Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 6 de 6
Filtrar
Añadir filtros








Intervalo de año
1.
Indian J Biochem Biophys ; 1997 Dec; 34(6): 494-500
Artículo en Inglés | IMSEAR | ID: sea-27035

RESUMEN

The effects of phytohormones on plastid tRNA modifications were investigated in ragi (Eleucine coracana) coleoptiles. Intact 7-day old dark-grown ragi seedlings were given phytohormone, indoleacetic acid (IAA) or isopentenyladenine (i6A) treatment and grown in the dark or under white fluorescent light; coleoptiles were harvested 24 hr following treatment, and plastid total tRNAs were isolated and analyzed for their content of modified nucleotides. A total of 14 modified nucleotides were identified in the total digests of ragi plastid total tRNA preparations; significant increases in the content of some modified nucleotides were observed following treatment of phytohormones in the dark and light. The relative amounts of pT, pm1G, pm7G and pm1A in IAA-treated dark-grown, pi6A, pm2G and pCm in IAA-treated light-grown, and pT and pm2G in i6A-treated light-grown ragi coleoptiles were 2 to 10 times higher than the untreated control coleoptile plastid total tRNA. In order to gain a better understanding of the effects of phytohormones on ragi plastid tRNA modifications, we purified plastid tRNA(Ile)(GAU) from coleoptiles of the aforementioned ragi seedlings and analyzed its modifed nucleotide content. We find that the content of pGm was 4 to 5 times higher in the tRNA(Ile)(GAU) purified from i6A- or IAA-treated dark-grown coleoptiles, and pm7G was 5 to 6 times higher in the tRNA(Ile)(GAU) of i6A-treated light-grown ragi coleoptiles. These results suggest that the synthesis or activity of some plastid-specific tRNA-modifying enzymes may be enhanced by i6A and IAA with two different modes of regulation, one operating in the light and the other operating in the dark.


Asunto(s)
Oscuridad , Luz , Reguladores del Crecimiento de las Plantas/farmacología , Plantas/química , Plastidios/química , ARN de Planta/química , ARN de Transferencia/química , Ribonucleótidos/análisis
2.
J Biosci ; 1997 Mar; 22(2): 143-147
Artículo en Inglés | IMSEAR | ID: sea-161104

RESUMEN

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

3.
Indian J Biochem Biophys ; 1996 Dec; 33(6): 448-54
Artículo en Inglés | IMSEAR | ID: sea-28562

RESUMEN

The nucleotide sequence of a 714 bp BamHI-EcoRI fragment of cucumber chloroplast DNA was determined. The fragment contained a gene for tRNA(Leu) together with its flanking regions. The trnL(CAA) gene sequence is about 99% in similarity to broad bean, cauliflower, maize, spinach and tobacco corresponding genes. The relative expression level of the gene was determined by Northern (tRNA) gel blot and Northern (total cellular RNA) slot-blot analyses using the trnL gene probe in 6-day old etiolated cucumber seedlings and the seedlings that had been kept in the dark (dark-grown), treated with benzyladenine (BA) and kept in the dark (BA-treated dark-grown), illuminated (light-grown), and treated with BA and illuminated (BA-treated light-grown), for additional 4, 8 or 12 hr. The trnL transcripts and tRNA(Leu) levels in BA-treated dark-grown seedlings were 5 and 3 times higher, respectively after 4 hr BA treatment, while in the BA treated light-grown seedlings the level of trnL transcripts was only 3 times higher and had no detectable effect on mature tRNA(Leu) when compared to the time-4 hr dark-grown seedlings. However, the level of mature tRNA(Leu) did not show marked changes in the light-grown seedlings, whereas the level of trnL transcripts increases 3 times after 8 hr illumination of dark-grown seedlings. These data indicate that both light and cytokinin can signal changes in plastid tRNA gene expression. The possible regulatory mechanisms for such changes are discussed.


Asunto(s)
Secuencia de Bases , Bencilaminas/farmacología , Northern Blotting , Clonación Molecular , Cucumis sativus/genética , ADN de Cloroplastos/química , ADN de Plantas/química , Regulación de la Expresión Génica de las Plantas/genética , Genes de Plantas , Luz , Datos de Secuencia Molecular , Conformación de Ácido Nucleico , ARN de Transferencia de Leucina/química
4.
Indian J Biochem Biophys ; 1994 Dec; 31(6): 454-8
Artículo en Inglés | IMSEAR | ID: sea-29087

RESUMEN

Total tRNAs isolated from N2- and NH4(+)-grown Azospirillum lipoferum cells were compared with respect to amino acid acceptance, isoacceptor tRNA species levels and extent of nucleotide modifications. Amino-acylation of these two tRNA preparations with ten different amino acids indicated differences in the relative acceptor activities. Comparison of aminoacyl-tRNA patterns by RPC-5 column chromatography revealed no qualitative differences in the elution profiles. However, quantitative differences in the relative amounts of some isoacceptors were observed. These results indicate that alterations of relative amounts of functional tRNA species occur to match cellular requirements of the bacterial cells using N2 or NH4+ as nitrogen source. In addition, the content of modified nucleotides in total tRNAs of N2- and NH4(+)-grown cells was determined. In the NH4(+)-grown cells, content of most of the modified nucleotides decreased significantly. Based upon these results, the relationship of chargeability of tRNAs to base modifications is discussed.


Asunto(s)
Acilación , Aminoácidos/metabolismo , Azospirillum/efectos de los fármacos , Nitrógeno/farmacología , Nucleótidos/metabolismo , Compuestos de Amonio Cuaternario/farmacología , Procesamiento Postranscripcional del ARN , ARN de Transferencia/metabolismo
5.
J Biosci ; 1988 Dec; 13(4): 367-378
Artículo en Inglés | IMSEAR | ID: sea-160693

RESUMEN

The effect of light on nucleotide modifications in the tRNA of cucumber (Cucumis sativus L. var. Guntur) cotyledons was studied by chromatographic, electrophoretic and immunological methods. The tRNA from light-grown tissue showed the absence of 2-methylguanosine and a decrease in the relative proportions of ribothymidine and cytokinin-active ribonucleosides when compared to those produced from dark-grown tissue. On the other hand, a significant amount of one species of 2'-O-methyldinucleotide was observed in the tRNA of light-grown tissue which was not detected in the dark-grown tissue. Also, tRNA from light-grown tissue had higher levels of another species of 2'-Omethyldinucleotide. The results showed no difference in the amounts of other modified nucleosides in tRNA between tissues grown under the two conditions. 2'-O-Methyl-lmethyladenosine, a nucleotide modified both in the base and the ribose, apparently specific to plant tRNAs, has been found to be present in the RNA of both light- and dark-grown tissues. These results on the variation in modified nucleotides suggest that light has some role in nucleotide modification and, consequently, in cellular functions.

6.
J Biosci ; 1981 Sept; 3(3): 269-274
Artículo en Inglés | IMSEAR | ID: sea-160154

RESUMEN

A cytokinin-binding protein fraction was isolated from normal rabbit sera by affinity chromatography. The protein fraction bound tritium labelled N6- (Δ2-risopentenyl) adenosine and the order of inhibition of this binding by competing non-radioactive compounds was, N6-(Δ2-isopentenyl) adenosine >N6-benzyIadenosine >zeatin-riboside >N6-(Δ2-isopentenyl) adenine >kinetin riboside >adenosine. The protein fraction showed broad specificity, the prefered cytokinin being N6-(Δ2-isopentenyl) adenosine. This is the first report of the isolation of cytokinin binding proteins from mammalian sources.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA