. Nuestros resultados demuestran por primera vez la presencia de HTLV-1 y HTLV-2 en la provincia de Corrientes. Y si bien se puede considerar a esta provincia como área no endémica, se destaca la necesidad de incluir a estos retrovirus en un programa nacional de salud pública, con el fin de contar con profesionales capacitados para realizar su diagnóstico y brindar la información necesaria en relación con la atención primaria y el seguimiento de los pacientes.


Abstract A molecular epidemiological study was conducted in a population of 9422 blood donors in the province of Corrientes, Northeastern Argentina, to determine the prevalence of Human T-cell lymphotropic virus types 1 and 2 (HTLV-1/2), the phylogenetic identification of HTLV-1 and 2 subtypes/subgroups and perform a mutation analysis. Based on the results obtained, it was shown that both HTLV-1 and HTLV-2 are circulating in a low-risk population of Corrientes, although with a similar prevalence to that of non-endemic areas. Phylogenetic studies identified the HTLV-1 Cosmopolitan subtype Transcontinental subgroup (Aa), and the HTLV-2 subtype b. Infected donors reported neither a history of risk factors such as transfusions, intravenous drug use, nor risky or HTLV-1/2 seropositive sexual partners. These results suggest that these viruses were transmitted from mother to child, possibly from generation to generation, and that these strains were introduced into the Caucasian population of this region from ancestors originating from endemic areas of the country either from or through contact with individuals from other countries years ago. Our results demonstrate for the first time the presence of HTLV-1 and HTLV-2 in the province of Corrientes. Moreover, although the province can be considered a non-endemic area, the need to include these retroviruses in a national Public Health program is highlighted, in order to have qualified professionals duly trained to make their diagnosis and provide the necessary information in relation to primary care and patient follow-up.


Subject(s)
Humans , Male , Female , Human T-lymphotropic virus 1/genetics , Human T-lymphotropic virus 2/genetics , Argentina/epidemiology , Blood Donors , DNA Mutational Analysis/methods , Epidemiologic Studies , Prevalence
12.
Medicina (B.Aires) ; 79(4): 265-270, ago. 2019. tab
Article in Spanish | LILACS | ID: biblio-1040519

ABSTRACT

El melanoma maligno es la forma más agresiva de cáncer de piel, con una tasa de mortalidad en Argentina 1997-2001 = 1.1/100 000 en varones y 0.6 en mujeres. El proto-oncogén BRAF es foco de intensa investigación, su mutación es uno de los principales promotores tumorales y pueden presentarse en 50% de los melanomas. Se han aprobado varios fármacos con actividad clínica sobre las mutaciones BRAF. El objetivo del trabajo es evaluar el estado mutacional de BRAF (exón 15) en biopsias con melanoma maligno cutáneo y su relación con las características histopatológicas. Realizamos un estudio observacional, retrospectivo, de muestras fijadas en formol e incluidas en parafina. Revisamos edad, sexo, diagnóstico y datos histopatológicos, tamaño y porcentaje tumoral, viabilidad para análisis molecular y presencia de melanina. Evaluamos mutaciones de BRAF con PCR/secuenciación Sanger. Utilizamos test de Student, Chi cuadrado, Wilcoxon y prueba exacta de Fisher. De 49 casos se pudo purificar y secuenciar el 76% (38/49), 13/38 (34%) mujeres y 25/38 (66%) varones, edad mediana 70 años. Localización más frecuente: tórax con 14/35 (40%). Tipo histológico: extensivo superficial 18/38 (47%). Niveles de Clark, 11/38 (29%): I-II y 27/38 (71%): III, IV y V. Mediana del Breslow: 1.6 mm. Fase de crecimiento radial 11/38 (29%) y 27/38 (71%) vertical. Presentaron mutaciones 16/38 (42%). Como lo informado por otros autores, no se encontró asociación entre el estado mutacional del exón 15 y los parámetros clínicos o histopatológicos.


Malignant melanoma (MM) is the more aggressive form of skin cancer with a mortality rate in Argentina 1997-2001 = 1.1/100 000 in men and 0.6 in women. BRAF proto-oncogene is focus of intense research; its mutation is one of the main tumor promoters and occurs in approximately 50% of MM. Several drugs with clinical activity on BRAF mutations have been approved. The aim of the study is to evaluate the mutational status of BRAF (exon 15) in cutaneous MM biopsies and its relationship with histopathological characteristics. We carried out an observational, retrospective study of samples fixed in formaldehyde and paraffin embedded; reviewing age, sex, diagnosis, histopathological data, tumor size and percentage, viability for molecular analysis and melanin presence. We evaluated BRAF mutations with PCR/Sanger sequencing. For statistics we used Student's t test, Chi square, Wilcoxon and Fisher's exact test. We were able to purify and sequence 76% (38/49) samples, 13/38 (34%) from women and 25/38 (66%) from men, the median age being 70 years. Most frequent location: thorax 14/35 (40%). Histological type: Superficial spreading 18/38 (47%). Clark´s levels, 11/38 (29%): I-II and 27/38 (71%): III, IV and V. Breslow´s median: 1.6 mm. Radial growth phase 11/38 (29%) and 27/38 (71%) vertical. Presented mutations 16/38 (42%). As reported by other authors, no association was found between the mutational state of exon 15 and clinical or histopathological parameters.


Subject(s)
Humans , Male , Female , Adult , Middle Aged , Aged , Aged, 80 and over , Skin Neoplasms/genetics , Proto-Oncogene Proteins B-raf/genetics , Melanoma/genetics , Mutation/genetics , Skin Neoplasms/pathology , DNA Mutational Analysis , Retrospective Studies , Real-Time Polymerase Chain Reaction , Melanoma/pathology
13.
Arch. endocrinol. metab. (Online) ; 63(2): 97-106, Mar.-Apr. 2019. tab, graf
Article in English | LILACS | ID: biblio-1001222

ABSTRACT

ABSTRACT Objectives: We aimed to investigate the prevalence of the BRAF (V600E) mutation in consecutive cases of papillary thyroid carcinoma (PTC) in patients diagnosed and treated at the Hospital Sao Rafael (Salvador, BA, Brazil) and evaluate its association with clinical and pathological characteristics of PTC. Subjects and methods: We retrospectively enrolled in the study a total of 43 consecutive PTC patients who underwent total thyroidectomy. We performed DNA extraction from formalin-fixed paraffin-embedded (FFPE) tumour tissue samples. Polymerase chain reaction (PCR) and direct sequencing were used to determine BRAF (V600E) mutation status. Univariate and multivariate logistic regression analyses were employed to identify independent associations. Results: The prevalence of BRAF (V600E) mutation was 65.1% (28/43). A high frequency of older patients (p value: 0.004) was observed among the BRAF-mutated PTC group and, in contrast, a low frequency of concurrent Hashimoto's thyroiditis (HT) (p value: 0.011) was noted. Multivariate analysis confirmed that older age (OR: 1.15; 95% CI: 1.00 - 1.33; p value: 0.047) and HT (OR: 0.05; 95% CI: 0.006-0.40; p value: 0.005) were independent factors associated with BRAF (V600E) mutation. Conclusion: We found a high prevalence of BRAF (V600E) mutation in PTC cases. Older age and no concurrent HT were independently associated with BRAF (V600E) mutation.


Subject(s)
Humans , Male , Female , Child , Adolescent , Adult , Middle Aged , Aged , Young Adult , Thyroid Neoplasms/genetics , Proto-Oncogene Proteins B-raf/genetics , Thyroid Cancer, Papillary/genetics , Mutation/genetics , Prognosis , Brazil/epidemiology , Thyroid Neoplasms/epidemiology , DNA Mutational Analysis , Prevalence , Cross-Sectional Studies , Retrospective Studies , Age Factors , Hashimoto Disease/complications , Hashimoto Disease/genetics , Thyroid Cancer, Papillary/complications , Thyroid Cancer, Papillary/epidemiology
14.
Arch. endocrinol. metab. (Online) ; 63(2): 107-112, Mar.-Apr. 2019. tab, graf
Article in English | LILACS | ID: biblio-1001216

ABSTRACT

ABSTRACT Objectives: This observational study analyzed telomerase reverse transcriptase (pTERT) mutations in 45 fine-needle aspiration (FNA) specimens obtained from thyroid nodules followed by postoperatively confirmation of papillary thyroid cancer (PTC) diagnosis, examining their relationship with clinicopathologic aspects and the BRAFV600E mutation. Subjects and methods: Clinical information was collected from patients who presented to Ribeirao Preto University Hospital for surgical consultation regarding a thyroid nodule and who underwent molecular testing between January 2010 to October 2012. Tests included a DNA-based somatic detection of BRAFV600E and pTERT mutations. Results: We found coexistence of pTERTC228T and BRAFV600E mutations in 8.9% (4/45) of thyroid nodules. All nodules positive for pTERT mutations were BRAFV600E positives. There was a significant association between pTERTC228T/BRAFV600E with older age and advanced stage compared with the group negative for either mutation. Conclusions: This series provides evidence that FNA is a reliable method for preoperative diagnosis of high-risk thyroid nodules. pTERTC228T/BRAFV600E mutations could be a marker of poor prognosis. Its use as a personalized molecular medicine tool to individualize treatment decisions and follow-up design needs to be further studied.


Subject(s)
Humans , Male , Female , Adolescent , Adult , Middle Aged , Aged , Young Adult , Thyroid Neoplasms/genetics , Thyroid Nodule/genetics , Telomerase/genetics , Proto-Oncogene Proteins B-raf/genetics , Thyroid Cancer, Papillary/genetics , Prognosis , Thyroid Neoplasms/diagnosis , Thyroid Neoplasms/pathology , DNA Mutational Analysis , Predictive Value of Tests , Age Factors , Promoter Regions, Genetic/genetics , Thyroid Nodule/diagnosis , Thyroid Nodule/pathology , Biopsy, Fine-Needle , Preoperative Period , Thyroid Cancer, Papillary/diagnosis , Thyroid Cancer, Papillary/pathology , Lymphatic Metastasis/diagnosis , Mutation/genetics , Neoplasm Staging
15.
Article in Chinese | WPRIM | ID: wpr-772030

ABSTRACT

OBJECTIVE@#To identify pathogenic mutation in a pedigree affected with brachydactyly and obesity.@*METHODS@#Peripheral blood sample was collected for extraction of genomic DNA. Exons capture combined with next generation sequencing (NGS) was carried out to identify potential mutation. Sanger sequencing was used to verify the results.@*RESULTS@#NGS has identified a novel heterozygous missense mutation (c.125A>C, p.Gln42Pro) in the exon 1 of PTHLH gene. The result was verified by Sanger sequencing. The mutations was derived from his mother. His uncle and sister have also carried the same heterozygous mutation.@*CONCLUSION@#A novel mutation of the PTHLH gene has been identified in a pedigree affected with brachydactyly type E2 and obesity.


Subject(s)
Brachydactyly , DNA Mutational Analysis , Humans , Mutation , Obesity , Pedigree
16.
Article in Chinese | WPRIM | ID: wpr-771999

ABSTRACT

OBJECTIVE@#To explore the genetic etiology for 17 pedigrees affected with autosomal dominant polycystic kidney disease (ADPKD).@*METHODS@#Peripheral blood samples were derived from the probands and their parents with informed consent. Following DNA extraction, targeted capture and next generation sequencing were carried out in search for potential disease-causing variants. Sanger sequencing was used to validate candidate pathogenic variants co-segregating with the disease in each pedigree. Prenatal diagnosis was provided for one family.@*RESULTS@#Among the 17 probands, 14 PKD1 mutations and 3 PKD2 mutations were detected, which included 6 missense mutations, 4 nonsense mutations and 7 frameshift mutations. Of these, 8 have been associated with ADPKD previously and 9 were novel, which included c.7625G>T (p.Gly2542Val), c.3673C>T (p.Gln1225*), c.11048dupT (p.Thr3684Aspfs*38), c.9083_9084delAG (p.Glu3028Glyfs*40), c.10560delG (p.Pro3521Hisfs*6), c.7952_7974del TGTCCCTGAGGGTCCACACTGTG (p.Val2651Glyfs*2) of PKD1, and c.662T>G (p.Leu221*), c.1202_1203 insCT (p.Glu401Aspfs*2), and c.919 delA (p.Ser307Valfs*10) of PKD2. Prenatal testing showed that the fetus did not carry the same mutation as the proband.@*CONCLUSION@#Identification of causative mutations in the 17 pedigrees affected with ADPKD has provided a basis for genetic counseling and reproductive guidance. The novel findings have enriched the mutational spectrum of the PKD1 and PKD2 genes.


Subject(s)
DNA Mutational Analysis , Female , Humans , Mutation , Pedigree , Polycystic Kidney, Autosomal Dominant , Pregnancy , Prenatal Diagnosis , TRPP Cation Channels
17.
Article in Chinese | WPRIM | ID: wpr-771998

ABSTRACT

OBJECTIVE@#To provide mutational analysis and targeted therapy for Chinese patients with non-small cell lung cancer (NSCLCs).@*METHODS@#Mutation of 13 genes including EGFR, ALK, KRAS were detected among 102 patients with NSCLCs by next-generation sequencing, and the correlation between mutations and clinical characteristics and response to targeted therapy was analyzed.@*RESULTS@#In total 42 EGFR mutations (40.8%), 3 ALK fusions (3.9%), 6 KRAS mutations (5.8%), 3 PIK3CA mutations and amplifications (2.9%), 1 MET exon 14-skipping (1%) and 1 RET fusion (1%) were detected. The occurrence of mutations have varied with sample types and pathological types. Seventeen out of 20 EGFR tyrosine kinase inhibitor (TKI)-treated patients with EGFR mutations have shown remission.@*CONCLUSION@#The mutational frequency of NSCLCs among Chinese patients slightly differed from the western populations, in particular the frequency of ALK fusion. The mutations have well correlated with clinical response to targeted therapy.


Subject(s)
Carcinoma, Non-Small-Cell Lung , DNA Mutational Analysis , Humans , Lung Neoplasms , Mutation , Protein Kinase Inhibitors
18.
Article in Chinese | WPRIM | ID: wpr-771996

ABSTRACT

OBJECTIVE@#To explore the characteristics of mutations of four common pathogenic genes (GJB2, SLC26A4, GJB3 and 12S rRNA) among patients with nonsyndromic hearing loss (NSHL) from eastern Shandong.@*METHODS@#Peripheral blood samples of 420 NSHL patients were collected, and a hereditary-deafness-gene microarray was used to detect GJB2 c.235delC, c.299-300delAT, c.35delG and c.176del16 mutations, GJB3 c.538C>T mutation, SLC26A4 c.2168A>G and c.IVS7-2A>G mutations, and 12S rRNA c.1555A>C and c.1494C>T mutations. For patients carrying single heterozygous mutations, the coding regions of the above genes were analyzed with Sanger sequencing.@*RESULTS@#The results of the microarray assay and Sanger sequencing showed that 84 patients (20.00%) carried GJB2 mutations, with c.235delC (16.43%) and c.299-300delAT (7.86%) being most common. Seventy-five patients (17.86%) carried SLC26A4 mutations, for which c.IVS7-2A>G accounted for 15.71%. In addition, 5.95% of patients carried 12S rRNA mutations. Only one patient was found to carried GJB3 mutation (c.538C>T).@*CONCLUSION@#Common pathogenic mutations for NSHL in eastern Shandong included GJB2 c.235delC and SLC26A4 c.IVS7-2A>G. Of note, 5.95% of patients were due to 12S rRNA m.1555A>G mutation, which gave a frequency greater than other regions of China.


Subject(s)
China , Connexin 26 , Connexins , DNA Mutational Analysis , DNA, Mitochondrial , Deafness , Genes, rRNA , Hearing Loss , Humans , Mutation , RNA, Ribosomal , Sulfate Transporters
19.
Article in Chinese | WPRIM | ID: wpr-771992

ABSTRACT

OBJECTIVE@#To detect EXT1 and EXT2 gene mutations in two pedigrees affected with hereditary multiple exostosis (HME).@*METHODS@#The coding regions and exon/intron boundaries of the EXT1 and EXT2 genes were analyzed by targeted next-generation sequencing (NGS). Suspected mutations were confirmed by Sanger sequencing of the probands, their family members and 200 unrelated healthy controls. Gross deletion was confirmed by quantitative PCR (qPCR) analysis and multiple ligation-dependent probe amplification (MLPA) analysis.@*RESULTS@#Two mutations were detected in the pedigrees, which included EXT2 gene c.337_338insG mutation in pedigree 1 and deletion of entire EXT1 in pedigree 2. Analysis of sequencing data revealed that a novel heterozygous mutation (c.337_338insG) in EXT2 gene in proband 1 and his father. The same mutation was not found among healthy family members and 200 unrelated healthy controls. As shown by NGS and MLPA analysis, proband 2 carried a heterozygous deletion of entire EXT1 gene. The same deletion was also found in her mother by qPCR.@*CONCLUSION@#Mutations of the EXT1 and EXT2 genes probably underlie the HME in both pedigrees. NGS combined with Sanger sequencing, qPCR and MLPA is effective for attaining the diagnosis.


Subject(s)
DNA Mutational Analysis , Exostoses, Multiple Hereditary , Genetics , Female , Humans , Mutation , N-Acetylglucosaminyltransferases , Genetics , Pedigree
20.
Article in Chinese | WPRIM | ID: wpr-771987

ABSTRACT

OBJECTIVE@#To analyze the clinical manifestation and genetic mutation of a child with tyrosinemia type I but without elevated succinylacetone.@*METHODS@#Clinical data of the patient was collected. Tandem mass spectrometry and gas chromatography mass spectrometry were used to analyze the blood amino acid and urine organic acid component of the proband. DNA was extracted from the child and his parents and used for mutation analysis.@*RESULTS@#The proband was of acute type, with features including hepatomegaly, jaundice, anemia and tendency of bleeding. Serum levels of Tyrosine, Methionine and Phenylalanine were 397.12 μmol/L, 896.16 μmol/L and 292.52 μmol/L, respectively, which all distinctly exceeded the normal levels. The level of phenyllactic acid and 4-hydroxyphenyl-lactic acid of proband's urine were 17.4 μmol/L and 417.0 μmol/L, respectively, which also exceeded the normal levels, but the level of succinylacetone was within the normal range. Compound heterozygous mutations of the FAH gene, namely c.634delT (p.L212Wfs*20) and c.455G>A (p.W152X), were detected in the proband, which were both predicted to be pathogenic and were inherited from her father and mother, respectively.@*CONCLUSION@#For children with tyrosinemia type I, detection of urine succinylacetone by gas phase mass spectrometry can be negative. The diagnosis of tyrosinemia type I must rely on genetic testing and/or enzymatic assaying.


Subject(s)
DNA Mutational Analysis , Female , Genetic Testing , Heptanoates , Humans , Male , Tyrosinemias
SELECTION OF CITATIONS
SEARCH DETAIL