Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 3 de 3
Filtrar
Añadir filtros








Intervalo de año
1.
Artículo en Chino | WPRIM | ID: wpr-1009323

RESUMEN

OBJECTIVE@#To explore the disease spectrum for abnormal 3-hydroxyisovalerylcarnitine (C5OH) metabolism identified through newborn screening and clinical diagnosis patients and the key points for differential diagnosis so as to raise the awareness of pediatricians for such diseases.@*METHODS@#Clinical data of 85 neonates with abnormal C5OH metabolism identified from February 2004 to January 2022 at Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine were collected. Their clinical manifestations and results of tandem mass spectrometry (MS/MS), gas chromatography mass spectrometry (GC-MS) and genetic testing were retrospectively analyzed.@*RESULTS@#Among the 85 cases, 46 (54.1%) were identified by neonate screening, whilst 39 (45.9%) were clinically diagnosed patients. Five diseases were diagnosed, including 28 cases with multiple carboxylase deficiency (MCD, 32.9%), 29 cases with 3-methylcrotonyl-coenzymeAcarboxylasedeficiency (MCCD, 34.1%), 4 cases with 3-methylglutaconic acid (3-MGA, 4.7%), 7 cases with 3-hydroxy-3-methylglutaric acid (3-HMG, 8.2%), and 17 cases with beta-ketothiolase deficiency (BKD, 20.0%). The disorders were characterized by sudden onset, anorexia, vomiting, diarrhea, abnormal breathing, consciousness disorder, spasm and developmental delay.@*CONCLUSION@#Among newborns with abnormal C5OH metabolism, MCCD is the most common disorder, which was followed by BKD and MCD. For patients with abnormal C5OH metabolism, MCD is the most common, followed by BKD and 3-HMG. C5OH related diseases have great heterogeneity. Combination of blood acylcarnitine levels, urinary organic acid levels and genetic testing based on clinical characteristics can help to attain the diagnosis.


Asunto(s)
Humanos , Recién Nacido , China , Tamizaje Neonatal , Estudios Retrospectivos , Espectrometría de Masas en Tándem/métodos
2.
Artículo en Chino | WPRIM | ID: wpr-344207

RESUMEN

<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>


Asunto(s)
Adulto , Anciano , Femenino , Humanos , Masculino , Persona de Mediana Edad , Genes de la Neurofibromatosis 2 , Mutación , Neurilemoma , Genética , Neoplasias de la Médula Espinal , Genética
3.
Cancer Research and Clinic ; (6): 253-255, 2015.
Artículo en Chino | WPRIM | ID: wpr-473090

RESUMEN

Objective To clarify the expression and clinicopathological significances of mTOR and Merlin proteins in spinal schwannoma.Methods Immunohistochemical SP method was used to detect the expression levels of mTOR and Merlin proteins in tumor tissues from 21 spinal schwannoma patients.The meaning of the two proteins expression changes on schwannoma was analyzed.Results In 21 cases of schwannoma patients,the mTOR was positive expression in 16 cases,negative expression in 5 cases,while in the normal neural tissue,mTOR was all negative expression.In 21 cases of schwannoma patients,the Merlin protein was negative expression in 18 cases,positive expression in 3 cases,but it was positive in all of normal neural tissue.Merlin protein expression was negatively correlated with mTOR protein expression (r =-0.785,P < 0.001).Conclusion The expression level of mTOR proteins in schwannoma is significantly higher than that in normal nerve tissue,while the expression level of Merlin protein in schwannoma tissue is significantly lower than that in normal nerve tissue.There is an internal relationship between mTOR and Merlin.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA