ABSTRACT
Abstract Transcription factors (TF) are a wide class of genes in plants, and these can regulate the expression of other genes in response to various environmental stresses (biotic and abiotic). In the current study, transcription factor activity in sugarcane was examined during cold stress. Initially, RNA transcript reads of two sugarcane cultivars (ROC22 and GT08-1108) under cold stress were downloaded from SRA NCBI database. The reads were aligned into a reference genome and the differential expression analyses were performed with the R/Bioconductor edgeR package. Based on our analyses in the ROC22 cultivar, 963 TF genes were significantly upregulated under cold stress among a total of 5649 upregulated genes, while 293 TF genes were downregulated among a total of 3,289 downregulated genes. In the GT08-1108 cultivar, 974 TF genes were identified among 5,649 upregulated genes and 283 TF genes were found among 3,289 downregulated genes. Most transcription factors were annotated with GO categories related to protein binding, transcription factor binding, DNA-sequence-specific binding, transcription factor complex, transcription factor activity in RNA polymerase II, the activity of nucleic acid binding transcription factor, transcription corepressor activity, sequence-specific regulatory region, the activity of transcription factor of RNA polymerase II, transcription factor cofactor activity, transcription factor activity from plastid promoter, transcription factor activity from RNA polymerase I promoter, polymerase II and RNA polymerase III. The findings of above results will help to identify differentially expressed transcription factors during cold stress. It also provides a comprehensive analysis of the regulation of the transcription activity of many genes. Therefore, this study provides the molecular basis for improving cold tolerance in sugarcane and other economically important grasses.
Resumo Fatores de transcrição (FT) são uma ampla classe de genes em plantas e podem regular a expressão de outros genes em resposta a vários estresses ambientais (estresses bióticos e abióticos). No presente estudo, a atividade do fator de transcrição na cana-de-açúcar foi examinada durante o estresse pelo frio. Inicialmente, as leituras de transcrição de RNA de duas cultivares de cana-de-açúcar (ROC22 e GT08-1108) sob estresse frio foram baixadas do banco de dados SRA NCBI. As leituras foram alinhadas em um genoma de referência e as análises de expressão diferencial foram realizadas com o pacote R / Bioconductor edgeR. Com base em nossas análises no cultivar ROC22, 963 genes TF foram significativamente regulados positivamente sob estresse pelo frio entre um total de 5.649 genes regulados positivamente, enquanto 293 genes TF foram regulados negativamente entre um total de 3.289 genes regulados negativamente. No cultivar GT08-1108, 974 genes TF foram identificados entre 5.649 genes regulados positivamente e 283 genes TF foram encontrados entre 3.289 genes regulados negativamente. Os fatores de transcrição, em sua maioria, foram anotados com categorias GO relacionadas à ligação de proteína, ligação de fator de transcrição, ligação específica de sequência de DNA, complexo de fator de transcrição, atividade de fator de transcrição em RNA polimerase II, atividade de fator de transcrição de ligação de ácido nucleico, atividade de corepressor de transcrição, sequência específica da região reguladora, atividade do fator de transcrição da RNA polimerase II, atividade do cofator do fator de transcrição, atividade do fator de transcrição do promotor do plastídio, atividade do fator de transcrição do promotor da RNA polimerase I, polimerase II e RNA polimerase III. As descobertas dos resultados acima ajudarão a identificar fatores de transcrição expressos diferencialmente durante o estresse pelo frio. Ele também fornece uma análise abrangente da regulação da atividade de transcrição de muitos genes. Portanto, este estudo fornece base molecular para melhorar a tolerância ao frio em cana-de-açúcar e outras gramíneas economicamente importantes.
Subject(s)
Saccharum/genetics , Saccharum/metabolism , Cold-Shock Response/genetics , Stress, Physiological/genetics , Transcription Factors/genetics , Transcription Factors/metabolism , Cold Temperature , Gene Expression Regulation, Plant , Gene Expression ProfilingABSTRACT
Objective: To assess the effect of gene mutations on the efficacy of ruxolitinib for treating myelofibrosis (MF) . Methods: We retrospectively analyzed the clinical data of 56 patients with MF treated with ruxolitinib from July 2017 to December 2020 and applied second-generation sequencing (NGS) technology to detect 127 hematologic tumor-related gene mutations. Additionally, we analyzed the relationship between mutated genes and the efficacy of ruxolitinib. Results: ①Among the 56 patients, there were 36 cases of primary bone marrow fibrosis (PMF) , 9 cases of bone marrow fibrosis (ppv-mf) after polycythemia vera, and 11 cases of bone marrow fibrosis (PET-MF) after primary thrombocytosis (ET) . ②Fifty-six patients with MF taking ruxolitinib underwent NGS, among whom, 50 (89.29%) carried driver mutations, 22 (39.29%) carried ≥3 mutations, and 29 (51.79%) carried high-risk mutations (HMR) . ③ For patients with MF carrying ≥ 3 mutations, ruxolitinib still had a better effect of improving somatic symptoms and shrinking the spleen (P=0.001, P<0.001) , but TTF and PFS were significantly shorter in patients carrying ≥ 3 mutations (P=0.007, P=0.042) . ④For patients carrying ≥ 2 HMR mutations, ruxolitinib was less effective in shrinking the spleen than in those who did not carry HMR (t= 10.471, P=0.034) , and the TTF and PFS were significantly shorter in patients carrying ≥2 HMR mutations (P<0.001, P=0.001) . ⑤Ruxolitinib had poorer effects on spleen reduction, symptom improvement, and stabilization of myelofibrosis in patients carrying additional mutations in ASXL1, EZH2, and SRSF2. Moreover, patients carrying ASXL1 and EZH2 mutations had significantly shorter TTF [ASXL1: 360 (55-1270) d vs 440 (55-1268) d, z=-3.115, P=0.002; EZH2: 327 (55-975) d vs 404 (50-1270) d, z=-3.219, P=0.001], and significantly shorter PFS compared to non-carriers [ASXL1: 457 (50-1331) d vs 574 (55-1437) d, z=-3.219, P=0.001) ; 428 (55-1331) d vs 505 (55-1437) d, z=-2.576, P=0.008]. Conclusion: The type and number of mutations carried by patients with myelofibrosis and HMR impact the efficacy of ruxolitinib.
Subject(s)
Humans , Mutation , Nitriles , Primary Myelofibrosis/genetics , Pyrazoles , Pyrimidines , Retrospective Studies , Technology , Transcription Factors/geneticsABSTRACT
In recent years, the MYB-related gene family has been found pivotal in plant growth and development. MYB-related gene family in Angelica dahurica var. formosana was systematically investigated based on "Chuanzhi No. 2" through transcriptome database search and bioinformatics and the temporal and spatial expression patterns were analyzed through real-time fluorescence-based quantitative polymerase chain reaction(PCR). The results showed that 122 MYB-related proteins family were identified, mainly including the unstable hydrophilic proteins with good thermal stability. Most of the proteins were located in nuclei. The majority of the proteins had the structures of random coil and α-helix. Five MYB-related proteins family of A. dahurica var. formosana had membrane-binding domains. The conserved domain analysis of MYB-related proteins family of A. dahurica var. formosana showed that the MYB domains of genes in five subgroups, similar to 2 R-, 3 R-, and 4 R-MYB proteins, contained three evenly distributed Trp(W) residues in the MYB repeat sequence. The phylogenetic analysis of MYB-related proteins family in A. dahurica var. formosana and Arabidopsis thaliana showed that the MYB-related members were unevenly distributed in five subgroups, and A. thaliana and A. dahurica var. formosana had almost the same number of genes in the CCA1-like subgroup. There were differences in the number, type, and distribution of motifs contained in 122 encoded proteins. Transcription factors with similar branches had similar domains and motifs. The expression pattern analysis showed that the transcription factors AdMYB53, AdMYB83, and AdMYB89 responded to hormones to varying degrees, and they were highly expressed in leaves and responded quickly in roots. This study lays a foundation for further investigating the function of MYB-related transcription factors of A. dahurica var. formosana and solving the corresponding biological problems such as bolting early.
Subject(s)
Angelica/chemistry , Animals , Computational Biology , Gastropoda , Phylogeny , Plant Leaves , Plant Proteins/genetics , Transcription Factors/geneticsABSTRACT
Farnesyl diphosphate synthase(FPPS) is a key enzyme at the branch point of the sesquiterpene biosynthetic pathway, but there are no reports on the transcriptional regulation of FPPS promoter in Pogostemon cabin. In the early stage of this study, we obtained the binding protein PcFBA-1 of FPPS gene promoter in P. cabin. In order to explore the possible mechanism of PcFBA-1 involved in the regulation of patchouli alcohol biosynthesis, this study performed PCR-based cloning and sequencing analysis of PcFBA-1, analyzed the expression patterns of PcFBA-1 in different tissues by fluorescence quantitative PCR and its subcellular localization using the protoplast transformation system, detected the binding of PcFBA-1 protein to the FPPS promoter in vitro with the yeast one-hybrid system, and verified its transcriptional regulatory function by dual-luciferase reporter gene assay. The findings demonstrated that the cloned PcFBA-1 had an open reading frame(ORF) of 1 131 bp, encoding a protein of 376 amino acids, containing two conserved domains named F-box-like superfamily and FBA-1 superfamily, and belonging to the F-box family. Moreover, neither signal peptide nor transmembrane domain was contained, implying that it was an unstable hydrophilic protein. In addition, as revealed by fluorescence quantitative PCR results, PcFBA-1 had the highest expression in leaves, and there was no significant difference in expression in roots or stems. PcFBA-1 protein was proved mainly located in the cytoplasm. Furthermore, yeast one-hybrid screening and dual-luciferase reporter gene assay showed that PcFBA-1 was able to bind to FPPS promoter both in vitro and in vivo to enhance the activity of FPPS promoter. In summary, this study identifies a new transcription factor PcFBA-1 in P. cabin, which directly binds to the FPPS gene promoter to enhance the promoter activity. This had laid a foundation for the biosynthesis of patchouli alcohol and other active ingre-dients and provided a basis for metabolic engineering and genetic improvement of P. cabin.
Subject(s)
Amino Acid Sequence , Cloning, Molecular , Geranyltranstransferase/genetics , Pogostemon , Transcription Factors/geneticsABSTRACT
YWHAE gene is located on chromosome 17p13.3, and its product 14-3-3epsilon protein belongs to 14-3-3 protein family. As a molecular scaffold, YWHAE participates in biological processes such as cell adhesion, cell cycle regulation, signal transduction and malignant transformation, and is closely related to many diseases. Overexpression of YWHAE in breast cancer can increase the ability of proliferation, migration and invasion of breast cancer cells. In gastric cancer, YWHAE acts as a negative regulator of MYC and CDC25B, which reduces their expression and inhibits the proliferation, migration, and invasion of gastric cancer cells, and enhances YWHAE-mediated transactivation of NF-κB through CagA. In colorectal cancer, YWHAE lncRNA, as a sponge molecule of miR-323a-3p and miR-532-5p, can compete for endogenous RNA through direct interaction with miR-323a-3p and miR-532-5p, thus up-regulating K-RAS/ERK/1/2 and PI3K-AKT signaling pathways and promoting the cell cycle progression of the colorectal cancer. YWHAE not only mediates tumorigenesis as a competitive endogenous RNA, but also affects gene expression through chromosome variation. For example, the FAM22B-YWHAE fusion gene caused by t(10; 17) (q22; p13) may be associated with the development of endometrial stromal sarcoma. At the same time, the fusion transcript of YWHAE and NUTM2B/E may also lead to the occurrence of endometrial stromal sarcoma. To understand the relationship between YWHAE, NUTM2A, and NUTM2B gene rearrangement/fusion and malignant tumor, YWHAE-FAM22 fusion gene/translocation and tumor, YWHAE gene polymorphism and mental illness, as well as the relationship between 17p13.3 region change and disease occurrence. It provides new idea and basis for understanding the effect of YWHAE gene molecular mechanism and genetic variation on the disease progression, and for the targeted for the diseases.
Subject(s)
14-3-3 Proteins/metabolism , Breast Neoplasms/genetics , Cell Line, Tumor , Cell Proliferation/genetics , Cell Transformation, Neoplastic/genetics , Colorectal Neoplasms/genetics , Endometrial Neoplasms , Female , Gene Expression Regulation, Neoplastic , Humans , MicroRNAs/genetics , Phosphatidylinositol 3-Kinases/metabolism , Sarcoma, Endometrial Stromal/pathology , Stomach Neoplasms/genetics , Transcription Factors/genetics , Translocation, GeneticABSTRACT
BACKGROUND@#SMARCA2 (SWI/SNF Related, Matrix Associated, Actin Dependent Regulator of Chromatin, Subfamily A, Member 2) is an important ATPase catalytic subunit in the switch-sucrose nonfermenting (SWI/SNF) complex. However, its relationship with the pathological features of NSCLC and its prognosis remain unclear.@*METHODS@#We retrospectively reviewed 2390 patients with surgically resected NSCLC, constructed tissue microarrays (TMAs) and performed immunohistochemical assays. We analyzed the correlation of SAMRCA2 with clinicopathological features and evaluated its prognostic value.@*RESULTS@#Among 2390 NSCLC cases, the negative expression ratios of SAMRCA2, SMARCA4, ARID1A, ARID1B and INI1 were 9.3%, 1.8%, 1.2%, 0.4% and 0%, respectively. In NSCLC, male sex, T3 and T4 stage, moderate and poor differentiation, tumor ≥ 2 cm, Ki67 ≥ 15%, SOX-2 negative expression, middle lobe lesion and adenocarcinoma were relative risk factors affecting SMARCA2-negative expression. In lung adenocarcinomas, high-grade nuclei, histological morphology of acinar and papillary, solid and micropapillary and TTF-1-negative expression were relative risk factors affecting SMARCA2-negative expression. Kaplan-Meier survival analysis showed that the OS was shorter in the SMARCA2-negative group. Multivariate survival analysis revealed that SMARCA2-negative expression was an independent factor correlated with a poor prognosis in NSCLC.@*CONCLUSION@#In conclusion, SMARCA2-negative expression is an independent predictor of a poor outcome of NSCLC and is a potential target for NSCLC treatment.
Subject(s)
Adenosine Triphosphatases/metabolism , Carcinoma, Non-Small-Cell Lung/genetics , Humans , Male , Retrospective Studies , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To explore the genetic basis for a child presented with renal failure and multi-cystic dysplastic kidney without anal atresia.@*METHODS@#Peripheral blood sample of the child and his parents were collected and subjected to whole exome sequencing. Candidate variant was verified by Sanger sequencing.@*RESULTS@#The 40-day-old infant had presented with vomiting brown matter in a 7 days neonate and was transferred for kidney failure. Clinical examination has discovered renal failure, polycystic renal dysplasia, congenital hypothyroidism, bilateral thumb polydactyly, sensorineural hearing loss and preauricular dermatophyte. Genetic testing revealed that he has harbored a previously unreported c.824delT, p.L275Yfs*10 frameshift variant of SALL1 gene, which was confirmed by Sanger sequencing as de novo.@*CONCLUSION@#The patient was diagnosed with Townes-Brocks syndrome due to the novel de novo variant of SALL1 gene. Townes-Brocks syndrome without anal atresia is rare. Above finding has also enriched the mutational spectrum of the SALL1 gene.
Subject(s)
Abnormalities, Multiple , Anus, Imperforate/genetics , Child , Female , Hearing Loss, Sensorineural/genetics , Humans , Infant , Infant, Newborn , Male , Renal Insufficiency , Thumb/abnormalities , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To explore the genetic basis for two Chinese pedigrees affected with Coffin-Siris syndrome (CSS).@*METHODS@#Whole exome sequencing (WES) was carried out for the probands. Candidate variants were verified by Sanger sequencing of the probands and their family members.@*RESULTS@#The two probands were respectively found to harbor a heterozygous c.5467delG (p.Gly1823fs) variant and a heterozygous c.5584delA (p.Lys1862fs) variant of the ARID1B gene, which were both of de novo in origin and unreported previously. Based on the guidelines of American College of Medical Genetics and Genomics, both variants were predicted to be pathogenic (PVS1+PS2+PM2).@*CONCLUSION@#The c.5467delG (p.Gly1823fs) and c.5545delA (p.Lys1849fs) variants of the ARID1B genes probably underlay the CSS in the two probands. Above results have enabled genetic counselling and prenatal diagnosis for the pedigrees.
Subject(s)
Abnormalities, Multiple , China , DNA-Binding Proteins/genetics , Face/abnormalities , Hand Deformities, Congenital , Humans , Intellectual Disability , Micrognathism , Neck/abnormalities , Pedigree , Transcription Factors/geneticsABSTRACT
OBJECTIVES@#Nasopharyngeal carcinoma (NPC) is a highly invasive epithelial malignant tumor with unique geographical and ethnic distribution characteristics. NPC is mostly found in south China and Southeast Asia, and its treatment mainly depends on radiotherapy and chemotherapy. However, NPC is usually found in the late stage, and local recurrence and distant metastasis are common, leading to poor prognosis. The receptor tyrosine kinase AXL is up-regulated in various tumors and it is involved in tumor proliferation, migration, invasion, and other processes, which are associated with poor prognosis of tumors. This study aims to detect the expression of AXL in NPC cell lines and tissues, and to investigate its biological function of AXL and the underlying molecular mechanisms in regulation of NPC.@*METHODS@#The expression levels of AXL in normal nasopharyngeal epithelial tissues and NPC tissues were analyzed by GSE68799, GSE12452, and GSE53819 data sets based on Gene Expression Omnibus (GEO) database. The Cancer Genome Atlas (TCGA) database was used to analyze the relationship between AXL and prognosis of head and neck squamous cell carcinoma (HNSC). The indicators of prognosis included overall survival (OS), disease-free interval (DFI), disease-specific survival (DSS), and progression-free interval (PFI). Western blotting assay was used to detect the AXL protein expression levels in normal nasopharyngeal epithelial cell line and NPC cell lines. Immunohistochemical method was used to detect AXL expression levels in normal nasopharyngeal epithelial tissues and NPC tissues. Cell lines with stable AXL knockdown were established by infecting 5-8F and Fadu cells with lentivirus interference vector, and cell lines with stable AXL overexpression were established by infecting C666-1 and HK-1 cells with lentivirus expression vector. Real-time PCR and Western blotting were used to detect the efficiency of knockdown and overexpression in stable cell lines. The effects of AXL knockdown or overexpression on proliferation, migration, and invasion of NPC cells were detected by CCK-8, plate colony formation, and Transwell assays, and the effect of AXL knockdown on tumor growth in nude mice was detected by subcutaneous tumor formation assay. The sequence of AXL upstream 2.0 kb promoter region was obtained by UCSC online database. The PROMO online database was used to predict AXL transcription factors with 0% fault tolerance, and the JASPAR online database was used to predict the binding sites of ETS1 to AXL. Real-time PCR and Western blotting were used to detect the effect of ETS1 on AXL protein and mRNA expression. The AXL upstream 2.0 kb promoter region was divided into 8 fragments, each of which was 250 bp in length. Primers were designed for 8 fragments. The binding of ETS1 to AXL promoter region was detected by chromatin immuno-precipitation (ChIP) assay to determine the direct regulatory relationship between ETS1 and AXL. Rescue assay was used to determine whether ETS1 affected the proliferation, migration, and invasion of NPC cells through AXL.@*RESULTS@#Bioinformatics analysis showed that AXL was highly expressed in NPC tissues (P<0.05), and AXL expression was positively correlated with OS, DFI, DSS, and PFI in HNSC patients. Western blotting and immunohistochemical results showed that AXL was highly expressed in NPC cell lines and tissues compared with the normal nasopharyngeal epithelial cell line and tissues. Real-time PCR and Western blotting results showed that knockdown and overexpression efficiency in the stable cell lines met the requirements of subsequent experiments. The results of CCK-8, plate colony formation, Transwell assays and subcutaneous tumor formation in nude mice showed that down-regulation of AXL significantly inhibited the proliferation, migration, invasion of NPC cells and tumor growth (all P<0.05), and the up-regulation of AXL significantly promoted the proliferation, migration, and invasion of NPC cells (all P<0.05).As predicted by PROMO and JASPAR online databases, ETS1 was a transcription factor of AXL and had multiple binding sites in the AXL promoter region. Real-time PCR and Western blotting results showed that knockdown or overexpression of ETS1 down-regulated or up-regulated AXL protein and mRNA expression levels. ChIP assay result showed that ETS1 bound to AXL promoter region and directly regulate AXL expression. Rescue assay showed that AXL rescued the effects of ETS1 on proliferation, migration and invasion of NPC cells (P<0.05).@*CONCLUSIONS@#AXL is highly expressed in NPC cell lines and tissues, which can promote the malignant progression of NPC, and its expression is regulated by transcription factor ETS1.
Subject(s)
Animals , Cell Line, Tumor , Cell Movement/genetics , Cell Proliferation/genetics , Gene Expression Regulation, Neoplastic , Mice , Mice, Nude , Nasopharyngeal Carcinoma/genetics , Nasopharyngeal Neoplasms/metabolism , RNA, Messenger/genetics , Sincalide/metabolism , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To investigate the serum microRNA (miRNA) expression and examine the impact of miRNA expression profiles on T helper type 17 (Th17)/regulatory T cells (Treg) imbalance among patients with cystic echinococcosis, so as to provide insights into the illustration of the mechanisms underlying chronic Echinococcus granulosus infections, and long-term pathogenesis.@*METHODS@#Total RNA was extracted from the sera of cystic echinococcosis patients and healthy controls, and subjected to high-throughput sequencing with the Illumina sequencing platform. Known miRNAs were annotated and new miRNAs were predicted using the miRBase database and the miRDeep2 tool, and differentially expressed miRNAs were identified. The target genes of differentially expressed miRNAs were predicted using the software miRanda and TargetScan, and the intersection was selected for Gene Ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Among the differentially expressed miRNAs with the 20 highest fold changes, miRNAs that targeted genes relating to key transcription factors RORC and FOXP3 that determine the production of Th17 and Treg cells or their important regulatory pathways (PI3K-Akt and mTOR pathways) were matched.@*RESULTS@#A total of 53 differentially expressed miRNAs were screened in sera of cystic echinococcosis patients and healthy controls, including 47 up-regulated miRNAs and 6 down-regulated miRNAs. GO enrichment analysis showed that these differentially expressed miRNA were involved DNA transcription and translation, cell components, cell morphology, neurodevelopment and metabolic decomposition, and KEGG pathway analysis showed that the differentially expressed miRNA were mainly involved in MAPK, PI3K-Akt and mTOR signaling pathways. Among the differentially expressed miRNAs with the 20 highest fold changes, there were 3 miRNAs that had a potential for target regulation of RORC, and 15 miRNAs that had a potential to target the PI3K-Akt and mTOR signaling pathways.@*CONCLUSIONS@#Significant changes are found in serum miRNA expression profiles among patients with E. granulosus infections, and differentially expressed miRNAs may lead to Th17/Treg imbalance through targeting the key transcription factors of Th17/Treg or PI3K-Akt and mTOR pathways, which facilitates the long-term parasitism of E. granulosus in hosts and causes a chronic disease.
Subject(s)
Echinococcosis/genetics , Gene Expression Profiling , Humans , MicroRNAs/metabolism , Phosphatidylinositol 3-Kinases/genetics , Proto-Oncogene Proteins c-akt/genetics , T-Lymphocytes, Regulatory , TOR Serine-Threonine Kinases/genetics , Th17 Cells , Transcription Factors/geneticsABSTRACT
Abstract Introduction: Non-syndromic cleft lip with or without cleft palate is a common worldwide birth defect due to a combination of environmental and genetic factors. Genome-wide association studies reported the rs7078160 of Vax1 is closely related to non-syndromic cleft lip with or without cleft palate in European populations. The following studies showed the same results in Mongolian, Japanese, Filipino, Vietnamese populations etc. However, conflicting research had been reported in Chinese population, Objective: The aim of this study was to investigate the association between the rs7078160 polymorphism and non-syndromic cleft lip with or without cleft palate in Southern Chinese patients. Methods: In this study, we investigated the polymorphism distribution of rs7078160 in 100 complete patient trios (39 patients with non-syndromic cleft lip and palate; 36 patients with non-syndromic cleft lip only; 25 had non-syndromic cleft palate only; and their parents) from Southern ethnic Han Chinese. 60 healthy trios were selected as control. Polymerase chain reaction and Sanger sequencing were used to genotype rs7078160 in Vax1; both case-control and family-based associations were analyzed. Results: The case-control analyses revealed the rs7078160 polymorphism was significant, associated with non-syndromic cleft lip with or without cleft palate (p = 0.04) and non-syndromic cleft lip and palate (p = 0.01), but not associated with non-syndromic cleft lip only and nonsyndromic cleft palate only patients. The genotype composition of rs7078160 comprises mutated homozygous AA, heterozygous AG and wild homozygous GG. Cases with AG + AA genotypes compared with GG homozygotes showed an increased risk of non-syndromic cleft lip with or without cleft palate (p = 0.04, OR = 2.05, 95% CI: 1.01-4.16) and non-syndromic cleft lip and palate (p = 0.01, OR = 3.94, 95% CI: 1.34-11.54). In addition, we did not detect any transmissiondisequilibrium in rs7078160 (p = 0.68). Conclusion: This study suggests that rs7078160 polymorphism is a risk factor of non-syndromic cleft lip with or without cleft palate, and Vax1 is strongly associated with non-syndromic cleft lip with or without cleft palate in Southern Chinese Han populations.
Resumo Introdução: A fenda labial não sindrômica, com ou sem fenda palatina, é um defeito congênito comum em todo o mundo, devido a uma combinação de fatores ambientais e genéticos. O genome-wide association studies relatou que o polimorfismo rs7078160 do Vax1 está intimamente relacionado à fenda labial não sindrômica, com ou sem fenda palatina em populações europeias. Estudos subsequentes mostraram os mesmos resultados nas populações mongol, japonesa, filipina e vietnamita etc. No entanto, pesquisas conflitantes foram relatadas na população chinesa. Objetivo: Investigar a associação entre o polimorfismo rs7078160 e fenda labial não sindrômica, com ou sem fenda palatina, em pacientes do sul da China. Método: Tentamos investigar a distribuição do polimorfismo rs7078160 em 100 trios completos de pacientes (39 pacientes com fenda labial e palatina não sindrômica; 36 pacientes com fenda labial somente, não sindrômica; 25 com fenda palatina somente, não sindrômica e seus pais), da etnia Han do sul da China, e em 60 trios saudáveis selecionados como controle. Reação de polimerase em cadeia e o sequenciamento de Sanger foram uszados para genotipar o polimorfismo rs7078160 do Vax1 e tanto os casos-controle quanto as associações baseadas na família foram analisadas. Resultados: As análises de caso-controle revelaram que o polimorfismo rs7078160 estava significativamente associado a fenda labial não sindrômica, com ou sem fenda palatina (p = 0,04) e fenda labial e palatina não sindrômica (p = 0,01), mas não estava associado a pacientes com fenda labial somente não sindrômica e fenda palatina somente não sindrômica. A composição do genótipo de rs7078160 compreende AA homozigoto mutado, AG heterozigoto e GG homozigoto selvagem. Casos com genótipos AG + AA comparados com GG homozigotos mostraram um risco aumentado de fenda labial não sindrômica, com ou sem fenda palatina (p = 0,04, OR = 2,05, IC de 95%: 1,01 ± 4,16) e fenda labial e palatina não sindrômica (p = 0,01, OR = 3,94, IC 95%: 1,34-11,54). Além disso, não detectamos desequilíbrio de transmissão em rs7078160 (p = 0,68). Conclusão: Este estudo sugere que o polimorfismo rs7078160 foi um fator de risco para fenda labial não sindrômica, com ou sem fenda palatina, e o gene Vax1 está fortemente associado com fenda labial não sindrômica, com ou sem fenda palatina em populações da etnia Han do sul da China.
Subject(s)
Humans , Cleft Lip/genetics , Cleft Palate/genetics , Transcription Factors/genetics , Case-Control Studies , China , Homeodomain Proteins/genetics , Genetic Predisposition to Disease , Polymorphism, Single Nucleotide , Genome-Wide Association Study , GenotypeABSTRACT
Current understanding of the genetic factors contributing to the etiology of non-syndromic craniosynostosis (NSC) remains scarce. The present work investigated the presence of variants in ALX4, EFNA4, and TWIST1 genes in children with NSC to verify if variants within these genes may contribute to the occurrence of these abnormal phenotypes. A total of 101 children (aged 45.07±40.94 months) with NSC participated in this cross-sectional study. Parents and siblings of the probands were invited to participate. Medical and family history of craniosynostosis were documented. Biological samples were collected to obtain genomic DNA. Coding exons of human TWIST1, ALX4, and EFNA4 genes were amplified by polymerase chain reaction and Sanger sequenced. Five missense variants were identified in ALX4 in children with bilateral coronal, sagittal, and metopic synostosis. A de novo ALX4 variant, c.799G>A: p.Ala267Thr, was identified in a proband with sagittal synostosis. Three missense variants were identified in the EFNA4 gene in children with metopic and sagittal synostosis. A TWIST1 variant occurred in a child with unilateral coronal synostosis. Variants were predicted to be among the 0.1% (TWIST1, c.380C>A: p. Ala127Glu) and 1% (ALX4, c.769C>T: p.Arg257Cys, c.799G>A: p.Ala267Thr, c.929G>A: p.Gly310Asp; EFNA4, c.178C>T: p.His60Tyr, C.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr) most deleterious variants in the human genome. With the exception of ALX4, c.799G>A: p.Ala267Thr, all other variants were present in at least one non-affected family member, suggesting incomplete penetrance. Thus, these variants may contribute to the development of craniosynostosis, and should not be discarded as potential candidate genes in the diagnosis of this condition.
Subject(s)
Humans , Child , Craniosynostoses/genetics , Transcription Factors/genetics , Base Sequence , Family , Cross-Sectional Studies , Mutation, Missense/genetics , DNA-Binding Proteins/geneticsABSTRACT
MAMLD1 gene has been implicated in 46,XY disorders of sex development (DSD) in recent years. Patients carrying MAMLD1 gene variants showed a "continuous spectrum" of simple micropenis, mild, moderate and severe hypospadias with micropenis, cryptorchidism, split scrotum and even complete gonadal dysplasia. The function of MAMLD1 gene in sexual development has not been fully elucidated, and its role in DSD has remained controversial. This article has reviewed recent findings on the role of the MAMLD1 gene in DSD, including the MAMLD1 gene, its encoded protein, genetic variants, clinical phenotype and possible pathogenic mechanism in DSD.
Subject(s)
DNA-Binding Proteins/genetics , Disorders of Sex Development/genetics , Humans , Male , Mutation , Nuclear Proteins/genetics , Phenotype , Sexual Development , Transcription Factors/geneticsABSTRACT
The terpenoids in Pogostemon cablin have complex structures and abundant pharmacological effects. Patchouli alcohol(PA) and pogostone(PO) have a high medicinal value by virtue of anti-tumor, anti-inflammatory, antibacterial, antioxidant, and other biological activities. Due to the low content of terpenoid metabolites in P. cablin, the study of biosynthesis and metabolism regulation can provide a biosynthetic basis for obtaining high-content terpenoids. In this study, key enzyme genes in biosynthesis, transcription factors in metabolism regulation, spatio-temporal expression of terpene synthase were reviewed, aiming to provide a reference for the development, protection, and utilization of P. cablin resources.
Subject(s)
Pogostemon/genetics , Terpenes , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.@*METHODS@#High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.@*RESULTS@#The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.@*CONCLUSION@#The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.
Subject(s)
Autistic Disorder/genetics , Child , Developmental Disabilities , Female , Humans , Mutation , Retrospective Studies , Syndrome , Transcription Factors/geneticsABSTRACT
Nuclear receptor subfamily 2, group F, member 6 (NR2F6) is a member of orphan nuclear receptors, which is expressed in major tissues and organs of the human body, and plays an important role in the regulation of various biological functions and gene expressions. Recent studies have shown that the expression of NR2F6 was up-regulated in a variety of malignant tumors and showed significant correlations with cancer progression. These findings triggered the widespread interest in understanding the relationship between NR2F6 and cancer development and progression. In addition, the latest studies have underscored that NR2F6 was involved in enhancing antitumor immune responses that could serve as a potential target for immune regulation. This review summarizes the biological functions of NR2F6 and its role in tumors, with the aim to provide new insights into effective cancer therapies.
Subject(s)
Gene Expression Regulation , Humans , Neoplasms/genetics , Receptors, Cytoplasmic and Nuclear/genetics , Repressor Proteins/genetics , Transcription Factors/geneticsABSTRACT
This study cloned the transcription factor gene PnbHLH which held an open reading frame of 966 bp encoding 321 amino acids. This study constructed the overexpression vector of transcription factor PnbHLH of Panax notoginseng. The combination of PnbHLH overexpression and RNAi of the key enzyme gene PnCAS involved in the phytosterol biosynthesis was achieved in P. notoginseng cells, thus exploring the biosynthetic regulation of P. notoginseng saponins(PNS) by the synergistic effect of PnbHLH overexpression and PnCAS RNAi. The results showed that the PnbHLH transcription factor interacted with the promoters of key enzyme genes PnDS, PnSS and PnSE in the biosynthetic pathway of PNS, and then regulated the expression levels of key enzyme genes and affected the biosynthesis of saponins indirectly. Further study indicated that the synergistic effect of PnbHLH overexpression and PnCAS RNAi was a more effective approach to regulate the biosynthesis of saponins. Compared with the wild type and PnCAS RNAi cells of P. notoginseng, the contents of total saponins and monomeric saponins(Rd, Rb_1, Re, Rg_1 and R_1) were increased to some extent in the cell lines of PnbHLH overexpression and PnCAS RNAi. This indicated that the two ways of forward regulation and reverse regulation of saponin biosynthesis showed superposition effect. This study explored a more rational and efficient regulation strategy of PNS biosynthesis based on the advantages of multi-point regulation of transcription factors as well as the down-regulation of by-product synthesis of saponins.
Subject(s)
Intramolecular Transferases , Panax notoginseng , RNA Interference , Saponins , Transcription Factors/geneticsABSTRACT
Objective To summarize clinical characteristics and investigate possible pathogenic gene of Klippel-Feil syndrome(KFS)by the self-designed multigene panel sequencing,so as to decipher the molecular basis for early diagnosis and targeted therapy.Methods From January 2015 to December 2018,we consecutively recruited 25 patients who were diagnosed with KFS in Peking Union Medical College Hospital.The demographic information,clinical manifestations,physical examination and radiological assessments were analyzed.Multigene panel sequencing was performed after DNA extraction from peripheral blood.The possible pathogenic mutations of KFS were explored on the basis of bioinformatics analysis.Results The KFS cohort consisted of 25 patients,including 15 males and 10 females,with a mean age of(12.9±7.3)years.Limited cervical range of motion was the most common clinical feature(12 cases,48%).Based on the Samartzis classification,the proportion of patients suffered from short neck(P=0.031)and limited cervical range of motion(P=0.026)in type Ⅲ KFS was significantly higher than that in type Ⅱ and type Ⅰ KFS.Panel sequencing detected a total of 11 pathogenic missense mutations in eight patients,including COL6A1,COL6A2,CDAN1,GLI3,FLNB,CHRNG,MYH3,POR,and TNXB.There was no pathogenic mutation found in five reported pathogenic genes(GDF6,MEOX1,GDF3,MYO18B and RIPPLY2)associated with KFS.Conclusions Our study has shown that patients with multiple contiguous cervical fusions are more likely to manifest short neck,limited cervical range of motion,and clinical triad.Therefore,these patients need additional attention and follow-up.Our analysis highlights novel KFS-related genetic variants,such as COL6A and CDAN1,extending the spectrum of known mutations contributing to this syndrome and providing a basis for elucidating the pathogenesis of KFS.
Subject(s)
Cervical Vertebrae , Child , Cohort Studies , Female , Glycoproteins , Humans , Klippel-Feil Syndrome/genetics , Male , Mutation , Nuclear Proteins , Radiography , Transcription Factors/geneticsABSTRACT
Accumulating evidence demonstrates that the nucleus tractus solitarii (NTS) neurons serve as central respiratory chemoreceptors, but the underlying molecular mechanisms remain undefined. The present study investigated the expression of acid-sensitive ether-à-go-go-gene-like (Elk, Kv12) channels in the NTS of mice. Immunofluorescence staining was used to observe the distribution and cellular localization of the Kv12 channels in NTS neurons. Western blot and quantitative real-time PCR (qPCR) were used to evaluate protein and mRNA expression levels of Kv12 channels. The results showed that all of the three members (Kv12.1, Kv12.2, Kv12.3) of the Kv12 channel family were expressed in NTS neurons, and their expressions were co-localized with paired-like homeobox 2b gene (Phox2b) expression. The expression of Kv12.1 mRNA was the largest, whereas the expression of Kv12.3 was the least in the NTS. The results suggest Kv12 channels are expressed in Phox2b-expressing neurons in the NTS of mice, which provides molecular evidence for pH sensitivity in Phox2b-expressing NTS neurons.
Subject(s)
Animals , Mice , Neurons , Potassium Channels, Voltage-Gated , Solitary Nucleus , Transcription Factors/geneticsABSTRACT
OBJECTIVE@#To investigate the relationship between acute myeloid leukemia (AML) patients ASXL2, ZBTB7A gene mutations and the prognosis.@*METHODS@#42 AML Patients treated in our hospital from January 2014 to January 2016 were selected and ASXL2 and ZBTB7A genes of their bone marrow samples were sequenced, the genetic characteristics and prognosis of core-binding factor-AML(CBF-AML) patients with ASXL2 and ZBTB7A mutations were analyzed.@*RESULTS@#ASXL2 (33.3%) and ZBTB7A (9.5%) mutations were found in t (8; 21) AML patients. Compared with wild-type, patients with ASXL2 mutations showed significantly higher white blood cell count at diagnosis [(9.49±1.85)×10@*CONCLUSION@#ASXL2 and ZBTB7A mutations are frequently found in t (8; 21) AML patients. The mutation of ASXL2 and ZBTB7A genes shows no significant effect on the prognosis of AML patients.