ABSTRACT
Abstract Cancer is a fatal malignancy and its increasing worldwide prevalence demands the discovery of more sensitive and reliable molecular biomarkers. To investigate the GINS1 expression level and its prognostic value in distinct human cancers using a series of multi-layered in silico approach may help to establish it as a potential shared diagnostic and prognostic biomarker of different cancer subtypes. The GINS1 mRNA, protein expression, and promoter methylation were analyzed using UALCAN and Human Protein Atlas (HPA), while mRNA expression was further validated via GENT2. The potential prognostic values of GINS1 were evaluated through KM plotter. Then, cBioPortal was utilized to examine the GINS1-related genetic mutations and copy number variations (CNVs), while pathway enrichment analysis was performed using DAVID. Moreover, a correlational analysis between GINS1 expression and CD8+ T immune cells and a the construction of gene-drug interaction network was performed using TIMER, CDT, and Cytoscape. The GINS1 was found down-regulated in a single subtypes of human cancer while commonly up-regulated in 23 different other subtypes. The up-regulation of GINS1 was significantly correlated with the poor overall survival (OS) of Liver Hepatocellular Carcinoma (LIHC), Lung Adenocarcinoma (LUAD), and Kidney renal clear cell carcinoma (KIRC). The GINS1 was also found up-regulated in LIHC, LUAD, and KIRC patients of different clinicopathological features. Pathways enrichment analysis revealed the involvement of GINS1 in two diverse pathways, while few interesting correlations were also documented between GINS1 expression and its promoter methylation level, CD8+ T immune cells level, and CNVs. Moreover, we also predicted few drugs that could be used in the treatment of LIHC, LUAD, and KIRC by regulating the GINS1 expression. The expression profiling of GINS1 in the current study has suggested it a novel shared diagnostic and prognostic biomarker of LIHC, LUAD, and KIRC.
Resumo O câncer é uma doença maligna fatal e sua crescente prevalência mundial exige a descoberta de biomarcadores moleculares mais sensíveis e confiáveis. Investigar o nível de expressão de GINS1 e seu valor prognóstico em cânceres humanos distintos, usando uma série de abordagens in silico em várias camadas, pode ajudar a estabelecê-lo como um potencial biomarcador de diagnóstico e prognóstico compartilhado de diferentes subtipos de câncer. O mRNA de GINS1, a expressão da proteína e a metilação do promotor foram analisados usando UALCAN e Human Protein Atlas (HPA), enquanto a expressão de mRNA foi posteriormente validada via GENT2. Os valores prognósticos potenciais de GINS1 foram avaliados por meio do plotter KM. Em seguida, o cBioPortal foi utilizado para examinar as mutações genéticas relacionadas ao GINS1 e as variações do número de cópias (CNVs), enquanto a análise de enriquecimento da via foi realizada usando DAVID. Além disso, uma análise correlacional entre a expressão de GINS1 e células imunes T CD8 + e a construção de uma rede de interação gene-droga foi realizada usando TIMER, CDT e Cytoscape. O GINS1 foi encontrado regulado negativamente em um único subtipo de câncer humano, enquanto comumente regulado positivamente em 23 outros subtipos diferentes. A regulação positiva de GINS1 foi significativamente correlacionada com a sobrevida global pobre (OS) de Carcinoma Hepatocelular de Fígado (LIHC), Adenocarcinoma de Pulmão (LUAD) e Carcinoma de Células Claras Renais de Rim (KIRC). O GINS1 também foi encontrado regulado positivamente em pacientes LIHC, LUAD e KIRC de diferentes características clínico-patológicas. A análise de enriquecimento de vias revelou o envolvimento de GINS1 em duas vias diversas, enquanto poucas correlações interessantes também foram documentadas entre a expressão de GINS1 e seu nível de metilação do promotor, nível de células imunes T CD8 + e CNVs. Além disso, também previmos poucos medicamentos que poderiam ser usados no tratamento de LIHC, LUAD e KIRC, regulando a expressão de GINS1. O perfil de expressão de GINS1 no estudo atual sugeriu que é um novo biomarcador de diagnóstico e prognóstico compartilhado de LIHC, LUAD e KIRC.
Subject(s)
Humans , Carcinoma, Renal Cell/genetics , Kidney Neoplasms/genetics , Liver Neoplasms , Prognosis , Biomarkers, Tumor/genetics , Gene Expression Regulation, Neoplastic , Up-Regulation , DNA-Binding Proteins , DNA Copy Number VariationsABSTRACT
Abstract Nucleotide excision repair (NER) acts repairing damages in DNA, such as lesions caused by cisplatin. Xeroderma Pigmentosum complementation group C (XPC) protein is involved in recognition of global genome DNA damages during NER (GG-NER) and it has been studied in different organisms due to its importance in other cellular processes. In this work, we studied NER proteins in Trypanosoma cruzi and Trypanosoma evansi, parasites of humans and animals respectively. We performed three-dimensional models of XPC proteins from T. cruzi and T. evansi and observed few structural differences between these proteins. In our tests, insertion of XPC gene from T. evansi (TevXPC) in T. cruzi resulted in slower cell growth under normal conditions. After cisplatin treatment, T. cruzi overexpressing its own XPC gene (TcXPC) was able to recover cell division rates faster than T. cruzi expressing TevXPC gene. Based on these tests, it is suggested that TevXPC (being an exogenous protein in T. cruzi) interferes negatively in cellular processes where TcXPC (the endogenous protein) is involved. This probably occurred due interaction of TevXPC with some endogenous molecules or proteins from T.cruzi but incapacity of interaction with others. This reinforces the importance of correctly XPC functioning within the cell.
Resumo O reparo por excisão de nucleotídeos (NER) atua reparando danos no DNA, como lesões causadas por cisplatina. A proteína Xeroderma Pigmentosum complementation group C (XPC) está envolvida no reconhecimento de danos pela via de reparação global do genoma pelo NER (GG-NER) e tem sido estudada em diferentes organismos devido à sua importância em outros processos celulares. Neste trabalho, estudamos proteínas do NER em Trypanosoma cruzi e Trypanosoma evansi, parasitos de humanos e animais, respectivamente. Modelos tridimensionais das proteínas XPC de T. cruzi e T. evansi foram feitos e observou-se poucas diferenças estruturais entre estas proteínas. Durante testes, a inserção do gene XPC de T. evansi (TevXPC) em T. cruzi resultou em crescimento celular mais lento em condições normais. Após o tratamento com cisplatina, T. cruzi superexpressando seu próprio gene XPC (TcXPC) foi capaz de recuperar as taxas de divisão celular mais rapidamente do que T. cruzi expressando o gene TevXPC. Com base nesses testes, sugere-se que TevXPC (sendo uma proteína exógena em T. cruzi) interfere negativamente nos processos celulares em que TcXPC (a proteína endógena) está envolvida. Isso provavelmente ocorreu pois TevXPC é capaz de interagir com algumas moléculas ou proteínas endógenas de T.cruzi, mas é incapaz de interagir com outras. Isso reforça a importância do correto funcionamento de XPC dentro da célula.
Subject(s)
Humans , Animals , Trypanosoma cruzi/genetics , Xeroderma Pigmentosum , DNA Damage/genetics , Computational Biology , DNA-Binding Proteins/genetics , DNA-Binding Proteins/metabolism , DNA Repair/geneticsABSTRACT
BACKGROUND: Chronic lymphocytic leukaemia (CLL) is a neoplasm of B-cells characterized by variable prognosis. Exploring the proteome of CLL cells may provide insights into the disease. Therefore, eleven proteomics experiments were conducted on eleven primary CLL samples. RESULTS: We reported a CLL proteome consisting of 919 proteins (false discovery rate (FDR) 1%) whose identification was based on the sequencing of two or more distinct peptides (FDR of peptide sequencing 1%). Mass spectrometry-based protein identification was validated for four different proteins using Western blotting and specific antibodies in different CLL samples. Small sizes of nucleolin (~57 kDa and ~68 kDa) showed a potential association with good prognosis CLL cells (n = 8, p < 0.01). Compared with normal B-cells, CLL cells over-expressed thyroid hormone receptor-associated protein 3 (THRAP3; n = 9; p = 0.00007), which is implicated in cell proliferation; and heterochromatin protein 1-binding protein 3 (HP1BP3; n = 10; p = 0.0002), which promotes cell survival and tumourogenesis. A smaller form of HP1BP3, which may correspond to HP1BP3 isoform-2, was specifically identified in normal B-cells (n = 10; p = 0.0001). HP1BP3 and THRAP3 predicted poor prognosis of CLL (p 0.05). Consistently, THRAP3 and HP1BP3 were found to be associated with cancer-related pathways (p 0.05). CONCLUSIONS: Our findings add to the known proteome of CLL and confirm the prognostic importance of two novel cancer-associated proteins in this disease.
Subject(s)
Leukemia, Lymphocytic, Chronic, B-Cell , Biomarkers, Tumor/analysis , Mass Spectrometry , Transcription Factors/analysis , Nuclear Proteins/analysis , Blotting, Western , Chromatography, Liquid , Proteomics , DNA-Binding Proteins/analysisABSTRACT
SUMMARY OBJECTIVE: Bladder cancer under the age of 40 is extremely rare. Bladder cancer development involves complex and multi-stage processes, one of which is the DNA damage repair mechanism. In this retrospective study, we aimed to evaluate the histopathological features of bladder urothelial carcinoma seen in patients under 40 years of age and tumor microsatellite instability status using immunohistochemistry. METHODS: A total of 50 patients under the age of 40 with urothelial bladder carcinoma from two different centers in the same country were included. Expression of the mismatch repair proteins MLH1, MSH2, MSH6, and PMS2 was analyzed by immunohistochemistry. RESULTS: Age at the time of diagnosis ranged from 17 to 40 years old. Most tumors were non-invasive papillary urothelial carcinoma. Two cases had nuclear loss of MSH-6 and PMS-2. We observed that tumor grade, tumor stage, presence of tumor differentiation, and infiltrative growth pattern of the tumor have significant impact on prognosis, but microsatellite instability does not have an effective role in bladder carcinogenesis in young patients. CONCLUSIONS: Our results indicate that the presence of microsatellite instability is not related to the low tumor grade and stage in urothelial neoplasms in young patients, suggesting that urothelial carcinoma of the bladder in young patients may represent a genetically stable form of neoplasia.
Subject(s)
Humans , Adolescent , Adult , Young Adult , Carcinoma, Transitional Cell/genetics , Microsatellite Instability , Urinary Bladder/metabolism , Retrospective Studies , DNA-Binding Proteins/genetics , DNA-Binding Proteins/metabolism , DNA Mismatch RepairABSTRACT
MAMLD1 gene has been implicated in 46,XY disorders of sex development (DSD) in recent years. Patients carrying MAMLD1 gene variants showed a "continuous spectrum" of simple micropenis, mild, moderate and severe hypospadias with micropenis, cryptorchidism, split scrotum and even complete gonadal dysplasia. The function of MAMLD1 gene in sexual development has not been fully elucidated, and its role in DSD has remained controversial. This article has reviewed recent findings on the role of the MAMLD1 gene in DSD, including the MAMLD1 gene, its encoded protein, genetic variants, clinical phenotype and possible pathogenic mechanism in DSD.
Subject(s)
DNA-Binding Proteins/genetics , Disorders of Sex Development/genetics , Humans , Male , Mutation , Nuclear Proteins/genetics , Phenotype , Sexual Development , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To explore the genotype-phenotype correlation in a child with Kabuki syndrome type 1 (KS1) caused by a mosaic frameshift variant of KMT2D gene.@*METHODS@#Trio-based whole exome sequencing (WES) was carried for the patient and her parents. Candidate variant was verified by Sanger sequencing.@*RESULTS@#The proband, a 3-year-and-2-month-old Chinese girl, presented with distinctive facial features, cognitive impairment, mild developmental delay, dermatoglyphic abnormalities, minor skeletal anomalies, ventricular septal defect, and autistic behavior. Trio-based WES revealed that the proband has carried a de novo mosaic frameshit variant of the KMT2D gene, namely NM_003482.3:c.13058delG (p.Pro4353Argfs*31) (GRCh37/hg19), for which the mosaicism rate was close to 21%. The variant was unreported previously and was confirmed by Sanger sequencing. Chromosomal microarray analysis (CMA) has revealed no pathogenic or likely pathogenic copy number variations. Compared with previously reported cases, our patient has presented obvious behavior anomalies including autism, anxiety and sleep problems, which were rarely reported.@*CONCLUSION@#This study has expanded the spectrum of KMT2D gene variants, enriched the clinical phenotypes of KS1, and facilitated genetic counseling for the family.
Subject(s)
Abnormalities, Multiple , China , DNA Copy Number Variations , DNA-Binding Proteins/genetics , Face/abnormalities , Female , Hematologic Diseases , Humans , Infant , Neoplasm Proteins/genetics , Phenotype , Vestibular DiseasesABSTRACT
Acetic acid is a common inhibitor present in lignocellulosic hydrolysate. Development of acetic acid tolerant strains may improve the production of biofuels and bio-based chemicals using lignocellulosic biomass as raw materials. Current studies on stress tolerance of yeast Saccharomyces cerevisiae have mainly focused on transcription control, but the role of transfer RNA (tRNA) was rarely investigated. We found that some tRNA genes showed elevated transcription levels in a stress tolerant yeast strain. In this study, we further investigated the effects of overexpressing an arginine transfer RNA gene tR(ACG)D and a leucine transfer RNA gene tL(CAA)K on cell growth and ethanol production of S. cerevisiae BY4741 under acetic acid stress. The tL(CAA)K overexpression strain showed a better growth and a 29.41% higher ethanol productivity than that of the control strain. However, overexpression of tR(ACG)D showed negative influence on cell growth and ethanol production. Further studies revealed that the transcriptional levels of HAA1, MSN2, and MSN4, which encode transcription regulators related to stress tolerance, were up-regulated in tL(CAA)K overexpressed strain. This study provides an alternative strategy to develop robust yeast strains for cellulosic biorefinery, and also provides a basis for investigating how yeast stress tolerance is regulated by tRNA genes.
Subject(s)
Acetic Acid , DNA-Binding Proteins/metabolism , Fermentation , Leucine , RNA, Transfer/genetics , Saccharomyces cerevisiae/metabolism , Saccharomyces cerevisiae Proteins/metabolism , Transcription FactorsABSTRACT
OBJECTIVE@#To the clinical characteristics and prognostic value of the patients with complete deletion of TET_JBP domain (ΔJBP) in TET2 acute myeloid leukemia (AML).@*METHODS@#Next Generation Sequencing technology was used to determine the mutations of 34 AML-related genes (including TET2 gene). The I-TASSER tool was used to predict the tertiary structure of the full-length TET2 protein and TET_JBP structure deletion.@*RESULTS@#Among 38 AML patients with TET2 mutations, 22(57.9%) showed truncation mutations, of which 16 (72.7%) produced TET2ΔJBP truncation mutants. Protein structure prediction showed that the deletion of TET_JBP domain lead to the significant changes of tertiary structure in TET2 protein. Compared with the patients in non-ΔJBP group, the age of patients in ΔJBP group were older (63 vs 54 years old, P=0.047), and the occurrence rate of CEBPA double mutation (CEBPA@*CONCLUSION@#AML patients with TET2ΔJBP truncation mutant shows lower CR rate, shorter EFS and OS after induction chemotherapy, which may be related to the poor prognosis, and co-mutation with CEBPA
Subject(s)
DNA-Binding Proteins/genetics , Humans , Induction Chemotherapy , Leukemia, Myeloid, Acute/genetics , Middle Aged , Mutation , Prognosis , Proto-Oncogene Proteins/genetics , Remission InductionABSTRACT
OBJECTIVE@#To explore the genetic basis of a child with recurrent infection, multiple malformation and dysmorphism.@*METHODS@#The child and his parents were subjected to trio whole exome sequencing.@*RESULTS@#The child had a complaint of fever and cough, with long and thin eye fissures and long eyelashes. Genetic testing revealed that the child has carried a non-triplet deletion of the KDM6A gene, which was unreported previously. The variant resulted in frameshift and premature termination of the translation. His parents were both of the wild type for the locus. After antibiotic and immunoglobulin treatment, the severe secondary pneumonia caused by immunodeficiency has improved.@*CONCLUSION@#With combined laboratory test, imaging examination and genetic testing, the child was ultimately diagnosed with Kabuki syndrome type 2. The characteristics of immunodeficiency of Kabuki syndrome may render conventional antibiotic treatment ineffective, which deserves clinical attention.
Subject(s)
Abnormalities, Multiple , Child , DNA-Binding Proteins/genetics , Face/abnormalities , Genetic Testing , Hematologic Diseases , Histone Demethylases/genetics , Humans , Neoplasm Proteins/genetics , Nuclear Proteins/genetics , Phenotype , Pneumonia , Vestibular DiseasesABSTRACT
OBJECTIVES@#A study was conducted to investigate the molecular mechanism of chromodomain helicase/ATPase DNA binding protein 1-like gene (CHD1L) influencing the invasion and metastasis of tongue squamous cell carcinoma and to provide a new target for clinical inhibition of invasion and metastasis of tongue squamous cell carcinoma.@*METHODS@#Ualcan website was used to analyze the expression of CHD1L in normal epithelial tissue and primary head and neck squamous cell carcinoma and to analyze the effect of lymph node metastasis on the expression of CHD1L in tissues with head and neck squamous cell carcinoma. The relationship between CHD1L expression and the survival rate of patients with head and neck squamous cell carcinoma was tested by the GEPIA website. Western blot was used to quantify the levels of CHD1L protein in human tongue squamous cell carcinoma CAL27 and immortalized human skin keratinocyte cell HaCaT. After knocking down CAL27 in human tongue squamous cell carcinoma cells with an RNA interference plasmid, the cells were designated as SiCHD1L/CAL27 and Scr/CAL27. Western blot was utilized to detect the expression of CHD1L in each group of cells. The change in CAL27 cell proliferation ability was tested by EdU proliferation test after CHD1L knockdown. The change of cell migration ability of each group cells was tested through the wound healing assay. Western blot was used to detect epithelial-mesenchymal transition (EMT) marker E-cadherin and Vimentin protein expression levels.@*RESULTS@#Ualcan database showed that the expression of CHD1L in primary head and neck squamous cell carcinoma tissues was higher than in normal epithelial tissues and in head and neck squamous cell carcinoma tissues with lymph node metastasis. GEPIA website analysis showed that the overall survival rate of patients with head and neck squamous cell carcinoma with high expression of CHD1L was significantly lower than that of patients with low expression. Western blot results showed that CHD1L expression in human tongue squamous carcinoma cells CAL27 was higher than that of human normal skin cells HaCaT. CHD1L expression in SiCHD1L/CAL27 cells was much lower than that in Scr/CAL27 cells. Results of EdU proliferation experiments showed the significant reduction in the cell proliferation ability of the SiCHD1L/CAL27 cells. Results of the wound healing experiments showed the reduction in the migration capacity of the SiCHD1L/CAL27 cells. The expression of E-cadherin increased, whereas that of Vimentin decreased, in SiCHD1L/CAL27 cells.@*CONCLUSIONS@#CHD1L promoted the EMT, proliferation, migration, and invasion ability of tongue squamous cell carcinoma cells.
Subject(s)
Adenosine Triphosphatases , Carcinoma, Squamous Cell/genetics , Cell Line, Tumor , Cell Movement , Cell Proliferation , DNA Helicases , DNA-Binding Proteins , Epithelial-Mesenchymal Transition , Gene Expression Regulation, Neoplastic , Head and Neck Neoplasms , Humans , Neoplasm Invasiveness/genetics , Tongue , Tongue Neoplasms/geneticsABSTRACT
The LIM domain only 1 (LMO1) gene belongs to the LMO family of genes that encodes a group of transcriptional cofactors. This group of transcriptional cofactors regulates gene transcription by acting as a key "connector" or "scaffold" in transcription complexes. All LMOs, including LMO1, are important players in the process of tumorigenesis. Unique biological features of LMO1 distinct from other LMO members, such as its tissue-specific expression patterns, interacting proteins, and transcriptional targets, have been increasingly recognized. Studies indicated that LMO1 plays a critical oncogenic role in various types of cancers, including T-cell acute lymphoblastic leukemia, neuroblastoma, gastric cancer, lung cancer, and prostate cancer. The molecular mechanisms underlying such functions of LMO1 have also been investigated, but they are currently far from being fully elucidated. Here, we focus on reviewing the current findings on the role of LMO1 in tumorigenesis, the mechanisms of its oncogenic action, and the mechanisms that drive its aberrant activation in cancers. We also briefly review its roles in the development process and non-cancer diseases. Finally, we discuss the remaining questions and future investigations required for promoting the translation of laboratory findings to clinical applications, including cancer diagnosis and treatment.
Subject(s)
Carcinogenesis/genetics , DNA-Binding Proteins/genetics , Gene Expression Regulation, Neoplastic , Humans , LIM Domain Proteins/genetics , Male , Transcription Factors/metabolismABSTRACT
Cullin-RING E3 ubiquitin ligase (CRL)-4 is a member of the large CRL family in eukaryotes. It plays important roles in a wide range of cellular processes, organismal development, and physiological and pathological conditions. DDB1- and CUL4-associated factor 8 (DCAF8) is a WD40 repeat-containing protein, which serves as a substrate receptor for CRL4. The physiological role of DCAF8 is unknown. In this study, we constructed Dcaf8 knockout mice. Homozygous mice were viable with no noticeable abnormalities. However, the fertility of Dcaf8-deficient male mice was markedly impaired, consistent with the high expression of DCAF8 in adult mouse testis. Sperm movement characteristics, including progressive motility, path velocity, progressive velocity, and track speed, were significantly lower in Dcaf8 knockout mice than in wild-type (WT) mice. However, the total motility was similar between WT and Dcaf8 knockout sperm. More than 40% of spermatids in Dcaf8 knockout mice showed pronounced morphological abnormalities with typical bent head malformation. The acrosome and nucleus of Dcaf8 knockout sperm looked similar to those of WT sperm. In vitro tests showed that the fertilization rate of Dcaf8 knockout mice was significantly reduced. The results demonstrated that DCAF8 plays a critical role in spermatogenesis, and DCAF8 is a key component of CRL4 function in the reproductive system.
Subject(s)
Animals , Cullin Proteins/genetics , DNA-Binding Proteins/genetics , Factor VIII , Male , Mice , Mice, Knockout , Spermatogenesis/genetics , Ubiquitin-Protein LigasesABSTRACT
OBJECTIVES@#Inflammation especially the overexpression of inflammasome and inflammatory cytokines, is one of the important reasons that affect the occurrence and development of acute cerebral infarction, including the initiation of cerebral infarction, the progress and recovery of post-infarction injury. This study aims to explore expressions of absent in melanoma 2 (AIM2), interleukin-1β (IL-1β), and interleukin-18 (IL-18) in plasma of patients with acute cerebral infarction and its significance.@*METHODS@#A total of 85 patients with acute cerebral infarction were enrolled in the cerebral infarction group. They were assigned into mild, moderate, and severe groups according to the severity of neurological deficits. They were assigned into small, middle, and large cerebral infarction groups according to the area of cerebral infarction. They were assigned into a good prognosis group and a poor prognosis group according to the Modified Rankin Scale (mRS) score on the 90th day after the onset. A total of 85 healthy controls were selected as a control group. The levels of AIM2, IL-1β, and IL-18 in plasma of the cerebral group and the control group were detected by enzyme-linked immunosorbent assay (ELISA).@*RESULTS@#The levels of plasma AIM2, IL-1β, and IL-18 in the cerebral infarction group were significantly higher than those in the control group (all @*CONCLUSIONS@#Expressions of AIM2, IL-1β, and IL-18 are up-regulated in the plasma of patients with acute cerebral infarction, and they are closely related to the severity of neurological deficit, cerebral infarction area, and prognosis in patients with acute cerebral infarction, suggesting that AIM2, IL-1β, and IL-18 may play an important role in the occurrence and development of acute cerebral infarction.
Subject(s)
Cerebral Infarction , DNA-Binding Proteins , Humans , Interleukin-18 , Interleukin-1beta , Melanoma , Plasma , StrokeABSTRACT
OBJECTIVES@#To study the gene expression of adipose tissue CD14@*METHODS@#The data of GSE54350 were obtained from the public database of gene expression profiling. The data were pre-processed by Network Analyst, String 11.0, Cytoscape 3.7.1, and other analytical software. The differentially expressed genes were analyzed by gene ontology biological function and kyoto encycopedia of genes and genomes (KEGG) signaling pathway to establish differential gene protein interaction network, transcription factor-gene regulatory network, microRNA-gene regulatory network, environmental factors-gene regulatory network, and other interaction systems.@*RESULTS@#The gene expression pattern of CD14@*CONCLUSIONS@#The gene expression of adipose tissue CD14
Subject(s)
Adipose Tissue , Computational Biology , DNA-Binding Proteins , Diabetes Mellitus, Type 2/genetics , Gene Expression , Gene Expression Profiling , Gene Regulatory Networks , Humans , MicroRNAs/genetics , Muscle ProteinsABSTRACT
OBJECTIVE@#To analyze the dynamic molecular expression characteristics of single cell RNA binding proteins (RBPs) in the development of mouse embryonic hematopoitic stem cells (HSCs), and obtain the functional research target RNA splicing factor--Mbnl1, to clarify the function of Mbnl1 involved in regulating mouse embryonic HSC development.@*METHODS@#Bioinformatics was used to analyze the single-cell transcriptome data of mouse embryos during HSC development, and the single-cell RBP dynamic molecular expression maps in HSC development was obtained. Mbnl1 was obtained by combining differential analysis and literature research screening. The Mbnl1-knockout mouse model was constructed by the CRISPER/Cas9 technology. Aorta-gonad-mesonephros (AGM) and yolk sac (YS) tissue in two genotype embryos of Mbnl1@*RESULTS@#The in vitro CFU-C experiment of hematopoietic cells preliminarily indicated that there was no significant difference in the number of cell colonies in AGM region and YS transformed by the two genotypes of Mbnl1@*CONCLUSION@#Through functional experiments in vivo and in vitro, it has been confirmed that knockout of the RNA splicing factor--Mbnl1 does not affect the development of HSPC in AGM region of mouse embryo.
Subject(s)
Animals , DNA-Binding Proteins , Gonads , Hematopoiesis , Hematopoietic Stem Cells , Mesonephros , Mice , RNA-Binding Proteins/genetics , Yolk SacABSTRACT
Sickle cell disease (SCD) is a single gene genetic disease, which seriously threatens the life span and quality of patients. On the basis of the pathogenesis of SCD and the alternative therapy based on fetal hemoglobin F (HbF), the research progress of transcription factors involved in the regulation of HbF gene expression, such as BCL11A, ZBTB7A, KLF-1, c-MYB and SOX6, as well as the application of CRISPR / Cas9, TALEN, zinc finger nuclease and other gene editing technologies in this field has been made, providing a solid theoretical basis for the exploration of new treatment schemes for β- like hemoglobin diseases, such as sickle cell disease and β- thalassemia.
Subject(s)
Anemia, Sickle Cell/therapy , Cell Line, Tumor , DNA-Binding Proteins , Fetal Hemoglobin/genetics , Genetic Therapy , Humans , Repressor Proteins/genetics , Transcription FactorsABSTRACT
OBJECTIVE@#To investigate the relationship between acute myeloid leukemia (AML) patients ASXL2, ZBTB7A gene mutations and the prognosis.@*METHODS@#42 AML Patients treated in our hospital from January 2014 to January 2016 were selected and ASXL2 and ZBTB7A genes of their bone marrow samples were sequenced, the genetic characteristics and prognosis of core-binding factor-AML(CBF-AML) patients with ASXL2 and ZBTB7A mutations were analyzed.@*RESULTS@#ASXL2 (33.3%) and ZBTB7A (9.5%) mutations were found in t (8; 21) AML patients. Compared with wild-type, patients with ASXL2 mutations showed significantly higher white blood cell count at diagnosis [(9.49±1.85)×10@*CONCLUSION@#ASXL2 and ZBTB7A mutations are frequently found in t (8; 21) AML patients. The mutation of ASXL2 and ZBTB7A genes shows no significant effect on the prognosis of AML patients.
Subject(s)
Cell Line, Tumor , DNA-Binding Proteins/genetics , Humans , Leukemia, Myeloid, Acute/genetics , Mutation , Oncogene Proteins, Fusion/genetics , Prognosis , Repressor Proteins/genetics , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To explore the genetic basis for a child with mental and motor retardation, language impairment, facial dysmorphism and epilepsy.@*METHODS@#Whole exome sequencing was carried out to detect pathogenic variant in the proband, and candidate variant was selected based on his phenotype. Sanger sequencing was used to verify the variant in the proband, his parents and other family members.@*RESULTS@#The proband was found to carry a frameshifting mutation of MBD5 gene, namely c.2217delT (p.F739Lfs*6), which was inherited from his mother and unreported previously. Sanger sequencing confirmed that his brother carried the same mutation with a similar phenotype. His mother also had poor language expression when she was young, in addition with poor academic performance, though she could do some housework and had no history of convulsion.@*CONCLUSION@#A novel pathogenic variant of the MBD5 gene was discovered, which has enriched the mutational spectrum of the MBD5 gene. Above discovery has enabled genetic counseling and prenatal diagnosis for the family.
Subject(s)
Child , DNA-Binding Proteins/genetics , Female , Humans , Intellectual Disability/genetics , Male , Mutation , Pedigree , Phenotype , Pregnancy , Whole Exome SequencingABSTRACT
FAM60A,a cell cycle protein,is a subunit of the SIN3 transcription regulator family member A/histone deacetylase(SIN3-HDAC)complex and plays an important role in cell cycle regulation,cell morphology change,cell proliferation,differentiation and migration,early embryogenesis and so on.Studies in recent years have shown that FAM60A plays a role in the occurrence and development of tumors including human osteosarcoma,esophageal cancer,gastric cancer,lung cancer and liver cancer,providing a new research direction for tumor diagnosis and treatment.Based on the research results in recent years at home and abroad,this paper discussed the effects of FAM60A on cellular functions.
Subject(s)
Cell Cycle Proteins , Cell Differentiation , Cell Proliferation , DNA-Binding Proteins , Humans , Sin3 Histone Deacetylase and Corepressor ComplexABSTRACT
OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.