RESUMEN
Objective To characterize the epidemic status and treatment outcomes of tuberculosis(TB)from 2008 to 2017 in Songjiang District of Shanghai for the development of TB prevention and control strategies. Methods According to case registration data in the TB management information system, statistical analysis was performed on the epidemic situation, epidemiological characteristics and treatment outcomes of TB cases in Songjiang District from 2008 to 2017. Results There were 5 516 reported cases in 2008-2017 in Songjiang District. The average annual reported incidence was 33.58/100 000, which was declining(χ2 = 6.13, P < 0.05). The incidence was significantly higher in the floating population than that in the household registered population(χ2 = 263.28, P < 0.05). In the cases, gender ratio was 2.17 : 1. More than 70% of the cases were between 15 and 44 years old. The majority of the cases were workers(34.95%), followed by housework or unemployed(16.28%). The proportion of TB case responding to the treatment was 93.38%, which was 93.41% for newly diagnosed cases and 92.86% for previously treated cases. The failure rate in the previously treated smear-positive cases was significantly higher than newly treated smear-positive cases(χ2 = 4.96, P < 0.05). Conclusion TB epidemic in Songjiang District remained at a low level in 2008-2017;however, it is far away from the termination of TB. We should further strengthen the prevention and control of TB, especially in the 15-44 years old workers and unemployed young population.
RESUMEN
Purpose To explore the effects of ploidy analysis on thoracic neoplasms based on DNA image cytometry (DNA-ICM), and to look for a meaningful novel diagnostic assay for tumor patients. Methods 4 402 patients who were diagnosed with thoracic disease were recruited in 2 years. By the DNA-ICM analysis, all the specimens were diagnosed as three types——positive, equivocal and negative ones. The results of701 specimens were compared with biopsy and clinical followup. Results DNA aneuploidy detected by DNA-ICM were65% in confirmed malignant samples, 64% in equivocal malignancy, and 8% in non-malignant diseases. The comprehensive performance of DNA-ICM in malignancy was 73%, 93%, 71%, 94% respectively for sensitivity, specificity, positive predictive value and negative predictive value. OR analysis found that the risk ratio of aneuploidy in malignancy was 23.236 compared to non-malignancy. Conclusion DNA-ICM can be applied in thoracic malignancy and have more potential values to be explored in oncology.
RESUMEN
Student contacts of tuberculosis (TB) cases are susceptible to latent tuberculosis infection (LTBI), and chemo-prophylaxis can reduce the risk of active TB among them. This study aimed to assess the acceptance of chemo-prophylaxis for LTBI among students, and their concerns regarding TB and its preventive treatment. A total of 560 students contacts were included in the investigation. The extent of contact was categorized from high to low (4 levels) with 12.9% of the students being close contacts. About 87.0% of the students were willing to receive chemo-prophylaxis if diagnosed with, LTBI, whereas 73 students declined. Students with a higher level of knowledge about TB (aOR = 1.11) or close contact with TB patients (aOR = 4.30) were more likely to accept treatment. To conclude, education regarding TB transmission is necessary. Moreover, LTBI detection should be integrated into the current school-based TB contact investigation.
Asunto(s)
Adolescente , Adulto , Femenino , Humanos , Masculino , Adulto Joven , Antituberculosos , Usos Terapéuticos , China , Epidemiología , Trazado de Contacto , Tuberculosis Latente , Quimioterapia , Epidemiología , Estudiantes , Tuberculosis Pulmonar , Quimioterapia , Epidemiología , UniversidadesRESUMEN
To evaluate the effects of glutamine-supplemented parenteral nutrition (PN) and probiotics in adult autoimmune enteropathy (AIE) patients. Four adult AIE patients were identified from April 2006 to January 2012. Clinical and nutritional data were obtained from the patients' medical records. Glutamine-supplemented PN started immediately when the AIE diagnosis was confirmed. The total PN duration was 351 days. According to the PN prescription, the average caloric intake ranged from 20 to 25 kcal/kg/day, and the protein intake ranged from 1.2 to 1.5 g/kg/day. Alanyl-glutamine (20 g/day) was administered to AIE patients for 4 weeks followed by a 2-week break, and this treatment schedule was repeated when PN lasted for more than 6 weeks. Body weight gain and an increased serum albumin level were achieved after PN, and defecation frequency and quality also improved. Each patient received oral supplements, 250 mL of Ensure and two probiotics capsules (each capsule containing 0.5x10(8) colonies) three times a day when enteral nutrition started. Three AIE patients were successfully weaned off PN, and one patient died of pneumonia. Glutamine-supplemented PN and probiotics show promise in managing patients with AIE and related malnutrition.
Asunto(s)
Adulto , Femenino , Humanos , Masculino , Adulto Joven , Bifidobacterium , Enterococcus faecalis , Glutamina/administración & dosificación , Lactobacillus acidophilus , Tiempo de Internación , Desnutrición/terapia , Nutrición Parenteral/métodos , Poliendocrinopatías Autoinmunes/terapia , Probióticos/administración & dosificaciónRESUMEN
<p><b>OBJECTIVE</b>To identify spatial distribution and risk factors among tuberculosis (TB) cases in Songjiang district, Shanghai, 2006 - 2009.</p><p><b>METHODS</b>All active TB cases and all bacteriologically confirmed TB cases diagnosed during the period from 2006 to 2009 were recruited into the study. Spatial scan statistics were used to identify spatial clusters. Using logistic regression, we compared the demographic and clinical characteristics of TB cases in spatial clusters versus TB cases not in spatial clusters.</p><p><b>RESULTS</b>A total of 1815 active TB cases and 730 bacteriologically confirmed TB cases were recruited during 2006 - 2009. Chedun township and Xinqiao township was detected to be a spatial cluste (RR = 1.38, LLR = 16.78, P < 0.01), which was the location of the municipal industrial zone. No spatial cluster was found during 2006 - 2007, while during 2008 - 2009 Chedun township was detected to be a spatial cluster (RR = 1.70, LLR = 15.06, P < 0.01). Among resident population, the spatial cluster of TB cases was located in the southwestern part of Songjiang district, which included five townships Xinbang, Shihudang, Xiaokunshan, Maogang and Yongfeng (RR = 1.49, LLR = 10.52, P < 0.01); while among migrant population, the spatial cluster of TB cases was located in Chedun township (RR = 1.55, LLR = 15.64, P < 0.01). There were higher proportions of resident TB cases who were farmers (AOR = 4.9, 95%CI: 1.9 - 12.3) or had other occupations (AOR = 2.6, 95%CI: 1.1 - 5.9) in the spatial cluster. There were higher proportions of migrant TB cases who lived here for less than 5 years (< 1 year: AOR = 5.9, 95%CI: 1.8 - 19.5; 1 - 5 years: AOR = 3.2, 95%CI: 1.0 - 9.9) or worked at other occupations (AOR = 2.8, 95%CI: 1.5 - 5.1) and lower proportions of migrant TB cases who came from Eastern region (AOR = 0.3, 95%CI: 0.1 - 0.8) or Middle region (AOR = 0.5, 95%CI: 0.3 - 0.9) in the spatial cluster.</p><p><b>CONCLUSION</b>In Songjiang district there was a spatial cluster in TB cases, which was Chedun township. Local residents with TB who were farmers or had other occupations were more likely to be in the spatial cluster. Migrants with TB who lived here for less than 5 years or came from Western region were more likely to be in the spatial cluster.</p>
Asunto(s)
Adulto , Anciano , Femenino , Humanos , Masculino , Persona de Mediana Edad , China , Epidemiología , Modelos Logísticos , Factores de Riesgo , Agrupamiento Espacio-Temporal , Migrantes , Tuberculosis , Epidemiología , Tuberculosis Pulmonar , EpidemiologíaRESUMEN
This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcripts and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcripts and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcripts were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.
Asunto(s)
Animales , Ratones , Médula Ósea , Virología , Infecciones por Citomegalovirus , Ratones Endogámicos BALB C , Monocitos , Virología , Muromegalovirus , Fisiología , Proteínas Proto-Oncogénicas c-kit , Células Madre , VirologíaRESUMEN
<p><b>OBJECTIVE</b>Spinal muscular atrophy (SMA) is one of common autosomal recessive diseases and is characterized by degeneration of the anterior horn cells of the spinal cord. The reported prevalence is 1/10,000 live births with a carrier rate of one in 50. It is important in genetic counseling to identify the carriers with one copy deletion for the survival motor neuron (SMN(1)) gene. However, the duplication of the SMA locus makes the detection of SMA carriers difficult. This study aimed to determine the potential of the quantitative PCR analysis in the identification of SMA carriers.</p><p><b>METHODS</b>The SMN(1) gene copy number was detected by realdouble ended arrowtime PCR with TaqMan technology in 109 SMA parents of affected children and 40 normal controls.</p><p><b>RESULTS</b>The average copy numbers of SMN(1) in the individuals with known one copy of the SMN(1) gene and with the two copies were 0.777 +/-0.035 (CV=4.5%) and 2.064 +/-0.120 (CV= 5.8%) respectively. The average copy number of SMN(1) in all of the parents with affected individuals was 0.798 +/-0.108 (CV=13.5%), and that of normal controls was 2.106 +/-0.18 (CV=8.5%). About 98% of SMA patients' parents carried 1 copy SMN(1), and 95% of normal controls carried 2 copies.</p><p><b>CONCLUSIONS</b>The gene copy numbers for SMN(1) were one and two for SMA carriers and non-carriers, respectively. Our results suggested that the quantitative PCR analysis can distinguish the SMN(1) deletion carriers from non-carriers.</p>
Asunto(s)
Femenino , Humanos , Masculino , Proteína de Unión a Elemento de Respuesta al AMP Cíclico , Genética , Dosificación de Gen , Tamización de Portadores Genéticos , Métodos , Atrofia Muscular Espinal , Genética , Proteínas del Tejido Nervioso , Genética , Reacción en Cadena de la Polimerasa , Métodos , Proteínas de Unión al ARN , Genética , Análisis de Regresión , Proteínas del Complejo SMNRESUMEN
<p><b>OBJECTIVE</b>To evaluate the prevalence of non-alcoholic fatty liver disease (NAFLD) and its related risk factors in children in Shanghai.</p><p><b>METHODS</b>A total of 1180 students aged 6 to 14 years (9.0+/-1.9) y from two elementary schools in the Pudong New Area were enrolled in our study, 572 were male and 608 were female. Height, body weight, waist circumference, hip circumference, waist-hip ratio (WHR), blood pressure were measured and liver ultrasound B scans were analyzed for each student. Body mass index (BMI) was calculated as body weight in kilograms divided by the square of height in meters.</p><p><b>RESULTS</b>Liver ultrasonic images were normal in 1155 students (97.9%), 18 students had mild fatty livers (1.5%) and 7 (0.6%) students had moderate fatty livers, while none of the students had severe fatty livers. Of all the NAFLD students, 19 were male and 6 were female. The prevalence of NAFLD in male students was obviously higher compared with that in female students (X2=6.66, P<0.05). The number of students with normal BMI was 934 (79.2%), while 137 (11.6%) and 109 (9.2%) respectively were overweight and obese, according to the age and gender specific BMI chart for Chinese children. The prevalence of NAFLD in students with normal BMI was 0.6% (6/934), while it was 2.9% (4/137) and 13.8% (15/109) in overweight and obese students. The prevalence of NAFLD in overweight and obese students was higher than that in students with normal BMI (X2=85.93, P<0.01). All the students were further divided into two groups based on age: group 1, 714 prepubertal students age 6 to 9 years; group 2, 466 students in puberty stage age 10 to 14 years. The prevalence of NAFLD was 1.7% (12/714) in group 1 and 2.8% (13/466) in group 2. There was no statistical difference between the two groups (X2=2.01), P>0.05. A stepwise multiple regression analysis was performed to evaluate the relationship between NAFLD and its related factors. BMI and WHR were chosen as predictors of NAFLD (x2=69.35), P<0.01.</p><p><b>CONCLUSION</b>Based on liver ultrasound, the prevalence of NAFLD is 2.1% of the 1180 surveyed school students age 6 to 14 years. The prevalence of NAFLD was obvious higher in overweight and obese students compared with that in students with normal BMI. Male students had more NAFLD than female students. BMI and WHR could be used as effective indexes to predict the occurrence of NAFLD.</p>
Asunto(s)
Adolescente , Niño , Femenino , Humanos , Masculino , Índice de Masa Corporal , China , Epidemiología , Hígado Graso , Epidemiología , Prevalencia , Factores de Riesgo , Estudiantes , Relación Cintura-CaderaRESUMEN
<p><b>OBJECTIVE</b>To detect the correlation between the clinical phenotype of spinal muscular atrophy (SMA) and survival motor neuron gene (SMN2) copy number.</p><p><b>METHODS</b>The SMN2 gene copy numbers of 57 different types of SMA were detected by real-time fluorescence quantitative PCR method with TaqMan technique.</p><p><b>RESULTS</b>Average SMN2 copy number was 1.017 +/- 0.090, 2.019+/- 0.080, 3.104+/- 0.170 in predicting one, two, three copy numbers, respectively, and CV was 8.9%, 3.9%, 5.4%, respectively. Average SMN2 copy number was 1.926+/- 0.460, 2.508+/- 0.460, 2.876+/- 0.270, in type I, II and III SMA, respectively. The SMN2 gene copy number in type II and III SMA were higher than that of type I SMA (P < 0.01). The SMN2 gene copy number in type III SMA was higher than that of type II SMA (P < 0.01). 85.72% of type I SMA patients usually had 2 SMN2 copies; 40% and 60% of type II SMA patients had 2 and 3 SMN2 copies, respectively; 82% of type III SMA patients had 3 SMN2 copies.</p><p><b>CONCLUSION</b>There is significant correlation between the change of SMA clinical phenotype and SMN2 cope number. The distributions of the SMN2 gene copy number are various in different types of SMA patients. All types of SMA patients have at least one copy SMN2. The SMN2 gene copy numbers in type II, III SMA are higher than that of type I. All of these findings suggest that the severity of SMA patients depend on the change of the SMN2 copy numbers.</p>
Asunto(s)
Humanos , Dosificación de Gen , Predisposición Genética a la Enfermedad , Genética , Atrofia Muscular Espinal , Genética , Patología , Fenotipo , Reacción en Cadena de la Polimerasa , Proteínas del Complejo SMN , Genética , Proteína 2 para la Supervivencia de la Neurona MotoraRESUMEN
The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.