Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 176
Filter
1.
Braz. j. biol ; 83: e242603, 2023. tab, graf
Article in English | MEDLINE, LILACS, VETINDEX | ID: biblio-1355852

ABSTRACT

Abstract Transcription factors (TF) are a wide class of genes in plants, and these can regulate the expression of other genes in response to various environmental stresses (biotic and abiotic). In the current study, transcription factor activity in sugarcane was examined during cold stress. Initially, RNA transcript reads of two sugarcane cultivars (ROC22 and GT08-1108) under cold stress were downloaded from SRA NCBI database. The reads were aligned into a reference genome and the differential expression analyses were performed with the R/Bioconductor edgeR package. Based on our analyses in the ROC22 cultivar, 963 TF genes were significantly upregulated under cold stress among a total of 5649 upregulated genes, while 293 TF genes were downregulated among a total of 3,289 downregulated genes. In the GT08-1108 cultivar, 974 TF genes were identified among 5,649 upregulated genes and 283 TF genes were found among 3,289 downregulated genes. Most transcription factors were annotated with GO categories related to protein binding, transcription factor binding, DNA-sequence-specific binding, transcription factor complex, transcription factor activity in RNA polymerase II, the activity of nucleic acid binding transcription factor, transcription corepressor activity, sequence-specific regulatory region, the activity of transcription factor of RNA polymerase II, transcription factor cofactor activity, transcription factor activity from plastid promoter, transcription factor activity from RNA polymerase I promoter, polymerase II and RNA polymerase III. The findings of above results will help to identify differentially expressed transcription factors during cold stress. It also provides a comprehensive analysis of the regulation of the transcription activity of many genes. Therefore, this study provides the molecular basis for improving cold tolerance in sugarcane and other economically important grasses.


Resumo Fatores de transcrição (FT) são uma ampla classe de genes em plantas e podem regular a expressão de outros genes em resposta a vários estresses ambientais (estresses bióticos e abióticos). No presente estudo, a atividade do fator de transcrição na cana-de-açúcar foi examinada durante o estresse pelo frio. Inicialmente, as leituras de transcrição de RNA de duas cultivares de cana-de-açúcar (ROC22 e GT08-1108) sob estresse frio foram baixadas do banco de dados SRA NCBI. As leituras foram alinhadas em um genoma de referência e as análises de expressão diferencial foram realizadas com o pacote R / Bioconductor edgeR. Com base em nossas análises no cultivar ROC22, 963 genes TF foram significativamente regulados positivamente sob estresse pelo frio entre um total de 5.649 genes regulados positivamente, enquanto 293 genes TF foram regulados negativamente entre um total de 3.289 genes regulados negativamente. No cultivar GT08-1108, 974 genes TF foram identificados entre 5.649 genes regulados positivamente e 283 genes TF foram encontrados entre 3.289 genes regulados negativamente. Os fatores de transcrição, em sua maioria, foram anotados com categorias GO relacionadas à ligação de proteína, ligação de fator de transcrição, ligação específica de sequência de DNA, complexo de fator de transcrição, atividade de fator de transcrição em RNA polimerase II, atividade de fator de transcrição de ligação de ácido nucleico, atividade de corepressor de transcrição, sequência específica da região reguladora, atividade do fator de transcrição da RNA polimerase II, atividade do cofator do fator de transcrição, atividade do fator de transcrição do promotor do plastídio, atividade do fator de transcrição do promotor da RNA polimerase I, polimerase II e RNA polimerase III. As descobertas dos resultados acima ajudarão a identificar fatores de transcrição expressos diferencialmente durante o estresse pelo frio. Ele também fornece uma análise abrangente da regulação da atividade de transcrição de muitos genes. Portanto, este estudo fornece base molecular para melhorar a tolerância ao frio em cana-de-açúcar e outras gramíneas economicamente importantes.


Subject(s)
Saccharum/genetics , Saccharum/metabolism , Cold-Shock Response/genetics , Stress, Physiological/genetics , Transcription Factors/genetics , Transcription Factors/metabolism , Cold Temperature , Gene Expression Regulation, Plant , Gene Expression Profiling
2.
Article in Chinese | WPRIM | ID: wpr-888372

ABSTRACT

OBJECTIVE@#To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism.@*METHODS@#High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis.@*RESULTS@#The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin.@*CONCLUSION@#The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.


Subject(s)
Autistic Disorder/genetics , Child , Developmental Disabilities , Female , Humans , Mutation , Retrospective Studies , Syndrome , Transcription Factors/genetics
3.
Article in Chinese | WPRIM | ID: wpr-880096

ABSTRACT

OBJECTIVE@#To investigate the relationship between acute myeloid leukemia (AML) patients ASXL2, ZBTB7A gene mutations and the prognosis.@*METHODS@#42 AML Patients treated in our hospital from January 2014 to January 2016 were selected and ASXL2 and ZBTB7A genes of their bone marrow samples were sequenced, the genetic characteristics and prognosis of core-binding factor-AML(CBF-AML) patients with ASXL2 and ZBTB7A mutations were analyzed.@*RESULTS@#ASXL2 (33.3%) and ZBTB7A (9.5%) mutations were found in t (8; 21) AML patients. Compared with wild-type, patients with ASXL2 mutations showed significantly higher white blood cell count at diagnosis [(9.49±1.85)×10@*CONCLUSION@#ASXL2 and ZBTB7A mutations are frequently found in t (8; 21) AML patients. The mutation of ASXL2 and ZBTB7A genes shows no significant effect on the prognosis of AML patients.


Subject(s)
Cell Line, Tumor , DNA-Binding Proteins/genetics , Humans , Leukemia, Myeloid, Acute/genetics , Mutation , Oncogene Proteins, Fusion/genetics , Prognosis , Repressor Proteins/genetics , Transcription Factors/genetics
4.
Article in Chinese | WPRIM | ID: wpr-879853

ABSTRACT

Neural development is regulated by both external environment and internal signals, and in addition to transcription factors, epigenetic modifications also play an important role. By focusing on the genetic mechanism of ATP-dependent chromatin remodeling in children with neurodevelopmental disorders, this article elaborates on the effect of four chromatin remodeling complexes on neurogenesis and the development and maturation of neurons and neuroglial cells and introduces the clinical research advances in neurodevelopmental disorders.


Subject(s)
Child , Chromatin , Chromatin Assembly and Disassembly , Humans , Neurodevelopmental Disorders/genetics , Neurogenesis , Transcription Factors/genetics
5.
Article in Chinese | WPRIM | ID: wpr-921968

ABSTRACT

MAMLD1 gene has been implicated in 46,XY disorders of sex development (DSD) in recent years. Patients carrying MAMLD1 gene variants showed a "continuous spectrum" of simple micropenis, mild, moderate and severe hypospadias with micropenis, cryptorchidism, split scrotum and even complete gonadal dysplasia. The function of MAMLD1 gene in sexual development has not been fully elucidated, and its role in DSD has remained controversial. This article has reviewed recent findings on the role of the MAMLD1 gene in DSD, including the MAMLD1 gene, its encoded protein, genetic variants, clinical phenotype and possible pathogenic mechanism in DSD.


Subject(s)
DNA-Binding Proteins/genetics , Disorders of Sex Development/genetics , Humans , Male , Mutation , Nuclear Proteins/genetics , Phenotype , Sexual Development , Transcription Factors/genetics
6.
Article in Chinese | WPRIM | ID: wpr-921738

ABSTRACT

The terpenoids in Pogostemon cablin have complex structures and abundant pharmacological effects. Patchouli alcohol(PA) and pogostone(PO) have a high medicinal value by virtue of anti-tumor, anti-inflammatory, antibacterial, antioxidant, and other biological activities. Due to the low content of terpenoid metabolites in P. cablin, the study of biosynthesis and metabolism regulation can provide a biosynthetic basis for obtaining high-content terpenoids. In this study, key enzyme genes in biosynthesis, transcription factors in metabolism regulation, spatio-temporal expression of terpene synthase were reviewed, aiming to provide a reference for the development, protection, and utilization of P. cablin resources.


Subject(s)
Pogostemon/genetics , Terpenes , Transcription Factors/genetics
7.
Chinese Journal of Biotechnology ; (12): 2595-2602, 2021.
Article in Chinese | WPRIM | ID: wpr-887825

ABSTRACT

Nuclear receptor subfamily 2, group F, member 6 (NR2F6) is a member of orphan nuclear receptors, which is expressed in major tissues and organs of the human body, and plays an important role in the regulation of various biological functions and gene expressions. Recent studies have shown that the expression of NR2F6 was up-regulated in a variety of malignant tumors and showed significant correlations with cancer progression. These findings triggered the widespread interest in understanding the relationship between NR2F6 and cancer development and progression. In addition, the latest studies have underscored that NR2F6 was involved in enhancing antitumor immune responses that could serve as a potential target for immune regulation. This review summarizes the biological functions of NR2F6 and its role in tumors, with the aim to provide new insights into effective cancer therapies.


Subject(s)
Gene Expression Regulation , Humans , Neoplasms/genetics , Receptors, Cytoplasmic and Nuclear/genetics , Repressor Proteins/genetics , Transcription Factors/genetics
8.
Article in Chinese | WPRIM | ID: wpr-879570

ABSTRACT

OBJECTIVE@#To explore the genetic basis for a child affected with Bainbridge-Ropers syndrome.@*METHODS@#Genomic DNA was extracted from peripheral venous blood samples from the patient and his parents. Whole exome sequencing (WES) was carried out to detect genetic variant of the proband. Candidate variant was verified by Sanger sequencing.@*RESULTS@#The 3-year-old boy presented with psychomotor retardation, linguistic difficulties, mental retardation and peculiar craniofacial phenotype. A de novo heterozygous nonsense variant of the ASXL3 gene, c.3106C>T, was identified by WES in the proband, and the same mutation was not found among his parents. Based on the American College of Medical Genetics and Genomics standards and guidelines, the c.3106C>T variant was predicted to be pathogenic (PVS1+PS2+PP4).@*CONCLUSION@#The heterozygous variant c.3106C>T of the ASXL3 gene probably underlies the Bainbridge-Ropers syndrome in the patient. Above result has enabled the clinical diagnosis and genetic counseling for the family.


Subject(s)
Child , Child, Preschool , Heterozygote , Humans , Intellectual Disability/genetics , Male , Mutation , Phenotype , Transcription Factors/genetics , Whole Exome Sequencing
9.
Article in Chinese | WPRIM | ID: wpr-879542

ABSTRACT

OBJECTIVE@#To explore the genetic etiology for a newborn with corneal opacity.@*METHODS@#The neonate and her parents were subjected to routine G-banding chromosomal karyotyping analysis. Copy number variation (CNV) was analyzed with low-coverage whole-genome sequencing (WGS) and single nucleotide polymorphism microarray (SNP array).@*RESULTS@#No karyotypic abnormality was found in the newborn and her parents. Low-coverage WGS has identified a de novo 5.5 Mb microdeletion at chromosome 8q21.11-q21.13 in the neonate, which encompassed the ZFHX4 and PEX2 genes. The result was confirmed by SNP array-based CNV analysis.@*CONCLUSION@#The newborn was diagnosed with chromosome 8q21.11 deletion syndrome. ZFHX4 may be one of the key genes underlying this syndrome.


Subject(s)
Chromosome Banding , Chromosomes, Human, Pair 8/genetics , DNA Copy Number Variations , Female , Genetic Testing , Homeodomain Proteins/genetics , Humans , Infant, Newborn , Karyotyping , Monosomy/genetics , Peroxisomal Biogenesis Factor 2/genetics , Polymorphism, Single Nucleotide , Transcription Factors/genetics
10.
Article in Chinese | WPRIM | ID: wpr-878916

ABSTRACT

This study cloned the transcription factor gene PnbHLH which held an open reading frame of 966 bp encoding 321 amino acids. This study constructed the overexpression vector of transcription factor PnbHLH of Panax notoginseng. The combination of PnbHLH overexpression and RNAi of the key enzyme gene PnCAS involved in the phytosterol biosynthesis was achieved in P. notoginseng cells, thus exploring the biosynthetic regulation of P. notoginseng saponins(PNS) by the synergistic effect of PnbHLH overexpression and PnCAS RNAi. The results showed that the PnbHLH transcription factor interacted with the promoters of key enzyme genes PnDS, PnSS and PnSE in the biosynthetic pathway of PNS, and then regulated the expression levels of key enzyme genes and affected the biosynthesis of saponins indirectly. Further study indicated that the synergistic effect of PnbHLH overexpression and PnCAS RNAi was a more effective approach to regulate the biosynthesis of saponins. Compared with the wild type and PnCAS RNAi cells of P. notoginseng, the contents of total saponins and monomeric saponins(Rd, Rb_1, Re, Rg_1 and R_1) were increased to some extent in the cell lines of PnbHLH overexpression and PnCAS RNAi. This indicated that the two ways of forward regulation and reverse regulation of saponin biosynthesis showed superposition effect. This study explored a more rational and efficient regulation strategy of PNS biosynthesis based on the advantages of multi-point regulation of transcription factors as well as the down-regulation of by-product synthesis of saponins.


Subject(s)
Intramolecular Transferases , Panax notoginseng , RNA Interference , Saponins , Transcription Factors/genetics
11.
Article in Chinese | WPRIM | ID: wpr-878693

ABSTRACT

Objective To summarize clinical characteristics and investigate possible pathogenic gene of Klippel-Feil syndrome(KFS)by the self-designed multigene panel sequencing,so as to decipher the molecular basis for early diagnosis and targeted therapy.Methods From January 2015 to December 2018,we consecutively recruited 25 patients who were diagnosed with KFS in Peking Union Medical College Hospital.The demographic information,clinical manifestations,physical examination and radiological assessments were analyzed.Multigene panel sequencing was performed after DNA extraction from peripheral blood.The possible pathogenic mutations of KFS were explored on the basis of bioinformatics analysis.Results The KFS cohort consisted of 25 patients,including 15 males and 10 females,with a mean age of(12.9±7.3)years.Limited cervical range of motion was the most common clinical feature(12 cases,48%).Based on the Samartzis classification,the proportion of patients suffered from short neck(P=0.031)and limited cervical range of motion(P=0.026)in type Ⅲ KFS was significantly higher than that in type Ⅱ and type Ⅰ KFS.Panel sequencing detected a total of 11 pathogenic missense mutations in eight patients,including COL6A1,COL6A2,CDAN1,GLI3,FLNB,CHRNG,MYH3,POR,and TNXB.There was no pathogenic mutation found in five reported pathogenic genes(GDF6,MEOX1,GDF3,MYO18B and RIPPLY2)associated with KFS.Conclusions Our study has shown that patients with multiple contiguous cervical fusions are more likely to manifest short neck,limited cervical range of motion,and clinical triad.Therefore,these patients need additional attention and follow-up.Our analysis highlights novel KFS-related genetic variants,such as COL6A and CDAN1,extending the spectrum of known mutations contributing to this syndrome and providing a basis for elucidating the pathogenesis of KFS.


Subject(s)
Cervical Vertebrae , Child , Cohort Studies , Female , Glycoproteins , Humans , Klippel-Feil Syndrome/genetics , Male , Mutation , Nuclear Proteins , Radiography , Transcription Factors/genetics
12.
Acta Physiologica Sinica ; (6): 217-222, 2021.
Article in English | WPRIM | ID: wpr-878250

ABSTRACT

Accumulating evidence demonstrates that the nucleus tractus solitarii (NTS) neurons serve as central respiratory chemoreceptors, but the underlying molecular mechanisms remain undefined. The present study investigated the expression of acid-sensitive ether-à-go-go-gene-like (Elk, Kv12) channels in the NTS of mice. Immunofluorescence staining was used to observe the distribution and cellular localization of the Kv12 channels in NTS neurons. Western blot and quantitative real-time PCR (qPCR) were used to evaluate protein and mRNA expression levels of Kv12 channels. The results showed that all of the three members (Kv12.1, Kv12.2, Kv12.3) of the Kv12 channel family were expressed in NTS neurons, and their expressions were co-localized with paired-like homeobox 2b gene (Phox2b) expression. The expression of Kv12.1 mRNA was the largest, whereas the expression of Kv12.3 was the least in the NTS. The results suggest Kv12 channels are expressed in Phox2b-expressing neurons in the NTS of mice, which provides molecular evidence for pH sensitivity in Phox2b-expressing NTS neurons.


Subject(s)
Animals , Mice , Neurons , Potassium Channels, Voltage-Gated , Solitary Nucleus , Transcription Factors/genetics
13.
Braz. j. med. biol. res ; 54(11): e11396, 2021. graf
Article in English | LILACS | ID: biblio-1339444

ABSTRACT

Current understanding of the genetic factors contributing to the etiology of non-syndromic craniosynostosis (NSC) remains scarce. The present work investigated the presence of variants in ALX4, EFNA4, and TWIST1 genes in children with NSC to verify if variants within these genes may contribute to the occurrence of these abnormal phenotypes. A total of 101 children (aged 45.07±40.94 months) with NSC participated in this cross-sectional study. Parents and siblings of the probands were invited to participate. Medical and family history of craniosynostosis were documented. Biological samples were collected to obtain genomic DNA. Coding exons of human TWIST1, ALX4, and EFNA4 genes were amplified by polymerase chain reaction and Sanger sequenced. Five missense variants were identified in ALX4 in children with bilateral coronal, sagittal, and metopic synostosis. A de novo ALX4 variant, c.799G>A: p.Ala267Thr, was identified in a proband with sagittal synostosis. Three missense variants were identified in the EFNA4 gene in children with metopic and sagittal synostosis. A TWIST1 variant occurred in a child with unilateral coronal synostosis. Variants were predicted to be among the 0.1% (TWIST1, c.380C>A: p. Ala127Glu) and 1% (ALX4, c.769C>T: p.Arg257Cys, c.799G>A: p.Ala267Thr, c.929G>A: p.Gly310Asp; EFNA4, c.178C>T: p.His60Tyr, C.283A>G: p.Lys95Glu, c.349C>A: Pro117Thr) most deleterious variants in the human genome. With the exception of ALX4, c.799G>A: p.Ala267Thr, all other variants were present in at least one non-affected family member, suggesting incomplete penetrance. Thus, these variants may contribute to the development of craniosynostosis, and should not be discarded as potential candidate genes in the diagnosis of this condition.


Subject(s)
Humans , Child , Craniosynostoses/genetics , Transcription Factors/genetics , Base Sequence , Family , Cross-Sectional Studies , Mutation, Missense/genetics , DNA-Binding Proteins/genetics
14.
Braz. j. otorhinolaryngol. (Impr.) ; 86(3): 370-375, May-June 2020. tab, graf
Article in English | LILACS | ID: biblio-1132588

ABSTRACT

Abstract Instruction: Noise-induced hearing loss is a leading occupational disease caused by gene-environment interaction. The Grainy Like 2, GRHL2, is a candidate gene. In this regard, many studies have evaluated the association between GRHL2 and noise-induced hearing loss, although the results are ambiguous and conflicting. Objective: The purpose of this study was to identify a precise estimation of the association between rs3735715 polymorphism in GRHL2 gene and susceptibility of noise-induced hearing loss. Methods: A comprehensive search was performed to collect data up to July 8, 2018. Finally, 4 eligible articles were included in this meta-analysis comprising 2410 subjects. The pooled odds ratios with 95% confidence intervals were used to evaluate the strength of the association. Results: Significant association was found in the overall population in the dominant model (GA/AA vs. GG, odds ratio = 0.707, 95% confidence interval = 0.594-0.841) and allele model (G allele vs. A allele, odds ratio = 1.189, 95% confidence interval = 1.062-1.333). When stratified by source of the subjects, we also found association between rs3735715 and noise-induced hearing loss risk in the dominant model (GA/AA vs. GG, odds ratio = 0.634, 95% confidence interval = 0.514-0.783) and allele model (G allele vs. A allele, odds ratio = 1.206, 95% confidence interval = 1.054-1.379). Conclusion: Rs3735715 polymorphism in GRHL2 gene may influence the susceptibility of noise-induced hearing loss. Additional large, well-designed and functional studies are needed to confirm this association in different populations.


Resumo Introdução: Perda auditiva induzida por ruído é uma das principais doenças ocupacionais causadas pela interação gene-ambiente. O Grainy Like 2, ou GRHL2 é um gene que tem sido considerado como candidato. Nesse sentido, muitos estudos avaliaram a associação entre o GRHL2 e perda auditiva induzida por ruído, embora os resultados sejam ambíguos e conflitantes. Objetivo: Identificar uma estimativa precisa da associação entre o polimorfismo rs3735715 no gene GRHL2 e a suscetibilidade à perda auditiva induzida por ruído. Método: Uma pesquisa abrangente foi feita para coletar dados até 8 de julho de 2018. No fim, quatro artigos elegíveis foram incluídos nesta metanálise, abrangeram 2.410 indivíduos. As odds ratios agrupadas com intervalos de confiança de 95% foram usadas para avaliar a força da associação. Resultados: Uma associação significante foi encontrada na população geral no modelo de dominância (GA/AA vs. GG, odds ratio = 0,707, intervalo de confiança 95% = 0,594-0,841) e modelo de alelo (alelo G vs. alelo A; odds ratio = 1,189, intervalo de confiança 95% = 1,062 a 1,333). Quando estratificados pelo local de trabalho dos indivíduos, também encontramos associação entre rs3735715 e risco de perda auditiva induzida por ruído no modelo de dominância (GA/AA vs. GG, odds ratio = 0,634, intervalo de confiança 95% = 0,514 ± 0,783) e modelo de alelo (alelo G vs. alelo A; odds ratio = 1,206, intervalo de confiança 95% = 1,054- 1,379). Conclusão: O polimorfismo Rs3735715 no gene GRHL2 pode influenciar a suscetibilidade à perda auditiva induzida por ruído. Estudos adicionais, amplos, bem desenhados e funcionais são necessários para confirmar essa associação em diferentes populações.


Subject(s)
Humans , Transcription Factors/genetics , Genetic Predisposition to Disease/genetics , Polymorphism, Single Nucleotide/genetics , DNA-Binding Proteins/genetics , Hearing Loss, Noise-Induced/genetics , Genotype , Noise, Occupational/adverse effects , Occupational Diseases/genetics
15.
Mem. Inst. Oswaldo Cruz ; 115: e190457, 2020. tab, graf
Article in English | SES-SP, LILACS, SES-SP | ID: biblio-1135252

ABSTRACT

BACKGROUND Imitation SWItch (ISWI) ATPase is the catalytic subunit in diverse chromatin remodeling complexes. These complexes modify histone-DNA interactions and therefore play a pivotal role in different DNA-dependent processes. In Trypanosoma cruzi, a protozoan that controls gene expression principally post-transcriptionally, the transcriptional regulation mechanisms mediated by chromatin remodeling are poorly understood. OBJECTIVE To characterise the ISWI remodeler in T. cruzi (TcISWI). METHODS A new version of pTcGW vectors was constructed to express green fluorescent protein (GFP)-tagged TcISWI. CRISPR-Cas9 system was used to obtain parasites with inactivated TcISWI gene and we determined TcISWI partners by cryomilling-affinity purification-mass spectrometry (MS) assay as an approximation to start to unravel the function of this protein. FINDINGS Our approach identified known ISWI partners [nucleoplasmin-like protein (NLP), regulator of chromosome condensation 1-like protein (RCCP) and phenylalanine/tyrosine-rich protein (FYRP)], previously characterised in T. brucei, and new components in TcISWI complex [DRBD2, DHH1 and proteins containing a domain characteristic of structural maintenance of chromosomes (SMC) proteins]. Data are available via ProteomeXchange with identifier PXD017869. MAIN CONCLUSIONS In addition to its participation in transcriptional silencing, as it was reported in T. brucei, the data generated here provide a framework that suggests a role for TcISWI chromatin remodeler in different nuclear processes in T. cruzi, including mRNA nuclear export control and chromatin compaction. Further work is necessary to clarify the TcISWI functional diversity that arises from this protein interaction study.


Subject(s)
Animals , Transcription Factors/genetics , Trypanosoma cruzi/genetics , Adenosine Triphosphatases/genetics , Chromatin Assembly and Disassembly/genetics , Gene Expression Regulation , Blotting, Western , Flow Cytometry
16.
Biol. Res ; 53: 23, 2020. tab, graf
Article in English | LILACS | ID: biblio-1124208

ABSTRACT

BACKGROUND: Abscisic acid-, stress-, and ripening-induced (ASR) genes are a class of plant specific transcription factors (TFs), which play important roles in plant development, growth and abiotic stress responses. The wheat ASRs have not been described in genome-wide yet. METHODS: We predicted the transmembrane regions and subcellular localization using the TMHMM server, and Plant-mPLoc server and CELLO v2.5, respectively. Then the phylogeny tree was built by MEGA7. The exon-intron structures, conserved motifs and TFs binding sites were analyzed by GSDS, MEME program and PlantRegMap, respectively. RESULTS: In wheat, 33ASR genes were identified through a genome-wide survey and classified into six groups. Phylogenetic analyses revealed that the TaASR proteins in the same group tightly clustered together, compared with those from other species. Duplication analysis indicated that the TaASR gene family has expanded mainly through tandem and segmental duplication events. Similar gene structures and conserved protein motifs of TaASRs in wheat were identified in the same groups. ASR genes contained various TF binding cites associated with the stress responses in the promoter region. Gene expression was generally associated with the expected group-specific expression pattern in five tissues, including grain, leaf, root, spike and stem, indicating the broad conservation of ASR genes function during wheat evolution. The qRT-PCR analysis revealed that several ASRs were up-regulated in response to NaCl and PEG stress. CONCLUSION: We identified ASR genes in wheat and found that gene duplication events are the main driving force for ASR gene evolution in wheat. The expression of wheat ASR genes was modulated in responses to multiple abiotic stresses, including drought/osmotic and salt stress. The results provided important information for further identifications of the functions of wheat ASR genes and candidate genes for high abiotic stress tolerant wheat breeding.


Subject(s)
Stress, Physiological/genetics , Triticum/genetics , Abscisic Acid/analysis , Genome, Plant/genetics , Evolution, Molecular , Droughts , Phylogeny , Transcription Factors/genetics , Triticum/classification , Gene Expression Regulation, Plant , Real-Time Polymerase Chain Reaction
17.
Electron. j. biotechnol ; 40: 65-70, July. 2019. ilus
Article in English | LILACS | ID: biblio-1053486

ABSTRACT

Background: In Saccharomyces cerevisiae, Msn2, which acts as a key transcription factor downstream the MAPKHOG cascade pathway, also regulates the expression of genes related to stress responses. However, little is known about the regulation mechanisms of the transcription factor in Setosphaeria turcica. Results: In this study, a zinc finger DNA-binding protein, designated as StMSN2, was cloned from S. turcica. Sequencing results showed that StMSN2 had a 1752 bp open reading frame (ORF), which was interrupted by an intron (135 bp) and encoded a putative 538-amino acid protein. Phylogenetic analysis further revealed that StMsn2 was more closely related to Msn2 of Aspergillus parasiticus. StMSN2 was cloned into the pET-28a vector with His (Histidine) tags and induced with 1 mM IPTG (isopropyl-ß-D-thiogalactoside) at 37°C. The recombinant His-tagged StMsn2 was purified, and a band of size approximately 58.8 kDa was obtained. The high specificity of the polyclonal antibody Msn2-2 was detected with the StMsn2 protein from S. turcica and prokaryotic expression system, respectively. Conclusions: A new gene, named StMSN2, with 1617 bp ORF was cloned from S. turcica and characterized using bioinformatics methods. StMsn2 was expressed and purified in a prokaryotic system. A polyclonal antibody, named Msn2-2, against StMsn2 with high specificity was identified.


Subject(s)
Plant Diseases , Ascomycota/genetics , Ascomycota/pathogenicity , Transcription Factors/isolation & purification , Ascomycota/metabolism , Stress, Physiological , Transcription Factors/genetics , Transcription Factors/metabolism , Carrier Proteins , Gene Expression , Blotting, Western , Open Reading Frames , Zinc Fingers , Cloning, Molecular , Zea mays , Escherichia coli , Helminthosporium , Epitopes
18.
Rev. chil. infectol ; 36(3): 312-317, jun. 2019. tab, graf
Article in Spanish | LILACS | ID: biblio-1013789

ABSTRACT

Resumen Introducción. Los factores de virulencia de las cepas de Vibrio cholerae no-O1, no-O139 no son claramente conocidos. La cepa de origen septicémico NN1 Vibrio cholerae no-O1, no-O139 fue secuenciada previamente mediante la plataforma Illumina, detectándose en su genoma un fragmento de la isla de patogenicidad VPaI-7 de V. parahaemolyticus. Objetivo: detectar los genes de virulencia vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF en cepas chilenas clínicas de V. cholerae no-O1, no-O139. Material y Métodos: Un total de 9 cepas chilenas de origen clínico de Vibrio cholerae no-O1, no-O139 aisladas entre 2006-2012 fueron analizadas mediante ensayos de reacción de polimerasa en cadena (RPC, en inglés PCR) convencional para los genes de secreción tipo III codificados en dicha isla: vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF. Adicionalmente se determinó la presencia de los genes de virulencia hylA y rtxA. Además, se realizaron ensayos de repetitive element palindromic PCR (REP-PCR) y Enterobacterial repetitive intergenic consensus PCR (ERIC-PCR). Resultados: la mayoría (6/9) de las cepas chilenas de V. cholerae no-O1, no-O139 contiene todos los genes de secreción tipo III vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF, codificados en una isla de patogenicidad. Además, el total de las cepas (9/9) contiene los genes de virulencia hylA y rtxA. Conclusión: Estos resultados sugieren fuertemente la posibilidad que dichas cepas posean un potencial de virulencia importante en seres humanos.


Backgound: The virulence factors of the Vibrio cholerae non-O1, non-O139 strains are not clearly known. The strain of septicemic origin NN1 Vibrio cholerae non-O1, non-O139 was sequenced previously by the Illumina platform. A fragment of the pathogenicity island VPaI-7 of V. parahaemolyticus was detected in its genome. Aim: To detect the virulence genes vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF in Chilean strains of V. cholerae non-O1, non-O139. Methods: A total of 9 Chilean strains of clinical origin of Vibrio cholerae non-O1, non-O139 isolated between 2006-2012 were analyzed by conventional PCR assays for type III secretion genes encoded on that island: vcsN2, vcsC2, vcsV2, vspD, toxR2 and vopF. Additionally, the presence of the virulence genes hylA and rtxA was determined. In addition, REP-PCR and ERIC-PCR assays were performed. Results: most (6/9) Chilean V. cholerae non-O1, non-O139 strains contain the type III secretion genes vcsN2, vcsC2, vcsV2, vspD, toxR2 and vopF, encoded in an island of pathogenicity. In addition, all (9/9) the strains contain the virulence genes hylA and rtxA. Conclusion: These results strongly suggest the possibility that those strains possess an important virulence potential in humans.


Subject(s)
Humans , Bacterial Proteins/genetics , Transcription Factors/genetics , Vibrio cholerae/genetics , Virulence Factors/genetics , Vibrio cholerae non-O1/genetics , Genomic Islands/genetics , DNA-Binding Proteins/genetics , Type III Secretion Systems/genetics , Bacterial Toxins/genetics , Vibrio cholerae/isolation & purification , Vibrio cholerae/pathogenicity , Chile , Polymerase Chain Reaction , Sequence Analysis, DNA , Vibrio cholerae non-O1/isolation & purification , Vibrio cholerae non-O1/pathogenicity , Hemolysin Proteins/genetics
19.
Electron. j. biotechnol ; 39: 74-81, may. 2019. tab, ilus, graf
Article in English | LILACS | ID: biblio-1052041

ABSTRACT

Background: CPEB is considered as an RNA-binding protein first identified in Xenopus oocytes. Although CPEB1 was involved in the growth of oocyte, its role in goat follicular granulosa cell has not been fully elucidated. To clarify the functions of this gene in goat follicular granulosa cells, CPEB1-overexpressing vector and interference vector were structured and transfected into follicular granulosa cells from Jiangsu native white goats of Nantong city, Jiangsu Province, China. The expression levels of differentiation-related genes including CDK1, Cyclin B1, and C-mos were determined 24 h after administration of CPEB1 by quantitative real-time polymerase chain reaction and Western blotting methods. Results: The expression levels of CDK1, Cyclin B1, and C-mos were significantly upregulated after overexpression and significantly downregulated after interference with CPEB1. Conclusions: The CPEB1 gene expression could affect the transcription of genes related to early cleavage divisions, which provided a reference for further research on its role in the growth and maturation of oocytes.


Subject(s)
Animals , Female , Oocytes , Transcription Factors/genetics , Goats/genetics , Transfection , Fertilization in Vitro , Gene Expression , Blotting, Western , Polymerase Chain Reaction/methods , RNA-Binding Proteins , Embryo Transfer , Livestock , Fluorescence , Granulosa Cells
20.
Braz. j. med. biol. res ; 52(6): e8424, 2019. tab, graf
Article in English | LILACS | ID: biblio-1001535

ABSTRACT

Although rare, CALM/AF10 is a chromosomal rearrangement found in immature T-cell acute lymphoblastic leukemia (T-ALL), acute myeloid leukemia, and mixed phenotype acute leukemia of T/myeloid lineages with poor prognosis. Moreover, this translocation is detected in 50% of T-ALL patients with gamma/delta T cell receptor rearrangement, frequently associated with low expression of transcription factor CCAAT/enhancer-binding protein alpha (CEBPA). However, the relevance of CEBPA low expression for CALM/AF10 leukemogenesis has not yet been evaluated. We generated double mutant mice, which express the Lck-CALM/AF10 fusion gene and are haploinsufficient for the Cebpa gene. To characterize the hematopoiesis, we quantified hematopoietic stem cells, myeloid progenitor cells, megakaryocyte-erythrocyte progenitor cells, common myeloid progenitor cells, and granulocyte-macrophage progenitor cells. No significant difference was detected in any of the progenitor subsets. Finally, we tested if Cebpa haploinsufficiency would lead to the expansion of Mac-1+/B220+/c-Kit+ cells proposed as the CALM/AF10 leukemic progenitor. Less than 1% of bone marrow cells expressed Mac-1, B220, and c-Kit with no significant difference between groups. Our results showed that the reduction of Cebpa gene expression in Lck-CALM/AF10 mice did not affect their hematopoiesis or induce leukemia. Our data corroborated previous studies suggesting that the CALM/AF10 leukemia-initiating cells are early progenitors with lymphoid/myeloid differentiating potential.


Subject(s)
Animals , Rabbits , Leukemia, Myeloid, Acute/genetics , CCAAT-Enhancer-Binding Protein-alpha/genetics , Haploinsufficiency/genetics , Hematopoiesis/genetics , Phenotype , Transcription Factors/genetics , Translocation, Genetic/genetics , Mice, Transgenic , Acute Disease , Flow Cytometry , Genotype
SELECTION OF CITATIONS
SEARCH DETAIL