Bioinformatics and expression analysis of the Xeroderma Pigmentosum complementation group C (XPC) of Trypanosoma evansi in Trypanosoma cruzi cells / Análises de bioinformática e da expressão do gene Xeroderma Pigmentosum complementation group C (XPC) de Trypanosoma evansi em células de Trypanosoma cruzi

Abstract Nucleotide excision repair (NER) acts repairing damages in DNA, such as lesions caused by cisplatin. Xeroderma Pigmentosum complementation group C (XPC) protein is involved in recognition of global genome DNA damages during NER (GG-NER) and it has been studied in different organisms due to its importance in other cellular processes. In this work, we studied NER proteins in Trypanosoma cruzi and Trypanosoma evansi, parasites of humans and animals respectively. We performed three-dimensional models of XPC proteins from T. cruzi and T. evansi and observed few structural differences between these proteins. In our tests, insertion of XPC gene from T. evansi (TevXPC) in T. cruzi resulted in slower cell growth under normal conditions. After cisplatin treatment, T. cruzi overexpressing its own XPC gene (TcXPC) was able to recover cell division rates faster than T. cruzi expressing TevXPC gene. Based on these tests, it is suggested that TevXPC (being an exogenous protein in T. cruzi) interferes negatively in cellular processes where TcXPC (the endogenous protein) is involved. This probably occurred due interaction of TevXPC with some endogenous molecules or proteins from T.cruzi but incapacity of interaction with others. This reinforces the importance of correctly XPC functioning within the cell.

Resumo O reparo por excisão de nucleotídeos (NER) atua reparando danos no DNA, como lesões causadas por cisplatina. A proteína Xeroderma Pigmentosum complementation group C (XPC) está envolvida no reconhecimento de danos pela via de reparação global do genoma pelo NER (GG-NER) e tem sido estudada em diferentes organismos devido à sua importância em outros processos celulares. Neste trabalho, estudamos proteínas do NER em Trypanosoma cruzi e Trypanosoma evansi, parasitos de humanos e animais, respectivamente. Modelos tridimensionais das proteínas XPC de T. cruzi e T. evansi foram feitos e observou-se poucas diferenças estruturais entre estas proteínas. Durante testes, a inserção do gene XPC de T. evansi (TevXPC) em T. cruzi resultou em crescimento celular mais lento em condições normais. Após o tratamento com cisplatina, T. cruzi superexpressando seu próprio gene XPC (TcXPC) foi capaz de recuperar as taxas de divisão celular mais rapidamente do que T. cruzi expressando o gene TevXPC. Com base nesses testes, sugere-se que TevXPC (sendo uma proteína exógena em T. cruzi) interfere negativamente nos processos celulares em que TcXPC (a proteína endógena) está envolvida. Isso provavelmente ocorreu pois TevXPC é capaz de interagir com algumas moléculas ou proteínas endógenas de T.cruzi, mas é incapaz de interagir com outras. Isso reforça a importância do correto funcionamento de XPC dentro da célula.

Clinical phenotypes and genetic features of epilepsy children with MBD5 gene variants / 中华儿科杂志

Objective: To summarize the phenotypes of epilepsy in patients with MBD5 gene variants. Methods: A total of 9 epileptic patients, who were treated in the Department of Pediatrics, Peking University First Hospital from July 2016 to September 2021 and detected with MBD5 gene pathogenic variants, were enrolled. The features of clinical manifestations, electroencephalogram (EEG), and neuroimaging were analyzed retrospectively. Results: Among 9 patients, 6 were male and 3 were female. Age at seizure onset ranged from 5 to 89 months. Multiple seizure types were observed, including generalized tonic clonic seizures (GTCS) in 7 patients, myoclonic seizures in 5 patients, focal seizures in 5 patients, atypical absence seizures in 3 patients, atonic seizures in 2 patients, myoclonus absence seizures in 1 patient, epileptic spasms in 1 patient, and tonic seizures in 1 patient. There were 8 patients with multiple seizure types, 2 patients with sensitivity to fever and 5 patients with clustering of seizures. Two patients had a history of status epilepticus. All patients had developmental delay before seizure onset. Nine patients had obvious language delay, and 6 patients had autism-like manifestations. Five patients had slow background activity in EEG. Interictal EEG showed abnormal discharges in 9 patients. Brain magnetic resonance imaging (MRI) was normal in all patients. A total of 9 epileptic patients carried MBD5 gene variants, all of them were de novo variants. There were MBD5 gene overall heterozygous deletion in 1 patient, large fragment deletions including MBD5 gene in 3 patients and single nucleotide variations (c.300C>A/p.C100X, c.1775delA/p.N592Tfs*29, c.1759C>T/p.Q587X, c.150_151del/p.Lys51Asnfs*6, c.113+1G>C) in 5 patients. The age at last follow-up ranged from 2 years and 9 months to 11 years and 11 months. At the last follow-up, 2 patients were seizure-free for more than 11 months to 4 years 6 months, 7 patients still had seizures. Conclusions: The initial seizure onset in patients with MBD5 gene variants usually occurs in infancy. Most patients have multiple seizure types. The seizures may be fever sensitive and clustered. Developmental delays, language impairments, and autistic behaviors are common. MBD5 gene variants include single nucleotide variations and fragment deletions. Epilepsy associated with MBD5 gene variants is usually refractory.

Analysis of clinical significance and prognostic impact of TET2 single nucleotide polymorphism I1762V in patients with acute myeloid leukemia / 中华血液学杂志

Objective: This study aimed to investigate the clinical and prognostic significance of TET2 single nucleotide polymorphism I1762V in patients with acute myeloid leukemia (AML) . Methods: The high-throughput sequencing method was used to sequence 58 hematological tumor-related genes in bone marrow samples from 413 patients with AML. TET2 I1762V and other somatic mutations were annotated and compared with patients' clinical information and prognosis. Results: I1762V was found in 154 patients with AML, which was significantly different from the general population in NyuWa Chinese Population Variant Database (χ(2)=72.4, P<0.001) . I1762V was not related to sex, age, and karyotype of patients with AML (P>0.05) . Patients with I1762V had a significantly higher proportion of NPM1 and KIT gene mutations than others (P<0.001) . NPM1 and KIT mutations were mutually exclusive. The survival analysis results revealed that the overall survival (OS) and progression-free survival (PFS) of patients with AML with I1762V were significantly greater than those of wild-type patients (HR=0.57, P=0.030; HR=0.55, P=0.020) , whereas the OS and PFS in patients with AML with DNMT3A mutation (with or without I1762V mutation) were lower than those of wild-type patients (HR=1.79, P=0.030; HR=1.74, P=0.040) . Conclusion: TET2 SNP I1762V has been linked to AML. I1762V is a prognostic factor of patients with AML, which can be used to guide the treatment and evaluate the prognosis of AML.

Analysis of a case with Xia-Gibbs syndrome due to variant of AHDC1 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical and genetic characteristics of a child featuring Xia-Gibbs syndrome.@*METHODS@#Whole exome sequencing was carried out for the child.@*RESULTS@#The patient has presented with developmental delay, hypotonia, strabismus and snoring. Cranial MRI revealed hypomyelination, while the EEGs were normal. Genetic testing revealed a de novo variant of the AHDC1 gene, namely c.730delA (p.Ile244Serfs*16), which was classified as pathogenic (PVS1+PS2+PM2). Together with 60 cases from the literature, individuals harboring a AHDC1 variant commonly have delayed motor milestones, speech delay, facial dysmorphism and hypotonia. Dysgenesis of corpus callosum is also common. In total 47 AHDC1 variants have been reported, among which truncating variants were the most common type.@*CONCLUSION@#The c.730delA (p.Ile244Serfs*16) variant of the AHDC1 gene probably underlay the Xia-Gibbs syndrome in this patient. Above finding has provided a basis for the clinical diagnosis.

Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.

Analysis of ARID1B gene variants in two Chinese pedigrees with Coffin-Siris syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for two Chinese pedigrees affected with Coffin-Siris syndrome (CSS).@*METHODS@#Whole exome sequencing (WES) was carried out for the probands. Candidate variants were verified by Sanger sequencing of the probands and their family members.@*RESULTS@#The two probands were respectively found to harbor a heterozygous c.5467delG (p.Gly1823fs) variant and a heterozygous c.5584delA (p.Lys1862fs) variant of the ARID1B gene, which were both of de novo in origin and unreported previously. Based on the guidelines of American College of Medical Genetics and Genomics, both variants were predicted to be pathogenic (PVS1+PS2+PM2).@*CONCLUSION@#The c.5467delG (p.Gly1823fs) and c.5545delA (p.Lys1849fs) variants of the ARID1B genes probably underlay the CSS in the two probands. Above results have enabled genetic counselling and prenatal diagnosis for the pedigrees.

The association between the histopathological features and microsatellite instability in young patients with urothelial carcinoma of the bladder

SUMMARY OBJECTIVE: Bladder cancer under the age of 40 is extremely rare. Bladder cancer development involves complex and multi-stage processes, one of which is the DNA damage repair mechanism. In this retrospective study, we aimed to evaluate the histopathological features of bladder urothelial carcinoma seen in patients under 40 years of age and tumor microsatellite instability status using immunohistochemistry. METHODS: A total of 50 patients under the age of 40 with urothelial bladder carcinoma from two different centers in the same country were included. Expression of the mismatch repair proteins MLH1, MSH2, MSH6, and PMS2 was analyzed by immunohistochemistry. RESULTS: Age at the time of diagnosis ranged from 17 to 40 years old. Most tumors were non-invasive papillary urothelial carcinoma. Two cases had nuclear loss of MSH-6 and PMS-2. We observed that tumor grade, tumor stage, presence of tumor differentiation, and infiltrative growth pattern of the tumor have significant impact on prognosis, but microsatellite instability does not have an effective role in bladder carcinogenesis in young patients. CONCLUSIONS: Our results indicate that the presence of microsatellite instability is not related to the low tumor grade and stage in urothelial neoplasms in young patients, suggesting that urothelial carcinoma of the bladder in young patients may represent a genetically stable form of neoplasia.

Clinical Significance of Truncated Mutant ΔJBP of TET2 Gene in Patients with Acute Myeloid Leukemia / 中国实验血液学杂志

OBJECTIVE@#To the clinical characteristics and prognostic value of the patients with complete deletion of TET_JBP domain (ΔJBP) in TET2 acute myeloid leukemia (AML).@*METHODS@#Next Generation Sequencing technology was used to determine the mutations of 34 AML-related genes (including TET2 gene). The I-TASSER tool was used to predict the tertiary structure of the full-length TET2 protein and TET_JBP structure deletion.@*RESULTS@#Among 38 AML patients with TET2 mutations, 22(57.9%) showed truncation mutations, of which 16 (72.7%) produced TET2ΔJBP truncation mutants. Protein structure prediction showed that the deletion of TET_JBP domain lead to the significant changes of tertiary structure in TET2 protein. Compared with the patients in non-ΔJBP group, the age of patients in ΔJBP group were older (63 vs 54 years old, P=0.047), and the occurrence rate of CEBPA double mutation (CEBPA@*CONCLUSION@#AML patients with TET2ΔJBP truncation mutant shows lower CR rate, shorter EFS and OS after induction chemotherapy, which may be related to the poor prognosis, and co-mutation with CEBPA

De novo ALX4 variant detected in child with non-syndromic craniosynostosis

Current understanding of the genetic factors contributing to the etiology of non-syndromic craniosynostosis (NSC) remains scarce. The present work investigated the presence of variants in ALX4, EFNA4, and TWIST1 genes in children with NSC to verify if variants within these genes may contribute to the occurrence of these abnormal phenotypes. A total of 101 children (aged 45.07±40.94 months) with NSC participated in this cross-sectional study. Parents and siblings of the probands were invited to participate. Medical and family history of craniosynostosis were documented. Biological samples were collected to obtain genomic DNA. Coding exons of human TWIST1, ALX4, and EFNA4 genes were amplified by polymerase chain reaction and Sanger sequenced. Five missense variants were identified in ALX4 in children with bilateral coronal, sagittal, and metopic synostosis. A de novo ALX4 variant, c.799G>A: p.Ala267Thr, was identified in a proband with sagittal synostosis. Three missense variants were identified in the EFNA4 gene in children with metopic and sagittal synostosis. A TWIST1 variant occurred in a child with unilateral coronal synostosis. Variants were predicted to be among the 0.1% (TWIST1, c.380C>A: p. Ala127Glu) and 1% (ALX4, c.769C>T: p.Arg257Cys, c.799G>A: p.Ala267Thr, c.929G>A: p.Gly310Asp; EFNA4, c.178C>T: p.His60Tyr, C.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr) most deleterious variants in the human genome. With the exception of ALX4, c.799G>A: p.Ala267Thr, all other variants were present in at least one non-affected family member, suggesting incomplete penetrance. Thus, these variants may contribute to the development of craniosynostosis, and should not be discarded as potential candidate genes in the diagnosis of this condition.

Treatment and genetic analysis of a child with Kabuki syndrome type 2 and secondary pulmonary infection due to a de novo variant of KDM6A gene / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis of a child with recurrent infection, multiple malformation and dysmorphism.@*METHODS@#The child and his parents were subjected to trio whole exome sequencing.@*RESULTS@#The child had a complaint of fever and cough, with long and thin eye fissures and long eyelashes. Genetic testing revealed that the child has carried a non-triplet deletion of the KDM6A gene, which was unreported previously. The variant resulted in frameshift and premature termination of the translation. His parents were both of the wild type for the locus. After antibiotic and immunoglobulin treatment, the severe secondary pneumonia caused by immunodeficiency has improved.@*CONCLUSION@#With combined laboratory test, imaging examination and genetic testing, the child was ultimately diagnosed with Kabuki syndrome type 2. The characteristics of immunodeficiency of Kabuki syndrome may render conventional antibiotic treatment ineffective, which deserves clinical attention.

DDB1- and CUL4-associated factor 8 plays a critical role in spermatogenesis / 医学前沿

Cullin-RING E3 ubiquitin ligase (CRL)-4 is a member of the large CRL family in eukaryotes. It plays important roles in a wide range of cellular processes, organismal development, and physiological and pathological conditions. DDB1- and CUL4-associated factor 8 (DCAF8) is a WD40 repeat-containing protein, which serves as a substrate receptor for CRL4. The physiological role of DCAF8 is unknown. In this study, we constructed Dcaf8 knockout mice. Homozygous mice were viable with no noticeable abnormalities. However, the fertility of Dcaf8-deficient male mice was markedly impaired, consistent with the high expression of DCAF8 in adult mouse testis. Sperm movement characteristics, including progressive motility, path velocity, progressive velocity, and track speed, were significantly lower in Dcaf8 knockout mice than in wild-type (WT) mice. However, the total motility was similar between WT and Dcaf8 knockout sperm. More than 40% of spermatids in Dcaf8 knockout mice showed pronounced morphological abnormalities with typical bent head malformation. The acrosome and nucleus of Dcaf8 knockout sperm looked similar to those of WT sperm. In vitro tests showed that the fertilization rate of Dcaf8 knockout mice was significantly reduced. The results demonstrated that DCAF8 plays a critical role in spermatogenesis, and DCAF8 is a key component of CRL4 function in the reproductive system.

Advance in research on the role of MAMLD1 gene in disorders of sex development / 中华医学遗传学杂志

MAMLD1 gene has been implicated in 46,XY disorders of sex development (DSD) in recent years. Patients carrying MAMLD1 gene variants showed a "continuous spectrum" of simple micropenis, mild, moderate and severe hypospadias with micropenis, cryptorchidism, split scrotum and even complete gonadal dysplasia. The function of MAMLD1 gene in sexual development has not been fully elucidated, and its role in DSD has remained controversial. This article has reviewed recent findings on the role of the MAMLD1 gene in DSD, including the MAMLD1 gene, its encoded protein, genetic variants, clinical phenotype and possible pathogenic mechanism in DSD.

Analysis of clinical manifestation and a mosaic frameshift variant of the KMT2D gene in a Chinese patient with Kabuki syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genotype-phenotype correlation in a child with Kabuki syndrome type 1 (KS1) caused by a mosaic frameshift variant of KMT2D gene.@*METHODS@#Trio-based whole exome sequencing (WES) was carried for the patient and her parents. Candidate variant was verified by Sanger sequencing.@*RESULTS@#The proband, a 3-year-and-2-month-old Chinese girl, presented with distinctive facial features, cognitive impairment, mild developmental delay, dermatoglyphic abnormalities, minor skeletal anomalies, ventricular septal defect, and autistic behavior. Trio-based WES revealed that the proband has carried a de novo mosaic frameshit variant of the KMT2D gene, namely NM_003482.3:c.13058delG (p.Pro4353Argfs*31) (GRCh37/hg19), for which the mosaicism rate was close to 21%. The variant was unreported previously and was confirmed by Sanger sequencing. Chromosomal microarray analysis (CMA) has revealed no pathogenic or likely pathogenic copy number variations. Compared with previously reported cases, our patient has presented obvious behavior anomalies including autism, anxiety and sleep problems, which were rarely reported.@*CONCLUSION@#This study has expanded the spectrum of KMT2D gene variants, enriched the clinical phenotypes of KS1, and facilitated genetic counseling for the family.

Roles of ten eleven translocation proteins family and 5-hydroxymethylcytosine in epigenetic regulation of stem cells and regenerative medicine / 北京大学学报(医学版)

The methylation of cytosine is one of the most fundamental epigenetic modifications in mammalian genomes, and is involved in multiple crucial processes including gene expression, cell differentiation, embryo development and oncogenesis. In the past, DNA methylation was thought to be an irreversible process, which could only be diluted passively through DNA replication. It is now becoming increa-singly obvious that DNA demethylation can be an active process and plays a crucial role in biological processes. Ten eleven translocation (TET) proteins are the key factors modulating DNA demethylation. This family contains three members: TET1, TET2 and TET3. Although three TET proteins have relatively conserved catalytic domains, their roles in organisms are not repeated, and their expression has significant cell/organ specificity. TET1 is mainly expressed in embryonic stem cells, TET2 is mainly expressed in hematopoietic system, and TET3 is widely expressed in cerebellum, cortex and hippocampus. This family catalyzes 5-methylcytosine to 5-hydroxymethylcytosine and other oxidative products, reactivates silenced-gene expression, in turn maintains stem cell pluripotency and regulates lineage specification. With the development of tissue engineering, organ transplantation, autologous tissue transplantation and artificial prosthesis have been widely used in clinical treatment, but these technologies have limitations. Regenerative medicine, which uses stem cells and stem cell related factors for treatment, may provide alternative therapeutic strategies for multiple diseases. Among all kinds of human stem cells, adipose-derived stem cells (ADSCs) are the most prospective stem cell lineage since they have no ethical issues and can be easily obtained with large quantities. To date, ADSCs have been shown to have strong proli-feration capacity, secrete numerous soluble factors and have multipotent differentiation ability. However, the underlying mechanism of the proliferation, secretion, acquired pluripotency, and lineage specific differentiation of ADSCs are still largely unknown. Some studies have explored the role of epigenetic regulation and TET protein in embryonic stem cells, but little is known about its role in ADSCs. By studying the roles of TET proteins and 5-hydroxymethylcytosine in ADSCs, we could provide new theoretical foundation for the clinical application of ADSCs and the stem cell-based therapy. In the future, combined with bioprinting technology, ADSCs may be used in tissue and organ regeneration, plastic surgery reconstruction and other broader fields.

The Relationship between ASXL2 and ZBTB7A Gene Mutations and Prognosis in Patients with Acute Myeloid Leukemia / 中国实验血液学杂志

OBJECTIVE@#To investigate the relationship between acute myeloid leukemia (AML) patients ASXL2, ZBTB7A gene mutations and the prognosis.@*METHODS@#42 AML Patients treated in our hospital from January 2014 to January 2016 were selected and ASXL2 and ZBTB7A genes of their bone marrow samples were sequenced, the genetic characteristics and prognosis of core-binding factor-AML(CBF-AML) patients with ASXL2 and ZBTB7A mutations were analyzed.@*RESULTS@#ASXL2 (33.3%) and ZBTB7A (9.5%) mutations were found in t (8; 21) AML patients. Compared with wild-type, patients with ASXL2 mutations showed significantly higher white blood cell count at diagnosis ［(9.49±1.85)×10@*CONCLUSION@#ASXL2 and ZBTB7A mutations are frequently found in t (8; 21) AML patients. The mutation of ASXL2 and ZBTB7A genes shows no significant effect on the prognosis of AML patients.

Identification of a novel mutation of MBD5 gene in a pedigree affected with autosomal dominant mental retardation type 1 / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for a child with mental and motor retardation, language impairment, facial dysmorphism and epilepsy.@*METHODS@#Whole exome sequencing was carried out to detect pathogenic variant in the proband, and candidate variant was selected based on his phenotype. Sanger sequencing was used to verify the variant in the proband, his parents and other family members.@*RESULTS@#The proband was found to carry a frameshifting mutation of MBD5 gene, namely c.2217delT (p.F739Lfs*6), which was inherited from his mother and unreported previously. Sanger sequencing confirmed that his brother carried the same mutation with a similar phenotype. His mother also had poor language expression when she was young, in addition with poor academic performance, though she could do some housework and had no history of convulsion.@*CONCLUSION@#A novel pathogenic variant of the MBD5 gene was discovered, which has enriched the mutational spectrum of the MBD5 gene. Above discovery has enabled genetic counseling and prenatal diagnosis for the family.

Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

LIM domain only 1: an oncogenic transcription cofactor contributing to the tumorigenesis of multiple cancer types / 中华医学杂志(英文版)

The LIM domain only 1 (LMO1) gene belongs to the LMO family of genes that encodes a group of transcriptional cofactors. This group of transcriptional cofactors regulates gene transcription by acting as a key "connector" or "scaffold" in transcription complexes. All LMOs, including LMO1, are important players in the process of tumorigenesis. Unique biological features of LMO1 distinct from other LMO members, such as its tissue-specific expression patterns, interacting proteins, and transcriptional targets, have been increasingly recognized. Studies indicated that LMO1 plays a critical oncogenic role in various types of cancers, including T-cell acute lymphoblastic leukemia, neuroblastoma, gastric cancer, lung cancer, and prostate cancer. The molecular mechanisms underlying such functions of LMO1 have also been investigated, but they are currently far from being fully elucidated. Here, we focus on reviewing the current findings on the role of LMO1 in tumorigenesis, the mechanisms of its oncogenic action, and the mechanisms that drive its aberrant activation in cancers. We also briefly review its roles in the development process and non-cancer diseases. Finally, we discuss the remaining questions and future investigations required for promoting the translation of laboratory findings to clinical applications, including cancer diagnosis and treatment.

Polymorphism in GRHL2 gene may contribute to noise-induced hearing loss susceptibility: a meta-analysis / Polimorfismo no gene GRHL2 pode contribuir para a suscetibilidade à perda auditivainduzida por ruído: uma metanálise

Abstract Instruction: Noise-induced hearing loss is a leading occupational disease caused by gene-environment interaction. The Grainy Like 2, GRHL2, is a candidate gene. In this regard, many studies have evaluated the association between GRHL2 and noise-induced hearing loss, although the results are ambiguous and conflicting. Objective: The purpose of this study was to identify a precise estimation of the association between rs3735715 polymorphism in GRHL2 gene and susceptibility of noise-induced hearing loss. Methods: A comprehensive search was performed to collect data up to July 8, 2018. Finally, 4 eligible articles were included in this meta-analysis comprising 2410 subjects. The pooled odds ratios with 95% confidence intervals were used to evaluate the strength of the association. Results: Significant association was found in the overall population in the dominant model (GA/AA vs. GG, odds ratio = 0.707, 95% confidence interval = 0.594-0.841) and allele model (G allele vs. A allele, odds ratio = 1.189, 95% confidence interval = 1.062-1.333). When stratified by source of the subjects, we also found association between rs3735715 and noise-induced hearing loss risk in the dominant model (GA/AA vs. GG, odds ratio = 0.634, 95% confidence interval = 0.514-0.783) and allele model (G allele vs. A allele, odds ratio = 1.206, 95% confidence interval = 1.054-1.379). Conclusion: Rs3735715 polymorphism in GRHL2 gene may influence the susceptibility of noise-induced hearing loss. Additional large, well-designed and functional studies are needed to confirm this association in different populations.

Resumo Introdução: Perda auditiva induzida por ruído é uma das principais doenças ocupacionais causadas pela interação gene-ambiente. O Grainy Like 2, ou GRHL2 é um gene que tem sido considerado como candidato. Nesse sentido, muitos estudos avaliaram a associação entre o GRHL2 e perda auditiva induzida por ruído, embora os resultados sejam ambíguos e conflitantes. Objetivo: Identificar uma estimativa precisa da associação entre o polimorfismo rs3735715 no gene GRHL2 e a suscetibilidade à perda auditiva induzida por ruído. Método: Uma pesquisa abrangente foi feita para coletar dados até 8 de julho de 2018. No fim, quatro artigos elegíveis foram incluídos nesta metanálise, abrangeram 2.410 indivíduos. As odds ratios agrupadas com intervalos de confiança de 95% foram usadas para avaliar a força da associação. Resultados: Uma associação significante foi encontrada na população geral no modelo de dominância (GA/AA vs. GG, odds ratio = 0,707, intervalo de confiança 95% = 0,594-0,841) e modelo de alelo (alelo G vs. alelo A; odds ratio = 1,189, intervalo de confiança 95% = 1,062 a 1,333). Quando estratificados pelo local de trabalho dos indivíduos, também encontramos associação entre rs3735715 e risco de perda auditiva induzida por ruído no modelo de dominância (GA/AA vs. GG, odds ratio = 0,634, intervalo de confiança 95% = 0,514 ± 0,783) e modelo de alelo (alelo G vs. alelo A; odds ratio = 1,206, intervalo de confiança 95% = 1,054- 1,379). Conclusão: O polimorfismo Rs3735715 no gene GRHL2 pode influenciar a suscetibilidade à perda auditiva induzida por ruído. Estudos adicionais, amplos, bem desenhados e funcionais são necessários para confirmar essa associação em diferentes populações.

Espectro fenotípico de Síndrome de CHARGE neonatal / Phenotypic spectrum of neonatal CHARGE syndrome

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.

INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.