Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 117
Filter
1.
Braz. j. biol ; 83: e243910, 2023. tab, graf
Article in English | MEDLINE, LILACS, VETINDEX | ID: biblio-1278525

ABSTRACT

Abstract Nucleotide excision repair (NER) acts repairing damages in DNA, such as lesions caused by cisplatin. Xeroderma Pigmentosum complementation group C (XPC) protein is involved in recognition of global genome DNA damages during NER (GG-NER) and it has been studied in different organisms due to its importance in other cellular processes. In this work, we studied NER proteins in Trypanosoma cruzi and Trypanosoma evansi, parasites of humans and animals respectively. We performed three-dimensional models of XPC proteins from T. cruzi and T. evansi and observed few structural differences between these proteins. In our tests, insertion of XPC gene from T. evansi (TevXPC) in T. cruzi resulted in slower cell growth under normal conditions. After cisplatin treatment, T. cruzi overexpressing its own XPC gene (TcXPC) was able to recover cell division rates faster than T. cruzi expressing TevXPC gene. Based on these tests, it is suggested that TevXPC (being an exogenous protein in T. cruzi) interferes negatively in cellular processes where TcXPC (the endogenous protein) is involved. This probably occurred due interaction of TevXPC with some endogenous molecules or proteins from T.cruzi but incapacity of interaction with others. This reinforces the importance of correctly XPC functioning within the cell.


Resumo O reparo por excisão de nucleotídeos (NER) atua reparando danos no DNA, como lesões causadas por cisplatina. A proteína Xeroderma Pigmentosum complementation group C (XPC) está envolvida no reconhecimento de danos pela via de reparação global do genoma pelo NER (GG-NER) e tem sido estudada em diferentes organismos devido à sua importância em outros processos celulares. Neste trabalho, estudamos proteínas do NER em Trypanosoma cruzi e Trypanosoma evansi, parasitos de humanos e animais, respectivamente. Modelos tridimensionais das proteínas XPC de T. cruzi e T. evansi foram feitos e observou-se poucas diferenças estruturais entre estas proteínas. Durante testes, a inserção do gene XPC de T. evansi (TevXPC) em T. cruzi resultou em crescimento celular mais lento em condições normais. Após o tratamento com cisplatina, T. cruzi superexpressando seu próprio gene XPC (TcXPC) foi capaz de recuperar as taxas de divisão celular mais rapidamente do que T. cruzi expressando o gene TevXPC. Com base nesses testes, sugere-se que TevXPC (sendo uma proteína exógena em T. cruzi) interfere negativamente nos processos celulares em que TcXPC (a proteína endógena) está envolvida. Isso provavelmente ocorreu pois TevXPC é capaz de interagir com algumas moléculas ou proteínas endógenas de T.cruzi, mas é incapaz de interagir com outras. Isso reforça a importância do correto funcionamento de XPC dentro da célula.


Subject(s)
Humans , Animals , Trypanosoma cruzi/genetics , Xeroderma Pigmentosum , DNA Damage/genetics , Computational Biology , DNA-Binding Proteins/genetics , DNA-Binding Proteins/metabolism , DNA Repair/genetics
2.
Rev. Assoc. Med. Bras. (1992) ; 67(1): 64-70, Jan. 2021. tab, graf
Article in English | LILACS | ID: biblio-1287776

ABSTRACT

SUMMARY OBJECTIVE: Bladder cancer under the age of 40 is extremely rare. Bladder cancer development involves complex and multi-stage processes, one of which is the DNA damage repair mechanism. In this retrospective study, we aimed to evaluate the histopathological features of bladder urothelial carcinoma seen in patients under 40 years of age and tumor microsatellite instability status using immunohistochemistry. METHODS: A total of 50 patients under the age of 40 with urothelial bladder carcinoma from two different centers in the same country were included. Expression of the mismatch repair proteins MLH1, MSH2, MSH6, and PMS2 was analyzed by immunohistochemistry. RESULTS: Age at the time of diagnosis ranged from 17 to 40 years old. Most tumors were non-invasive papillary urothelial carcinoma. Two cases had nuclear loss of MSH-6 and PMS-2. We observed that tumor grade, tumor stage, presence of tumor differentiation, and infiltrative growth pattern of the tumor have significant impact on prognosis, but microsatellite instability does not have an effective role in bladder carcinogenesis in young patients. CONCLUSIONS: Our results indicate that the presence of microsatellite instability is not related to the low tumor grade and stage in urothelial neoplasms in young patients, suggesting that urothelial carcinoma of the bladder in young patients may represent a genetically stable form of neoplasia.


Subject(s)
Humans , Adolescent , Adult , Young Adult , Carcinoma, Transitional Cell/genetics , Microsatellite Instability , Urinary Bladder/metabolism , Retrospective Studies , DNA-Binding Proteins/genetics , DNA-Binding Proteins/metabolism , DNA Mismatch Repair
3.
Article in Chinese | WPRIM | ID: wpr-879566

ABSTRACT

OBJECTIVE@#To explore the genetic basis for a child with mental and motor retardation, language impairment, facial dysmorphism and epilepsy.@*METHODS@#Whole exome sequencing was carried out to detect pathogenic variant in the proband, and candidate variant was selected based on his phenotype. Sanger sequencing was used to verify the variant in the proband, his parents and other family members.@*RESULTS@#The proband was found to carry a frameshifting mutation of MBD5 gene, namely c.2217delT (p.F739Lfs*6), which was inherited from his mother and unreported previously. Sanger sequencing confirmed that his brother carried the same mutation with a similar phenotype. His mother also had poor language expression when she was young, in addition with poor academic performance, though she could do some housework and had no history of convulsion.@*CONCLUSION@#A novel pathogenic variant of the MBD5 gene was discovered, which has enriched the mutational spectrum of the MBD5 gene. Above discovery has enabled genetic counseling and prenatal diagnosis for the family.


Subject(s)
Child , DNA-Binding Proteins/genetics , Female , Humans , Intellectual Disability/genetics , Male , Mutation , Pedigree , Phenotype , Pregnancy , Whole Exome Sequencing
4.
Article in Chinese | WPRIM | ID: wpr-879519

ABSTRACT

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.


Subject(s)
CHARGE Syndrome/genetics , Child , DNA Helicases/genetics , DNA-Binding Proteins/genetics , Genetic Variation , Humans , Mutation , Phenotype
5.
Article in Chinese | WPRIM | ID: wpr-921968

ABSTRACT

MAMLD1 gene has been implicated in 46,XY disorders of sex development (DSD) in recent years. Patients carrying MAMLD1 gene variants showed a "continuous spectrum" of simple micropenis, mild, moderate and severe hypospadias with micropenis, cryptorchidism, split scrotum and even complete gonadal dysplasia. The function of MAMLD1 gene in sexual development has not been fully elucidated, and its role in DSD has remained controversial. This article has reviewed recent findings on the role of the MAMLD1 gene in DSD, including the MAMLD1 gene, its encoded protein, genetic variants, clinical phenotype and possible pathogenic mechanism in DSD.


Subject(s)
DNA-Binding Proteins/genetics , Disorders of Sex Development/genetics , Humans , Male , Mutation , Nuclear Proteins/genetics , Phenotype , Sexual Development , Transcription Factors/genetics
6.
Article in Chinese | WPRIM | ID: wpr-921956

ABSTRACT

OBJECTIVE@#To explore the genotype-phenotype correlation in a child with Kabuki syndrome type 1 (KS1) caused by a mosaic frameshift variant of KMT2D gene.@*METHODS@#Trio-based whole exome sequencing (WES) was carried for the patient and her parents. Candidate variant was verified by Sanger sequencing.@*RESULTS@#The proband, a 3-year-and-2-month-old Chinese girl, presented with distinctive facial features, cognitive impairment, mild developmental delay, dermatoglyphic abnormalities, minor skeletal anomalies, ventricular septal defect, and autistic behavior. Trio-based WES revealed that the proband has carried a de novo mosaic frameshit variant of the KMT2D gene, namely NM_003482.3:c.13058delG (p.Pro4353Argfs*31) (GRCh37/hg19), for which the mosaicism rate was close to 21%. The variant was unreported previously and was confirmed by Sanger sequencing. Chromosomal microarray analysis (CMA) has revealed no pathogenic or likely pathogenic copy number variations. Compared with previously reported cases, our patient has presented obvious behavior anomalies including autism, anxiety and sleep problems, which were rarely reported.@*CONCLUSION@#This study has expanded the spectrum of KMT2D gene variants, enriched the clinical phenotypes of KS1, and facilitated genetic counseling for the family.


Subject(s)
Abnormalities, Multiple , China , DNA Copy Number Variations , DNA-Binding Proteins/genetics , Face/abnormalities , Female , Hematologic Diseases , Humans , Infant , Neoplasm Proteins/genetics , Phenotype , Vestibular Diseases
7.
Journal of Experimental Hematology ; (6): 1011-1018, 2021.
Article in Chinese | WPRIM | ID: wpr-888512

ABSTRACT

OBJECTIVE@#To the clinical characteristics and prognostic value of the patients with complete deletion of TET_JBP domain (ΔJBP) in TET2 acute myeloid leukemia (AML).@*METHODS@#Next Generation Sequencing technology was used to determine the mutations of 34 AML-related genes (including TET2 gene). The I-TASSER tool was used to predict the tertiary structure of the full-length TET2 protein and TET_JBP structure deletion.@*RESULTS@#Among 38 AML patients with TET2 mutations, 22(57.9%) showed truncation mutations, of which 16 (72.7%) produced TET2ΔJBP truncation mutants. Protein structure prediction showed that the deletion of TET_JBP domain lead to the significant changes of tertiary structure in TET2 protein. Compared with the patients in non-ΔJBP group, the age of patients in ΔJBP group were older (63 vs 54 years old, P=0.047), and the occurrence rate of CEBPA double mutation (CEBPA@*CONCLUSION@#AML patients with TET2ΔJBP truncation mutant shows lower CR rate, shorter EFS and OS after induction chemotherapy, which may be related to the poor prognosis, and co-mutation with CEBPA


Subject(s)
DNA-Binding Proteins/genetics , Humans , Induction Chemotherapy , Leukemia, Myeloid, Acute/genetics , Middle Aged , Mutation , Prognosis , Proto-Oncogene Proteins/genetics , Remission Induction
8.
Article in Chinese | WPRIM | ID: wpr-888374

ABSTRACT

OBJECTIVE@#To explore the genetic basis of a child with recurrent infection, multiple malformation and dysmorphism.@*METHODS@#The child and his parents were subjected to trio whole exome sequencing.@*RESULTS@#The child had a complaint of fever and cough, with long and thin eye fissures and long eyelashes. Genetic testing revealed that the child has carried a non-triplet deletion of the KDM6A gene, which was unreported previously. The variant resulted in frameshift and premature termination of the translation. His parents were both of the wild type for the locus. After antibiotic and immunoglobulin treatment, the severe secondary pneumonia caused by immunodeficiency has improved.@*CONCLUSION@#With combined laboratory test, imaging examination and genetic testing, the child was ultimately diagnosed with Kabuki syndrome type 2. The characteristics of immunodeficiency of Kabuki syndrome may render conventional antibiotic treatment ineffective, which deserves clinical attention.


Subject(s)
Abnormalities, Multiple , Child , DNA-Binding Proteins/genetics , Face/abnormalities , Genetic Testing , Hematologic Diseases , Histone Demethylases/genetics , Humans , Neoplasm Proteins/genetics , Nuclear Proteins/genetics , Phenotype , Pneumonia , Vestibular Diseases
9.
Chinese Medical Journal ; (24): 1017-1030, 2021.
Article in English | WPRIM | ID: wpr-878138

ABSTRACT

The LIM domain only 1 (LMO1) gene belongs to the LMO family of genes that encodes a group of transcriptional cofactors. This group of transcriptional cofactors regulates gene transcription by acting as a key "connector" or "scaffold" in transcription complexes. All LMOs, including LMO1, are important players in the process of tumorigenesis. Unique biological features of LMO1 distinct from other LMO members, such as its tissue-specific expression patterns, interacting proteins, and transcriptional targets, have been increasingly recognized. Studies indicated that LMO1 plays a critical oncogenic role in various types of cancers, including T-cell acute lymphoblastic leukemia, neuroblastoma, gastric cancer, lung cancer, and prostate cancer. The molecular mechanisms underlying such functions of LMO1 have also been investigated, but they are currently far from being fully elucidated. Here, we focus on reviewing the current findings on the role of LMO1 in tumorigenesis, the mechanisms of its oncogenic action, and the mechanisms that drive its aberrant activation in cancers. We also briefly review its roles in the development process and non-cancer diseases. Finally, we discuss the remaining questions and future investigations required for promoting the translation of laboratory findings to clinical applications, including cancer diagnosis and treatment.


Subject(s)
Carcinogenesis/genetics , DNA-Binding Proteins/genetics , Gene Expression Regulation, Neoplastic , Humans , LIM Domain Proteins/genetics , Male , Transcription Factors/metabolism
10.
Frontiers of Medicine ; (4): 302-312, 2021.
Article in English | WPRIM | ID: wpr-880973

ABSTRACT

Cullin-RING E3 ubiquitin ligase (CRL)-4 is a member of the large CRL family in eukaryotes. It plays important roles in a wide range of cellular processes, organismal development, and physiological and pathological conditions. DDB1- and CUL4-associated factor 8 (DCAF8) is a WD40 repeat-containing protein, which serves as a substrate receptor for CRL4. The physiological role of DCAF8 is unknown. In this study, we constructed Dcaf8 knockout mice. Homozygous mice were viable with no noticeable abnormalities. However, the fertility of Dcaf8-deficient male mice was markedly impaired, consistent with the high expression of DCAF8 in adult mouse testis. Sperm movement characteristics, including progressive motility, path velocity, progressive velocity, and track speed, were significantly lower in Dcaf8 knockout mice than in wild-type (WT) mice. However, the total motility was similar between WT and Dcaf8 knockout sperm. More than 40% of spermatids in Dcaf8 knockout mice showed pronounced morphological abnormalities with typical bent head malformation. The acrosome and nucleus of Dcaf8 knockout sperm looked similar to those of WT sperm. In vitro tests showed that the fertilization rate of Dcaf8 knockout mice was significantly reduced. The results demonstrated that DCAF8 plays a critical role in spermatogenesis, and DCAF8 is a key component of CRL4 function in the reproductive system.


Subject(s)
Animals , Cullin Proteins/genetics , DNA-Binding Proteins/genetics , Factor VIII , Male , Mice , Mice, Knockout , Spermatogenesis/genetics , Ubiquitin-Protein Ligases
11.
Article in Chinese | WPRIM | ID: wpr-880096

ABSTRACT

OBJECTIVE@#To investigate the relationship between acute myeloid leukemia (AML) patients ASXL2, ZBTB7A gene mutations and the prognosis.@*METHODS@#42 AML Patients treated in our hospital from January 2014 to January 2016 were selected and ASXL2 and ZBTB7A genes of their bone marrow samples were sequenced, the genetic characteristics and prognosis of core-binding factor-AML(CBF-AML) patients with ASXL2 and ZBTB7A mutations were analyzed.@*RESULTS@#ASXL2 (33.3%) and ZBTB7A (9.5%) mutations were found in t (8; 21) AML patients. Compared with wild-type, patients with ASXL2 mutations showed significantly higher white blood cell count at diagnosis [(9.49±1.85)×10@*CONCLUSION@#ASXL2 and ZBTB7A mutations are frequently found in t (8; 21) AML patients. The mutation of ASXL2 and ZBTB7A genes shows no significant effect on the prognosis of AML patients.


Subject(s)
Cell Line, Tumor , DNA-Binding Proteins/genetics , Humans , Leukemia, Myeloid, Acute/genetics , Mutation , Oncogene Proteins, Fusion/genetics , Prognosis , Repressor Proteins/genetics , Transcription Factors/genetics
12.
Braz. j. med. biol. res ; 54(11): e11396, 2021. graf
Article in English | LILACS | ID: biblio-1339444

ABSTRACT

Current understanding of the genetic factors contributing to the etiology of non-syndromic craniosynostosis (NSC) remains scarce. The present work investigated the presence of variants in ALX4, EFNA4, and TWIST1 genes in children with NSC to verify if variants within these genes may contribute to the occurrence of these abnormal phenotypes. A total of 101 children (aged 45.07±40.94 months) with NSC participated in this cross-sectional study. Parents and siblings of the probands were invited to participate. Medical and family history of craniosynostosis were documented. Biological samples were collected to obtain genomic DNA. Coding exons of human TWIST1, ALX4, and EFNA4 genes were amplified by polymerase chain reaction and Sanger sequenced. Five missense variants were identified in ALX4 in children with bilateral coronal, sagittal, and metopic synostosis. A de novo ALX4 variant, c.799G>A: p.Ala267Thr, was identified in a proband with sagittal synostosis. Three missense variants were identified in the EFNA4 gene in children with metopic and sagittal synostosis. A TWIST1 variant occurred in a child with unilateral coronal synostosis. Variants were predicted to be among the 0.1% (TWIST1, c.380C>A: p. Ala127Glu) and 1% (ALX4, c.769C>T: p.Arg257Cys, c.799G>A: p.Ala267Thr, c.929G>A: p.Gly310Asp; EFNA4, c.178C>T: p.His60Tyr, C.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr) most deleterious variants in the human genome. With the exception of ALX4, c.799G>A: p.Ala267Thr, all other variants were present in at least one non-affected family member, suggesting incomplete penetrance. Thus, these variants may contribute to the development of craniosynostosis, and should not be discarded as potential candidate genes in the diagnosis of this condition.


Subject(s)
Humans , Child , Craniosynostoses/genetics , Transcription Factors/genetics , Base Sequence , Family , Cross-Sectional Studies , Mutation, Missense/genetics , DNA-Binding Proteins/genetics
13.
Braz. j. otorhinolaryngol. (Impr.) ; 86(3): 370-375, May-June 2020. tab, graf
Article in English | LILACS | ID: biblio-1132588

ABSTRACT

Abstract Instruction: Noise-induced hearing loss is a leading occupational disease caused by gene-environment interaction. The Grainy Like 2, GRHL2, is a candidate gene. In this regard, many studies have evaluated the association between GRHL2 and noise-induced hearing loss, although the results are ambiguous and conflicting. Objective: The purpose of this study was to identify a precise estimation of the association between rs3735715 polymorphism in GRHL2 gene and susceptibility of noise-induced hearing loss. Methods: A comprehensive search was performed to collect data up to July 8, 2018. Finally, 4 eligible articles were included in this meta-analysis comprising 2410 subjects. The pooled odds ratios with 95% confidence intervals were used to evaluate the strength of the association. Results: Significant association was found in the overall population in the dominant model (GA/AA vs. GG, odds ratio = 0.707, 95% confidence interval = 0.594-0.841) and allele model (G allele vs. A allele, odds ratio = 1.189, 95% confidence interval = 1.062-1.333). When stratified by source of the subjects, we also found association between rs3735715 and noise-induced hearing loss risk in the dominant model (GA/AA vs. GG, odds ratio = 0.634, 95% confidence interval = 0.514-0.783) and allele model (G allele vs. A allele, odds ratio = 1.206, 95% confidence interval = 1.054-1.379). Conclusion: Rs3735715 polymorphism in GRHL2 gene may influence the susceptibility of noise-induced hearing loss. Additional large, well-designed and functional studies are needed to confirm this association in different populations.


Resumo Introdução: Perda auditiva induzida por ruído é uma das principais doenças ocupacionais causadas pela interação gene-ambiente. O Grainy Like 2, ou GRHL2 é um gene que tem sido considerado como candidato. Nesse sentido, muitos estudos avaliaram a associação entre o GRHL2 e perda auditiva induzida por ruído, embora os resultados sejam ambíguos e conflitantes. Objetivo: Identificar uma estimativa precisa da associação entre o polimorfismo rs3735715 no gene GRHL2 e a suscetibilidade à perda auditiva induzida por ruído. Método: Uma pesquisa abrangente foi feita para coletar dados até 8 de julho de 2018. No fim, quatro artigos elegíveis foram incluídos nesta metanálise, abrangeram 2.410 indivíduos. As odds ratios agrupadas com intervalos de confiança de 95% foram usadas para avaliar a força da associação. Resultados: Uma associação significante foi encontrada na população geral no modelo de dominância (GA/AA vs. GG, odds ratio = 0,707, intervalo de confiança 95% = 0,594-0,841) e modelo de alelo (alelo G vs. alelo A; odds ratio = 1,189, intervalo de confiança 95% = 1,062 a 1,333). Quando estratificados pelo local de trabalho dos indivíduos, também encontramos associação entre rs3735715 e risco de perda auditiva induzida por ruído no modelo de dominância (GA/AA vs. GG, odds ratio = 0,634, intervalo de confiança 95% = 0,514 ± 0,783) e modelo de alelo (alelo G vs. alelo A; odds ratio = 1,206, intervalo de confiança 95% = 1,054- 1,379). Conclusão: O polimorfismo Rs3735715 no gene GRHL2 pode influenciar a suscetibilidade à perda auditiva induzida por ruído. Estudos adicionais, amplos, bem desenhados e funcionais são necessários para confirmar essa associação em diferentes populações.


Subject(s)
Humans , Transcription Factors/genetics , Genetic Predisposition to Disease/genetics , Polymorphism, Single Nucleotide/genetics , DNA-Binding Proteins/genetics , Hearing Loss, Noise-Induced/genetics , Genotype , Noise, Occupational/adverse effects , Occupational Diseases/genetics
14.
Rev. chil. pediatr ; 90(5): 533-538, oct. 2019. tab, graf
Article in Spanish | LILACS | ID: biblio-1058180

ABSTRACT

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.


INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.


Subject(s)
Humans , Female , Infant, Newborn , DNA Helicases/genetics , DNA-Binding Proteins/genetics , CHARGE Syndrome/physiopathology , Phenotype , CHARGE Syndrome/diagnosis , CHARGE Syndrome/genetics , Mutation
15.
Rev. chil. infectol ; 36(3): 312-317, jun. 2019. tab, graf
Article in Spanish | LILACS | ID: biblio-1013789

ABSTRACT

Resumen Introducción. Los factores de virulencia de las cepas de Vibrio cholerae no-O1, no-O139 no son claramente conocidos. La cepa de origen septicémico NN1 Vibrio cholerae no-O1, no-O139 fue secuenciada previamente mediante la plataforma Illumina, detectándose en su genoma un fragmento de la isla de patogenicidad VPaI-7 de V. parahaemolyticus. Objetivo: detectar los genes de virulencia vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF en cepas chilenas clínicas de V. cholerae no-O1, no-O139. Material y Métodos: Un total de 9 cepas chilenas de origen clínico de Vibrio cholerae no-O1, no-O139 aisladas entre 2006-2012 fueron analizadas mediante ensayos de reacción de polimerasa en cadena (RPC, en inglés PCR) convencional para los genes de secreción tipo III codificados en dicha isla: vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF. Adicionalmente se determinó la presencia de los genes de virulencia hylA y rtxA. Además, se realizaron ensayos de repetitive element palindromic PCR (REP-PCR) y Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). Resultados: la mayoría (6/9) de las cepas chilenas de V. cholerae no-O1, no-O139 contiene todos los genes de secreción tipo III vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF, codificados en una isla de patogenicidad. Además, el total de las cepas (9/9) contiene los genes de virulencia hylA y rtxA. Conclusión: Estos resultados sugieren fuertemente la posibilidad que dichas cepas posean un potencial de virulencia importante en seres humanos.


Backgound: The virulence factors of the Vibrio cholerae non-O1, non-O139 strains are not clearly known. The strain of septicemic origin NN1 Vibrio cholerae non-O1, non-O139 was sequenced previously by the Illumina platform. A fragment of the pathogenicity island VPaI-7 of V. parahaemolyticus was detected in its genome. Aim: To detect the virulence genes vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF in Chilean strains of V. cholerae non-O1, non-O139. Methods: A total of 9 Chilean strains of clinical origin of Vibrio cholerae non-O1, non-O139 isolated between 2006-2012 were analyzed by conventional PCR assays for type III secretion genes encoded on that island: vcsN2, vcsC2, vcsV2, vspD, toxR2 and vopF. Additionally, the presence of the virulence genes hylA and rtxA was determined. In addition, REP-PCR and ERIC-PCR assays were performed. Results: most (6/9) Chilean V. cholerae non-O1, non-O139 strains contain the type III secretion genes vcsN2, vcsC2, vcsV2, vspD, toxR2 and vopF, encoded in an island of pathogenicity. In addition, all (9/9) the strains contain the virulence genes hylA and rtxA. Conclusion: These results strongly suggest the possibility that those strains possess an important virulence potential in humans.


Subject(s)
Humans , Bacterial Proteins/genetics , Transcription Factors/genetics , Vibrio cholerae/genetics , Virulence Factors/genetics , Vibrio cholerae non-O1/genetics , Genomic Islands/genetics , DNA-Binding Proteins/genetics , Type III Secretion Systems/genetics , Bacterial Toxins/genetics , Vibrio cholerae/isolation & purification , Vibrio cholerae/pathogenicity , Chile , Polymerase Chain Reaction , Sequence Analysis, DNA , Vibrio cholerae non-O1/isolation & purification , Vibrio cholerae non-O1/pathogenicity , Hemolysin Proteins/genetics
16.
Biol. Res ; 52: 4, 2019. tab, graf
Article in English | LILACS | ID: biblio-1011407

ABSTRACT

BACKGROUND: Hematoporphyrin derivative (HPD) has a sensibilization effect in lung adenocarcinoma. This study was conducted to identify the target genes of HPD in lung adenocarcinoma. METHODS: RNA sequencing was performed using the lung adenocarcinoma cell line A549 after no treatment or treatment with X-ray or X-ray + HPD. The differentially expressed genes (DEGs) were screened using Mfuzz package by noise-robust soft clustering analysis. Enrichment analysis was carried out using "BioCloud" online tool. Protein-protein interaction (PPI) network and module analyses were performed using Cytoscape software. Using WebGestalt tool and integrated transcription factor platform (ITFP), microRNA target and transcription factor (TF) target pairs were separately predicted. An integrated regulatory network was visualized with Cytoscape software. RESULTS: A total of 815 DEGs in the gene set G1 (continuously dysregulated genes along with changes in processing conditions [untreated-treated with X-ray-X-ray + treated with HPD]) and 464 DEGs in the gene set G2 (significantly dysregulated between X-ray + HPD-treated group and untreated/X-ray-treated group) were screened. The significant module identified from the PPI network for gene set G1 showed that ribosomal protein L3 (RPL3) gene could interact with heat shock protein 90 kDa alpha, class A member 1 (HSP90AA1). TFs AAA domain containing 2 (ATAD2) and protein inhibitor of activated STAT 1 (PIAS1) were separately predicted for the genes in gene set G1 and G2, respectively. In the integrated network for gene set G2, ubiquitin-specific peptidase 25 (USP25) was targeted by miR-200b, miR-200c, and miR-429. CONCLUSION: RPL3, HSP90AA1, ATAD2, and PIAS1 as well as USP25, which is targeted by miR-200b, miR-200c, and miR-429, may be the potential targets of HPD in lung adenocarcinoma.


Subject(s)
Humans , Hematoporphyrin Derivative/pharmacology , Gene Regulatory Networks/genetics , Adenocarcinoma of Lung/genetics , Lung Neoplasms/genetics , Ribosomal Proteins/drug effects , Ribosomal Proteins/genetics , Transcription Factors , Cluster Analysis , Gene Expression Regulation, Neoplastic , Sequence Analysis, RNA , HSP90 Heat-Shock Proteins/drug effects , HSP90 Heat-Shock Proteins/genetics , Small Ubiquitin-Related Modifier Proteins/drug effects , Small Ubiquitin-Related Modifier Proteins/genetics , MicroRNAs/metabolism , Cell Line, Tumor , DNA-Binding Proteins/drug effects , DNA-Binding Proteins/genetics , Protein Inhibitors of Activated STAT/drug effects , Protein Inhibitors of Activated STAT/genetics , Flow Cytometry , ATPases Associated with Diverse Cellular Activities/drug effects , ATPases Associated with Diverse Cellular Activities/genetics , Adenocarcinoma of Lung/drug therapy , Adenocarcinoma of Lung/radiotherapy , Lung Neoplasms/drug therapy , Lung Neoplasms/radiotherapy
17.
Braz. j. med. biol. res ; 51(7): e7126, 2018. tab
Article in English | LILACS | ID: biblio-889120

ABSTRACT

This study was performed to examine whether the AF4/FMR2 family, member 1 (AFF1) rs340630 polymorphism is involved in the genetic background of rheumatoid arthritis (RA) in a Chinese population. Two different study groups of RA patients and controls (328 RA patients and 449 healthy controls in the first study group; 232 RA patients and 313 controls in the second study group) were included in our study. Overall, there was no significant difference in either genotype (P=0.71 and 0.64 in the first and second study group, respectively) nor allele (in the first study group: A vs G, P=0.65, OR=1.05, 95%CI=0.85-1.29; in the second study group: G vs A, P=0.47, OR=1.10, 95%CI=0.86-1.40) frequencies of AFF1 rs340630 polymorphism between RA patients and controls. Our study represents the first report assessing the association of AFF1 rs340630 polymorphism with RA risk. No significant evidence was found for the dominant or recessive models. Further case-control studies with larger sample sizes and fine-mapping studies are needed to clarify the role of AFF1 in the genetic basis of RA.


Subject(s)
Humans , Male , Female , Middle Aged , Polymorphism, Genetic/genetics , Arthritis, Rheumatoid/genetics , Genetic Predisposition to Disease/genetics , Transcriptional Elongation Factors/genetics , DNA-Binding Proteins/genetics , Case-Control Studies , Asian Continental Ancestry Group , Gene Frequency , Genotype
18.
Biol. Res ; 51: 13, 2018. graf
Article in English | LILACS | ID: biblio-950899

ABSTRACT

BACKGROUND: Neuroblastoma (NB) represents the most common extracranial solid tumor in children. Accumulating evidence shows that microRNAs (miRs) play an important role in the carcinogenesis of NB. Here, we investigated the biological function of miR-1247 in NB in vitro. METHODS/RESULTS: We found miR-1247 was downregulated in NB tissues and cells using quantitative PCR analysis. Gain- and loss-of-function studies demonstrated that miR-1247 significantly suppressed cell proliferation and induced cell cycle G0/G1 phase arrest and cell apoptosis of NB cells in vitro by using MTT, colony formation assay and Flow cytometry analysis. Luciferase assay suggested ZNF346 was the target of miR-1247 and its expression could be down-regulated by miR-1247 overexpression using Western blotting. Furthermore, downregulation of ZNF346 by siRNA performed similar effects with overexpression of miR-1247 in NB cells. CONCLUSIONS: Our findings suggested miR-1247 directly targeted to repress ZNF346 expression, thus suppressing the progression of NB, which might be a novel therapeutic target against NB.


Subject(s)
Humans , Male , Female , RNA-Binding Proteins/metabolism , MicroRNAs/metabolism , DNA-Binding Proteins/metabolism , Neuroblastoma/metabolism , Phenotype , Time Factors , Tumor Cells, Cultured , Down-Regulation , Gene Expression Regulation, Neoplastic , Child, Preschool , RNA-Binding Proteins/genetics , Colony-Forming Units Assay , MicroRNAs/genetics , Cell Proliferation/genetics , DNA-Binding Proteins/genetics , Real-Time Polymerase Chain Reaction , Flow Cytometry , Neuroblastoma/genetics , Neuroblastoma/pathology
19.
Braz. j. med. biol. res ; 51(9): e7588, 2018. tab, graf
Article in English | LILACS | ID: biblio-951758

ABSTRACT

Previous studies suggested that chromodomain helicase DNA-binding proteins (CHDs), including CHD 1-8, were associated with several human diseases and cancers including lymphoma, liver cancer, colorectal cancer, stomach cancer, etc. To date, little research on CHD 9 in human cancers has been reported. In this study, we assessed the prognostic value of CHD 9 in patients with colorectal cancer (CRC). We screened for CHD 9 expression using immunohistochemical analysis in 87 surgical CRC specimens and found that the expression was upregulated in 81.5% of the cases, while 7.4% were decreased; in the remaining 11.1% of the cases, levels were not altered. Kaplan-Meier analysis showed that patients with high CHD 9 expression had better prognosis than those with low CHD 9 expression (54.5 vs 32.1%, P=0.034). Subsequently, Cox multi-factor survival regression analysis revealed that expression of CHD 9 protein was an independent predictor for CRC, with a hazard ratio of 0.503 (P=0.028). In addition, we found that CHD 9 expression was positively correlated with MSH2 (rs=0.232, P=0.036). We speculated that CHD9 might be a putative tumor suppressor gene, and could inhibit the development of CRC by participating in DNA repair processes. Our findings suggest that CHD 9 could be a novel prognostic biomarker and a therapeutic target for CRC. Further studies are needed to detect the effect of CHD 9 on cellular function and the expression of mismatch repair genes.


Subject(s)
Humans , Male , Adult , Middle Aged , Aged , Aged, 80 and over , Young Adult , Transcription Factors/metabolism , Colorectal Neoplasms/metabolism , Biomarkers, Tumor/metabolism , DNA-Binding Proteins/metabolism , Prognosis , Transcription Factors/genetics , Immunohistochemistry , Colorectal Neoplasms/genetics , Colorectal Neoplasms/pathology , Biomarkers, Tumor/genetics , Gene Expression Regulation, Neoplastic , Trans-Activators , DNA Helicases , DNA-Binding Proteins/genetics , Kaplan-Meier Estimate , Neoplasm Staging
20.
Clinics ; 73: e455, 2018. tab, graf
Article in English | LILACS | ID: biblio-974907

ABSTRACT

OBJECTIVES: To study the relationship between the Asp1104His polymorphism of the nucleotide excision repair gene ERCC5 and treatment sensitivity to oxaliplatin in patients with advanced colorectal cancer (CRC) in China. METHODS: A group of 226 patients in the Department of Gastrointestinal Oncology at Zhejiang Xiaoshan Hospital from July 2011∼December 2016 and a control group of 226 normal healthy individuals were involved in this study. All patients were first diagnosed with advanced CRC and were treated with oxaliplatin-based chemotherapy. The genotype of ERCC5 at the site of amino acid 1104 was determined by a TaqMan probe-based real-time PCR approach. RESULTS: There were no differences in age or gender between the groups, but the percentages of smokers and individuals with a family history of cancer were significantly higher in the patient group than in the control group. Analysis of the G/C polymorphism frequency among the patients and the healthy controls showed that the frequencies of the CC genotype and the CC+GC genotype were significantly related to CRC, but no significant difference in these frequencies was found between genders. The analysis of the relationship between the 5-year survival rate and different genotypes showed that in the total patient group, regardless of gender, the 5-year survival rate was significantly associated with the Asp1104His polymorphism of ERCC5. CONCLUSIONS: The Asp1104His polymorphism of ERCC5 was associated with the risk and 5-year survival rate of CRC as well as treatment sensitivity to oxaliplatin.


Subject(s)
Humans , Male , Female , Middle Aged , Nuclear Proteins/genetics , Colorectal Neoplasms/genetics , Colorectal Neoplasms/drug therapy , DNA-Binding Proteins/genetics , Endonucleases/genetics , Antineoplastic Agents/therapeutic use , Transcription Factors/genetics , Colorectal Neoplasms/mortality , Case-Control Studies , Polymorphism, Single Nucleotide/genetics , Kaplan-Meier Estimate , Oxaliplatin/therapeutic use , Genotype , Neoplasm Staging
SELECTION OF CITATIONS
SEARCH DETAIL