Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 58
Filter
1.
Braz. j. biol ; 79(3): 460-465, July-Sept. 2019. tab, graf
Article in English | LILACS | ID: biblio-1001467

ABSTRACT

Abstract The fidelity of the genomes is defended by mechanism known as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) systems. Three Type II CRISPR systems (CRISPR1- cas, CRISPR2 and CRISPR3-cas) have been identified in enterococci isolates from clinical and environmental samples. The aim of this study was to observe the distribution of CRISPR1-cas, CRISPR2 and CRISPR3-cas in non-clinical strains of Enterococcus faecalis and Enterococcus faecium isolates from food and fecal samples, including wild marine animals. The presence of CRISPRs was evaluated by PCR in 120 enterococci strains, 67 E. faecalis and 53 E. faecium. It is the first report of the presence of the CRISPRs system in E. faecalis and E. faecium strains isolated from wild marine animal fecal samples. The results showed that in non-clinical strains, the CRISPRs were more frequently detected in E. faecalis than in E. faecium. And the frequencies of CRISPR1-cas and CRISPR2 were higher (60%) in E. faecalis strains isolated from animal feces, compared to food samples. Both strains showed low frequencies of CRISPR3-cas (8.95% and 1.88%). In conclusion, the differences in the habitats of enterococcal species may be related with the results observe in distribution of CRISPRs systems.


Resumo A fidelidade dos genomas ​​é defendida por mecanismos conhecidos como sistemas de repetições palindrômicas curtas agrupadas e regularmente interespaçadas (CRISPRs). Três tipos de sistemas CRISPR II (CRISPR1-cas, CRISPR2 e CRISPR3-cas) têm sido identificados em cepas de enterococos isolados de amostras clínicas e ambientais. O objetivo deste estudo foi observar a distribuição dos CRISPR1-cas, CRISPR2 e CRISPR3-cas em cepas não-clínicas de Enterococcus faecalis e Enterococcus faecium isoladas de amostras alimentícias e fecais, incluindo animais marinhos selvagens. A presenca dos CRISPRs foi determinada por PCR em 120 cepas de enterococos, sendo 67 E. faecalis e 53 E. faecium. É o primeiro relato da presença do sistema CRISPRs nas estirpes E. faecalis e E. faecium isoladas de amostras fecais de animais marinhos selvagens. Os resultados mostraram que em cepas não-clínicas, os CRISPRs foram mais frequentemente detectados em E. faecalis do que em E. faecium. E as frequências de CRISPR1-cas e CRISPR2 foram maiores (60%) em cepas de E. faecalis isoladas de fezes de animais, quando comparadas à amostras de alimentos. Ambas as cepas apresentaram baixas freqüências de CRISPR3-cas (8,95% e 1,88%). Em conclusão, as diferenças nos habitats das espécies de enterococos podem estar relacionadas com os resultados observados na distribuição dos sistemas CRISPRs.


Subject(s)
Animals , Enterococcus faecium/genetics , Enterococcus faecalis/genetics , Feces/microbiology , Clustered Regularly Interspaced Short Palindromic Repeats , Food Microbiology , Turtles/microbiology , Vegetables/microbiology , Chickens/microbiology , Dairy Products/microbiology , Milk/microbiology , Spheniscidae/microbiology , Fur Seals/microbiology , Meat/microbiology
2.
Arq. Inst. Biol ; 85: e0952016, 2018. tab
Article in English | LILACS, VETINDEX | ID: biblio-987417

ABSTRACT

This study aimed to evaluate the occurrence of Bacillus cereus group in requeijões and especialidades lácteas tipo requeijão (regular and light) and to verify if there is differences in relation to this occurrence among different categories of these products. A set of 14 (35%) lots was contaminated with this bacterial group from the 40 lots with low counts (maximum 3.1 × 10 CFU/g), and no significant difference regarding counts or presence/absence were observed among the categories of the products. It can be concluded that contamination by B. cereus group in these products is unable to consist in risk to consumers, regarding adequate refrigeration during selling. This study was the first one to report this bacteria group for these dairy products and highlights the needs of further investigations to evaluate the impact of its spoilage during shelf life.(AU)


Este estudo objetivou avaliar a ocorrência de bactérias do grupo de Bacillus cereus em requeijões e especialidades lácteas (normais e light) e verificar se há diferença em relação a essa ocorrência entre as diferentes categorias desses produtos. Entre os 40 lotes avaliados, 14 (35%) estavam contaminados por bactérias desse grupo, com baixas contagens (máxima de 3,1 × 10 UFC/g) e sem diferenças significativas no que tange às contagens ou à presença/ausência entre as diversas categorias. Conclui-se que as bactérias do grupo de B. cereus em requeijões e especialidades lácteas são incapazes de consistir em risco aos consumidores desses produtos, desde que as condições de refrigeração sejam adequadas durante armazenamento e venda. O presente trabalho é o primeiro a relatar a presença de tal grupo de micro-organismos nesses tipos de produtos, porém, são necessários novos estudos para avaliar o impacto de sua ação deteriorante sobre o período em que passa na prateleira.(AU)


Subject(s)
Bacillus cereus , Bacteria , Dairy Products/microbiology , Food Safety
3.
Rev. chil. infectol ; 34(3): 243-247, jun. 2017. tab
Article in Spanish | LILACS | ID: biblio-899707

ABSTRACT

Introduction: Brucellosis is a zoonosis caused by Brucella spp. It may be acquired by consuming unpasteurized dairy products. Brucellosis has a low incidence in Chile, thus, we have a scarce data. Aim: To report and to characterize the first series of clinical cases of adult patients diagnosed with brucellosis in Chile. Methods: We describe a series of 13 clinical cases in patients diagnosed between 2000 and 2016 in three different centers in the Metropolitan Region, Chile. A retrospective analysis was performed on clinical presentation, laboratory, antibiotic treatment, morbidity and mortality. Results: The mean age was 50 years old. Eight cases had a record of consumption of unpasteurized dairy products. The most frequently reported complaints were fever. The most frequent focal point involved was the spine. Only one patient had a positive blood culture, while the diagnosis was made using serological techniques in the other part of the group. The most indicated antibiotic regimens were doxycycline-rifampicin and doxycycline-gentamicin. The hospital stay was 20 days approximately as an average. Clinical cure was achieved in all cases. Conclusions: Brucellosis is an infrequent zoonosis in Chile, and it produces a nonspecific clinical picture, so it is necessary to have high suspicion to make the diagnosis based in the antecedent of consumption of unpasteurized dairy or raw meat.


Introducción: La brucelosis es una zoonosis provocada por Brucella spp, cuyo principal mecanismo de transmisión es mediante el consumo de lácteos no pasteurizados. Es de baja ocurrencia en Chile, por lo que los datos locales son escasos. Objetivo: Reportar y caracterizar la primera serie de casos clínicos de pacientes adultos con diagnóstico de brucelosis en Chile. Material y Método: Se describe una serie de 13 casos clínicos en pacientes diagnosticados entre el año 2000 y el 2016 en tres centros de la Región Metropolitana, Chile. Se realizó un análisis retrospectivo acerca de la presentación clínica, laboratorio, tratamiento antimicrobiano y morbi-mortalidad. Resultados: El promedio de edad fue 50 años. Ocho casos tenían antecedente de consumo de lácteos no pasteurizados. El motivo de consulta más frecuente fue sensación febril. El compromiso focal más frecuente fue el de columna vertebral. Sólo en un paciente se encontró hemocultivo positivo; en el resto el diagnóstico se hizo mediante técnicas serológicas. Los esquemas antimicrobianos más indicados fueron doxiciclina-rifampicina y doxiciclina-gentamicina. La estadía hospitalaria fue en promedio de 20 días. En todos los casos se logró curación clínica. Conclusiones: La brucelosis es una zoonosis infrecuente en Chile, produce un cuadro clínico inespecífico, por lo que se debe tener una alta sospecha para realizar el diagnóstico, basada en el antecedente del consumo de productos lácteos no pasteurizados o de carne mal cocida.


Subject(s)
Humans , Male , Female , Adult , Middle Aged , Aged , Young Adult , Brucellosis/diagnosis , Rifampin/administration & dosage , Urban Population , Brucellosis/etiology , Brucellosis/drug therapy , Brucellosis/epidemiology , Gentamicins/administration & dosage , Chile/epidemiology , Retrospective Studies , Doxycycline/administration & dosage , Dairy Products/microbiology , Drug Therapy, Combination , Length of Stay
4.
Braz. j. biol ; 75(4): 923-931, Nov. 2015. tab, graf
Article in English | LILACS | ID: lil-768199

ABSTRACT

Abstract Lactic acid bacteria (LAB) have an important role in a great variety of fermented foods. In addition to their contribution to sensory characteristics, they enhance food preservation and can be used as probiotics. In this study, the antimicrobial and antioxidant activities of culture supernatants and cell free extracts of 16 LAB isolated from meat and dairy products were investigated. The bacterial were identified by 16S rRNA sequencing. GenBank BLAST analysis revealed that all the isolates belong to Enterococcus faecium species. Antimicrobial activity against the indicator microorganism (Listeria monocytogenes) was observed at 11 culture supernatants and 4 cell free extracts. The sensibility of culture supernatant was evaluated by proteinase K and trypsin and it was observed that activity of antimicrobial substance was completely lost after the treatment. All of the isolates showed antioxidant activity as determined by the Thiobarbituric Acid Reactive Substances (TBARS) method with both types of extracts. When the antioxidant capacity was investigated using ABTS•+ method (2,2 azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) and DPPH method (2,2-diphenyl-1-picrylhydrazyl) it was observed that only culture supernatants showed antioxidant capacity. These bacteria could particularly help to reduce or inhibit pathogenic microorganisms as well as oxidative spoilage in foods and feed.


Resumo As bactérias ácido láticas (BAL) têm um papel importante em uma grande variedade de alimentos fermentados. Em adição à sua contribuição para as características sensoriais, estes microorganismos melhoram a conservação de alimentos e podem ser utilizados como probióticos. Neste estudo, as atividades antimicrobiana e antioxidante do sobrenadante e dos extratos livres de células de 16 isolados de LAB de carne e produtos lácteos foram investigadas. Os isolados foram identificados pelo sequenciamento da região 16S do rRNA. Após a comparação das sequências obtidas com aquelas disponíveis na base de dados GenBank, observou-e que todos os isolados foram pertencentes à espécie Enterococcus faecium. A atividade antimicrobiana contra o microrganismo indicador (Listeria monocytogenes) foi observada no sobrenadante das culturas em 11 isolados, e nos extratos livres de células por 4 isolados. A sensibilidade da cultura sobrenadante foi avaliada pela proteinase K e tripsina e observou-se que a atividade da substância antimicrobiana foi completamente perdida após o tratamento com as enzimas proteolíticas. Todos os isolados apresentaram atividade antioxidante, como determinado pelo método do ácido tiobarbitúrico de substâncias reativas (TBARS) com ambos os tipos de extratos. Quando a capacidade antioxidante foi investigada usando o método do ABTS (2,2 azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)) e o método de DPPH (2,2-diphenyl-1-picrylhydrazyl) observou-se que apenas os sobrenadantes das culturas demonstraram capacidade antioxidante. Estas bactérias poderiam particularmente ajudar a reduzir ou inibir microorganismos patogênicos, bem como a deterioração oxidativa em alimentos e rações.


Subject(s)
Anti-Infective Agents/pharmacology , Antioxidants/analysis , Dairy Products/microbiology , Enterococcus/chemistry , Listeria monocytogenes/drug effects , Meat/microbiology , Phylogeny , Sequence Analysis, DNA , Thiobarbituric Acid Reactive Substances/chemistry
8.
Braz. j. microbiol ; 45(1): 25-33, 2014. ilus, tab
Article in English | LILACS | ID: lil-709475

ABSTRACT

A total of 244 lactic acid bacteria (LAB) strains were isolated from 180 dairy and pharmaceutical products that were collected from different areas in Minia governorate, Egypt. LAB were identified phenotypically on basis of morphological, physiological and biochemical characteristics. Lactobacillus isolates were further confirmed using PCR-based assay. By combination of phenotypic with molecular identification Lactobacillus spp. were found to be the dominant genus (138, 76.7%) followed by Streptococcus spp. (65, 36.1%) and Lactococcus spp. (27, 15%). Some contaminant organisms such as (Staphylococcus spp., Escherichia coli, Salmonella spp., mould and yeast) were isolated from the collected dairy samples but pharmaceutical products were free of such contaminants. Susceptibility of LAB isolates to antibiotics representing all major classes was tested by agar dilution method. Generally, LAB were highly susceptible to Beta-lactams except penicillin. Lactobacilli were resistant to vancomycin, however lactococci and streptococci proved to be very susceptible. Most strains were susceptible to tetracycline and showed a wide range of streptomycin MICs. The MICs of erythromycin and clindamycin for most of the LAB were within the normal range of susceptibility. Sixteen Lactobacillus,8 Lactococcus and 8 Streptococcus isolates including all tetracycline and/or erythromycin resistant strains were tested for the presence of tetracycline and/or erythromycin resistant genes [tet(M) and/or erm(B)]. PCR assays shows that some resistant strains harbor tet(M) and/or erm(B) resistance genes.


Subject(s)
Humans , Anti-Bacterial Agents/pharmacology , Drug Resistance, Bacterial , Dairy Products/microbiology , Lactobacillales/drug effects , Lactobacillales/isolation & purification , Pharmaceutical Preparations , DNA, Bacterial/genetics , Egypt , Genes, Bacterial , Lactobacillales/classification , Microbial Sensitivity Tests , Polymerase Chain Reaction
9.
Alexandria Journal of Veterinary Sciences [AJVS]. 2014; 40: 51-62
in English | IMEMR | ID: emr-160055

ABSTRACT

A survey was conducted to determine the prevalence of Aeromonas spp. in 75 random samples [25 each of raw cow's milk, local plain yoghurt and Domiati cheese] collected from different dairy shops, supermarket and street peddlers in Diarb Negm and Zagazig cities Sharkia Governorate, Egypt. Investigations involved proteolytic and lipolytic activities of isolated Aeromonas spp. and the effect of heat- treatment, acidity, pH and Sodium chloride concentration on prevalence of Aeromonas bacteria. Prevalence of Aeromonas spp. was proved in 32, 44 and 20.0% of examined raw cow's milk, local plain yoghurt and Domiati cheese samples with mean count of 9.8 x10[3], 1.4 x10[5] and 6.9 x10[3]/ml, respectively. Identification of confirmed raw cow's milk isolates revealed that A. trota, A. hydrophila, A. janda and A. caviae were the predominant strains with percentages of 40, 25, 25 and 10.0% respectively. While local plain yoghurt isolates could be identified as A. caviae, A. sobria, A. hydrophila, A. trota and A. schubertii with percentages of 36.4, 22.7, 18.2, 13.6 and 9.1% respectively. Meanwhile identification of 10 confirmed Domiati cheese cultures revealed that the predominant strains were A. hydrophila, A. caviae and A. trota with percentages of 30, 50 and 20% respectively. All laboratory pasteurized milk samples revealed no count and there is marked decrease in the count of Aeromonas spp. as the acidity% of the examined raw cow's milk samples increase. While the count decrease when the pH value of the examined local plain yoghurt samples decrease and the NaCl% of the examined Domiati cheese samples increase. Characterization of isolated Aeromonas strains pointed that 50% of A. hydrophila, 60% of A. caviae, 40% of A. sobria, 53.8% of A. Trota, 100% of A. janda and 50% of A. schubertii were psychrotrophic. A. hydrophila exhibited proteolytic and lipolytic activities at the percentage of 41.7 and 16.7% respectively but in case of A. caviae strains the percentages were 46.7% and 20% respectively and with A. trota were 30.8 and 15.4% respectively. 60% of A. sobria and 100% of A. janda and A. schubertii strains showed proteolytic activity only. The public health importance and economic significance of existing microorganisms as well as the suggestive measures for improving the quality of raw milk and dairy products were discussed


Subject(s)
Animals , Aeromonas/immunology , Dairy Products/microbiology , Milk/microbiology , Polymerase Chain Reaction/statistics & numerical data
10.
Alexandria Journal of Veterinary Sciences [AJVS]. 2014; 41: 80-86
in English | IMEMR | ID: emr-160071

ABSTRACT

This study aimed to determine the presence of Enterobacteriaceae in beef products as luncheon, pasterma, frankfurter and minced meat as these microbes are considered as major cause of foodborne illness.A total of 100 samples [25 of each beef product] were collected from different retail outlets. Each sample was kept in a separate sterile plastic bag and transferred in an ice box to the laboratory under complete aseptic conditions with a minimum of delay. All collected samples were bacteriologically examined for isolation and identification of Enterobacteriaceae. We found that the most important bacteria that isolated from minced meat were E. coli [44%], Enterobacter spp. Especially Enterobacter aerogenes [12%], Enterobacter intermedium [4] and Enterobacter gergoviae [4%], Citrobacter spp. that includes Citrobacter amalonaticus [4%], Citrobacter diversus [4%] and Citrobacter freundii [4%], serratia spp especially Serratia marcescens 8%], Serratia ficaria [8%], Serratia fonticola [12%], Serratia liquefaciens [4%] and Serratia rubidaea [8%], Edwardsiella spp. Especially Edwardsiella ictalori [8%] and Edwardsiella hoshinae [12%], Povidencia spp. [8%] especially Providencia alcalifciens [4%], Klebsiella pneumoniae especially Subsp. Ozanae [4%] and Proteus spp. especially Proteus mirabilis [16%]. The most important bacteria that isolated from luncheon were E. coli [32%], Enterobacter spp. Especially Enterobacter aerogenes [8%], Enterobacter intermedium [4%] and Enterobacter gergoviae [8%], Citrobacter spp. that includes Citrobacter amalonaticus [12%], Citrobacter diversus [4%] and Citrobacter freundii [16%], Serratia spp. Especially Serratia marcescens [8%], Serratia ficaria [12%], Serratia fonticola [4%], Srratia liquefaciens [4%] and Serratia rubidaea [8%], Edwardsiella spp. especially Edwardsiella ictalori [8%] and Edwardsiella hoshinae [16%], Providencia spp. especially Providencia alcalifciens [4%], Klebsiella pneumoniae especially Subsp. Ozanae [12%] and Proteus spp. especially Proteus mirabilis [8%]. Also, the most important bacteria that isolated from pasterma were E. coli [40%], Enterobacter spp. Especially Enterobacter aerogenes [8%], Enterobacter intermedium [4%] and Enterobacter gergoviae [12%], Citrobacter spp. that includes Citrobacter amalonaticus [4%], Citrobacter diversus [12%] and Citrobacter freundii [4%], Serratia spp. Especially Srratia marcescens [4%], Serratia ficaria [8%], Serratia fonticola [4%], Serratia liquefaciens [4%] and Serratia rubidaea [8%], Edwardsiella spp. especially Edwardsiella ictalori [12%] and Edwardsiella hoshinae [8%], providencia spp. especially providencia alcalifciens [8%], Klebsiella pneumoniae especially subsp. Ozanae [8%] and Proteus spp. especially Poteus mirabilis [12%]. Eventually, the most important bacteria that isolated from frankfurter were E. coli [36%], Enterobacter spp. Especially enterobacter aerogenes [4%], enterobacter intermedium [4%] and enterobacter gergoviae [8%], Citrobacter spp. that includes Citrobacter amalonaticus [8%], Citrobacter diversus [4%] and Citrobacter freundii [4%], Serratia spp. Especially Serratia marcescens [4%], Serratia ficaria [12%], Serratia fonticola [4%], Serratia liquefaciens [4%] and Serratia rubidaea [4%], Edwardsiella spp. especially edwardsiella ictalori [8%] and Edwardsiella hoshinae [12%], providencia spp. especially Providencia alcalifciens [4%], Klebsiella pneumoniae especially subsp. Ozanae [8%] and Proteus spp. especially Proteus mirabilis [8%]


Subject(s)
Dairy Products/microbiology
11.
Braz. j. microbiol ; 44(4): 1195-1198, Oct.-Dec. 2013. ilus, tab
Article in English | LILACS | ID: lil-705260

ABSTRACT

Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL), a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR) for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers.


Subject(s)
Animals , Bacillus cereus/isolation & purification , Bacterial Proteins/analysis , Bacterial Proteins/genetics , Dairy Products/microbiology , Hemolysin Proteins/analysis , Hemolysin Proteins/genetics , Milk/microbiology , Brazil , Bacillus cereus/genetics , DNA, Bacterial/genetics , Immunoassay , Polymerase Chain Reaction
12.
Indian J Exp Biol ; 2013 Nov; 51(11): 910-918
Article in English | IMSEAR | ID: sea-149397

ABSTRACT

Two Bacillus sp. were isolated from the local fermented milk and identified on the basis 16S rRNA sequence profile as Bacillus subtilis AKL1 and by biochemical process as Lactobacillus acidophilus AKL2. These isolates were used as fresh inoculums for curd preparation individually and in combinations. Different physico-chemical and therapeutic properties of the newly prepared curd were examined and compared with marketed local (sweet and sour) and branded (Mother Dairy and Thackar) curds. The total hydrolyzed peptides, free amino acids, lactic acid were significantly higher, whereas, total solid, ash content, syneresis and free reducing sugar were lower in the curd prepared by a mixture of AKL1 and AKL2 (0.5:0.5, v/v). The antioxidant activity against ABTS+, DPPH•, OH• and Fe3+ were also higher in the newly formulated curd. Polyphenols (85.5µg/g), flavonoids (12.5µg/g) and free aromatic amino acids contents were also higher in AKL1+AKL2. All these components prevent excess protein oxidation that was revealed by SDS-PAGE. The curd also exhibited potent antimicrobial activity against some entero-pathogens like Clostridium perfringens, Escherichia coli, Shigella dysentery, Vibrio cholerae and Staphylococcus aureus. It can be concluded that the combination of these Lactobacillus sp. will be a fruitful inoculum for the preparation of curd having better health promoting effects.


Subject(s)
Bacillus subtilis/classification , Bacillus subtilis/genetics , Bacillus subtilis/isolation & purification , Base Sequence , DNA Primers , Dairy Products/microbiology , Electrophoresis, Polyacrylamide Gel , Lactobacillus/genetics , Lactobacillus/isolation & purification , Phylogeny , Polymerase Chain Reaction
14.
Braz. j. microbiol ; 44(3): 701-707, July-Sept. 2013. tab
Article in English | LILACS | ID: lil-699802

ABSTRACT

The aim of this work was to study the yeast populations and the main hygienic-sanitary microbial indicators in water buffalo mozzarella produced and commercialized in Minas Gerais, Brazil. Forty-two water buffalo mozzarella samples were purchased from retail outlets in Belo Horizonte. In addition, five samples of consecutive starter cultures, curd before acidification, acidified curd and mozzarella were collected at an industry in the city of Oliveira. Only three of the five water samples analyzed were suitable for consumption according to Brazilian sanitary standards. Four milk samples were highly contaminated with fecal coliforms, and did not meet the minimal hygienic-sanitary standards according to Brazilian regulations. Only one sample of buffalo muzzarela purchased from retail outlets exceeded the limit for coagulase-positive Staphylococcus. Eleven samples showed counts of thermotolerant coliforms higher than5x 10³ CFU.g-1, but still lower than the maximum permitted by the Brazilian laws. Salmonella spp. and Listeria monocytogenes were not isolated. Debaryomyces hansenii, Candida lusitaniae and C. parapsilosis were the prevalent yeast species isolated from cheese. Among samples from the production stages, the acidified curd presented the highest numbers of yeasts, with C. catenulata being the most frequent species isolated. Some opportunistic yeast species such as C. guilliermondii, C. tropicalis, C. parapsilosis, C. lusitaniae, C. catenulata, C. rugosa and C. krusei occurred in the mozzarella cheese samples analyzed. The mozzarella cheese presented a low microbial load as compared to other cheese already studied, and the yeast biota included species typical of cheese and also opportunistic pathogens.


Subject(s)
Animals , Bacteria/isolation & purification , Dairy Products/microbiology , Yeasts/isolation & purification , Bacterial Load , Brazil , Buffaloes , Bacteria/classification , Colony Count, Microbial , Yeasts/classification
15.
Braz. j. microbiol ; 44(3): 751-758, July-Sept. 2013. ilus, tab
Article in English | LILACS | ID: lil-699807

ABSTRACT

Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes) rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction) has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO). A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB) followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT) complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR). PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%), followed by fish meat (4.0%), and then beef (2.5%). Among various milk and milk products, curd (2.0%) showed the highest prevalence, followed by raw milk (1.3%). The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS) examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro) resulted positive in twenty four strong haemolysin producing L. monocytogenes isolates. The vero cytotoxicity assay could be suggested as a further step towards an alternative assay for detection of haemolytic strains of L. monocytogenes.


Subject(s)
Animals , Cattle , Food Microbiology/methods , Listeria monocytogenes/isolation & purification , Molecular Diagnostic Techniques/methods , Bacterial Toxins/genetics , Cell Survival , Chlorocebus aethiops , Chickens , DNA Primers/genetics , Dairy Products/microbiology , Fishes , Heat-Shock Proteins/genetics , Hemolysin Proteins/genetics , India , Meat/microbiology , Milk/microbiology , Polymerase Chain Reaction , Vero Cells
18.
Braz. j. microbiol ; 44(2): 393-399, 2013. tab
Article in English | LILACS | ID: lil-688576

ABSTRACT

This study was conducted to determine the prevalence rate, enterotoxigenecity, and antimicrobial resistance of S. aureus isolated from dairy products in Iran. From September 2010 to July 2011, a total of 347 samples from various dairy products, traditional and commercial, were collected from randomly selected retail stores. Overall, 20 samples (5.8%) were found to be contaminated with S. aureus. The highest prevalence of S. aureus was found in traditional cheese (11.1%), followed by traditional ice-cream (5.9%), cream (5.6%), and butter (5.3%). The ability to synthesize classical staphylococcal enterotoxins (SEA-E) was determined in 7 of 20 (35%) isolates by using ELISA. SE type C was the most common enterotoxin found in the isolated S. aureus (42.9%), followed by SE type A (28.6%), SEA+SEC and SE type D (14.3%). Of the 20 isolates, 16 (80.0%) were positive for one or more entrotoxin genes and 8 different genotypes were observed. Susceptibilities of the isolates were determined for 14 antimicrobial drugs using the disk diffusion assay. Most of the isolates (95.0%) were resistant to one or more two antimicrobial agent and 45.0% of the isolates were resistant to three or more of drugs. Resistance to ampicillin was the most common finding (55.0%), followed by tetracycline (40.0%) and penicillin G (30.0%). The results of this study showed the wide spread of enterotoxigenic and multidrug-resistant S. aureus strains in traditional dairy products in Iran and highlighted their public health hazards.


Subject(s)
Dairy Products/microbiology , Enterotoxins , Staphylococcus aureus/enzymology , Staphylococcus aureus/isolation & purification , Anti-Bacterial Agents/pharmacology , Drug Resistance, Bacterial , Enzyme-Linked Immunosorbent Assay , Food Contamination , Iran , Microbial Sensitivity Tests , Prevalence , Staphylococcus aureus/drug effects
19.
Lebanese Science Journal. 2013; 14 (1): 3-14
in French | IMEMR | ID: emr-143053

ABSTRACT

The detection and limitation of microorganisms that cause disease are important parts of food microbiology. Cheese and dairy products can serve as vehicles for transmission of infectious diseases. This study aims firstly to examine the presence of two important bacteria in food microbiology, Salmonella spp and Listeria monocytogenes by the immunological technique mini-VIDAS and secondly to isolate the multi drug-resistant bacteria using a medium supplemented by a third-generation cephalosporin. Fifty samples of Akkawi cheese randomly selected from the region of north Lebanon were tested. The screening for Listeria monocytogenes and Salmonella spp by the mini-VIDAS technique gave five positive results for Listeria monocytogenes and two positive results for Salmonella spp. The confirmation by biochemical identification showed that among the 5 mini-VIDAS positive results for Listeria monocytogenes, one isolate was identified as Listeria grayi, one as Aerococcus viridans, one as Streptococcus uberis, one as Brevibacterium spp and one as CDC group 1. The two positive mini-VIDAS Salmonella spp were identified as Salmonella group 1 and Enterobacter cloacae. The search for bacteria resistant to antibiotics has shown that out of the 50 samples analyzed, 21 samples contained Gram negative bacilli resistant to beta-lactam antibiotics [42%]. Results showed the presence of 11 isolates belonging to the family of Enterobacteriaceae and 15 non-enteric bacteria isolates. The antibiotic susceptibility profiles have demonstrated that in the group of Enterobacteriaceae, six isolates were ESBL [extended spectrum beta-lactamase] producers [3 E. coli, 2 Klebsiella pneumoniae and 1 Rhanella aquatilis] and 3 were cephalosporinase hyper-producing isolates [Enterobacter cloacae, Serratia odorifera and Hafnia alvei]. Regarding the non-enteric bacteria, one notes the presence of 8 strains of Acinetobacter calcoaticus, 3 Burkholderia cepacia, 2 Pseudomonas aeruginosa, 1 Sphingomonas paucimobilis and 1 Stenotrophomonas maltophiliae. Results on the presence of bacteria resistant to antibiotics in the analyzed cheese samples indicate a real problem for public health and should draw attention to the need to implement adequate control systems in this country.


Subject(s)
Food Microbiology , Listeria monocytogenes/isolation & purification , Salmonella/isolation & purification , Immunoenzyme Techniques , Dairy Products/microbiology , Consumer Product Safety , Food Contamination
20.
EMHJ-Eastern Mediterranean Health Journal. 2013; 19 (5): 474-477
in English | IMEMR | ID: emr-158861

ABSTRACT

Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples [185 dairy, 187 meat products and 158 ready-to-eat foods such as salads] were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples [12.5%]. Meat products showed the highest [27.2%] and dairy products the lowest [3.8%] contamination rates. L. innocua was found in 56 [10.6%] samples, but L. monocytogenes was only found in 3 samples [0.6%]. The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required


Subject(s)
Listeria , Prevalence , Meat Products/microbiology , Dairy Products/microbiology , Listeria monocytogenes
SELECTION OF CITATIONS
SEARCH DETAIL