RESUMEN
OBJECTIVE@#To observe the clinical efficacy of scalp acupuncture for spastic cerebral palsy (CP), and to explore its possible mechanism based on brain white matter fiber bundles, nerve growth related proteins and inflammatory cytokines.@*METHODS@#A total of 90 children with spastic CP were randomly divided into a scalp acupuncture group and a sham scalp acupuncture group, 45 cases in each group. The children in the two groups were treated with conventional comprehensive rehabilitation treatment. The children in the scalp acupuncture group were treated with scalp acupuncture at the parietal temporal anterior oblique line, parietal temporal posterior oblique line on the affected side, and parietal midline. The children in the sham scalp acupuncture group were treated with scalp acupuncture at 1 cun next to the above point lines. The needles were kept for 30 min, once a day, 5 days a week, for 12 weeks. Before and after treatment, the diffusion tensor imaging (DTI) indexes of magnetic resonance (FA values of corticospinal tract [CST], anterior limb of internal capsule [ICAL], posterior limb of internal capsule [ICPL], genu of internal capsule [ICGL], genu of corpus callosum [GCC], body of corpus callosum [BCC] and splenium of corpus callosum [SCC]), serum levels of nerve growth related proteins (neuron-specific enolase [NSE], glial fibrillary acidic protein [GFAP], myelin basic protein [MBP], ubiquitin carboxy terminal hydrolase-L1 [UCH-L1]) and inflammatory cytokines (interleukin 33 [IL-33], tumor necrosis factor α [TNF-α]), cerebral hemodynamic indexes (mean blood flow velocity [Vm], systolic peak flow velocity [Vs] and resistance index [RI], pulsatility index [PI] of cerebral artery), surface electromyography (SEMG) signal indexes (root mean square [RMS] values of rectus femoris, hamstring muscles, gastrocnemius muscles, tibialis anterior muscles), gross motor function measure-88 (GMFM-88) score, modified Ashworth scale (MAS) score, ability of daily living (ADL) score were observed in the two groups. The clinical effect of the two groups was compared.@*RESULTS@#After treatment, the FA value of each fiber bundle, Vm, Vs, GMFM-88 scores and ADL scores in the two groups were higher than those before treatment (P<0.05), and the above indexes in the scalp acupuncture group were higher than those in the sham scalp acupuncture group (P<0.05). After treatment, the serum levels of NSE, GFAP, MBP, UCH-L1, IL-33, TNF-α as well as RI, PI, MAS scores and RMS values of each muscle were lower than those before treatment (P<0.05), and the above indexes in the scalp acupuncture group were lower than those in the sham scalp acupuncture group (P<0.05). The total effective rate was 95.6% (43/45) in the scalp acupuncture group, which was higher than 82.2% (37/45) in the sham scalp acupuncture group (P<0.05).@*CONCLUSION@#Scalp acupuncture could effectively treat spastic CP, improve the cerebral hemodynamics and gross motor function, reduce muscle tension and spasticity, and improve the ability of daily life. The mechanism may be related to repairing the white matter fiber bundles and regulating the levels of nerve growth related proteins and inflammatory cytokines.
Asunto(s)
Niño , Humanos , Parálisis Cerebral/terapia , Interleucina-33 , Imagen de Difusión Tensora/métodos , Cuero Cabelludo , Espasticidad Muscular , Factor de Necrosis Tumoral alfa , Terapia por Acupuntura , CitocinasRESUMEN
OBJECTIVE@#To observe the effect of @*METHODS@#A total of 60 children with intellectual disability were randomly divided into an observation group (30 cases, 2 cases dropped off) and a control group (30 cases, 2 cases dropped off). In the control group, rehabilitation training and routine acupuncture were adopted, 30 min each time, once a day, 6 times a week for 3 months. On the base of the treatment as the control group, @*RESULTS@#Compared before treatment, the scores of DQ and ADL and the serum levels of DA, NE, 5-HT after treatment were increased (@*CONCLUSION@#On the base of rehabilitation training and routine acupuncture,
Asunto(s)
Niño , Humanos , Actividades Cotidianas , Puntos de Acupuntura , Terapia por Acupuntura , Discapacidad Intelectual , Agujas , Neurotransmisores , Resultado del TratamientoRESUMEN
This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcripts and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcripts and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcripts were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.
Asunto(s)
Animales , Ratones , Médula Ósea , Virología , Infecciones por Citomegalovirus , Ratones Endogámicos BALB C , Monocitos , Virología , Muromegalovirus , Fisiología , Proteínas Proto-Oncogénicas c-kit , Células Madre , VirologíaRESUMEN
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
Asunto(s)
Animales , Agkistrodon , Genética , Secuencia de Aminoácidos , Secuencia de Bases , Clonación Molecular , Venenos de Crotálidos , Genética , ADN Complementario , Química , Genética , Escherichia coli , Genética , Metaloendopeptidasas , Genética , Datos de Secuencia Molecular , Proteínas Recombinantes , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Análisis de Secuencia de ADN , Homología de Secuencia de Ácido Nucleico , Trombina , GenéticaRESUMEN
Virus inactivation of plasma can be achieved by methylene blue/photochemical method. To investigate the effect of this method on immunological properties and biochemical functions of plasma components, the virus-inactivation method was performed on single-donor plasma that was exposed to visible light (40,000 lux) at room temperature for 1 h in the presence of 1 micro mol/L methylene blue. The results showed that activities of the factor VIII, PT and APTT were decreased to a certain degree while most of other plasma proteins were not affected significantly. Human plasma components including albumin, glucose and minerals as well as plasma pH were also not affected. By using different electrophoreses and immunochemical techniques, no neoantigens were found in photodynamically treated plasma and electrophoretic mobility revealed identical patterns for untreated and treated plasma. In conclusion, methylene blue/photochemical method dose not considerably influence the properties of major of plasma components.