RESUMEN
Background: Pore-forming proteins (PFP) are a class of toxins abundant in the venom of sea anemones. Owing to their ability to recognize and permeabilize cell membranes, pore-forming proteins have medical potential in cancer therapy or as biosensors. In the present study, we showed the partial purification and sequencing of a pore-forming protein from Anthopleura dowii Verrill (1869). 17. Methods: Cytolytic activity of A. dowii Verrill (1869) venom was determined via hemolysis assay in the erythrocytes of four mammals (sheep, goat, human and rabbit). The cytotoxic activity was analyzed in the human adherent lung carcinoma epithelial cells (A549) by the cytosolic lactate dehydrogenase (LDH) assay, and trypan blue staining. The venom was fractionated via ammonium sulfate precipitation gradient, dialysis, and ion exchange chromatography. The presence of a pore-forming protein in purified fractions was evaluated through hemolytic and cytotoxic assays, and the activity fraction was analyzed using the percent of osmotic protections after polyethylene glycol (PEG) treatment and mass spectrometry. 18. Results: The amount of protein at which the venom produced 50% hemolysis (HU50) was determined in hemolysis assays using erythrocytes from sheep (HU50 = 10.7 ± 0.2 µg), goat (HU50 = 13.2 ± 0.3 µg), rabbit (HU50 = 34.7 ± 0.5 µg), and human (HU50 = 25.6 ± 0.6 µg). The venom presented a cytotoxic effect in A549 cells and the protein amount present in the venom responsible for producing 50% death (IC50) was determined using a trypan blue cytotoxicity assay (1.84 ± 0.40 µg/mL). The loss of membrane integrity in the A549 cells caused by the venom was detected by the release of LDH in proportion to the amount of protein. The venom was fractionated; and the fraction with hemolytic and cytotoxic activities was analyzed by mass spectrometry. A pore-forming protein was identified. The cytotoxicity in the A549 cells produced by the fraction containing the pore-forming protein was osmotically protected by PEG-3350 Da molecular mass, which corroborated that the loss of integrity in the plasma membrane was produced via pore formation. 19. Conclusion: A. dowii Verrill (1869) venom contains a pore-forming protein suitable for designing new drugs for cancer therapy.(AU)
Asunto(s)
Humanos , Animales , Anémonas de Mar , Venenos de Cnidarios/aislamiento & purificación , Neoplasias Pulmonares/terapia , Venenos/toxicidad , Espectrometría de Masas/métodos , Células A549RESUMEN
Objetivo: Evaluar la capacidad de un sistema no comercial de amplificación directa por reacción en cadena de la polimerasa para identificar a Mycobacterium tuberculosis en pacientes con sospecha de tuberculosis pulmonar y baciloscopia positiva. Material y métodos: Se analizaron muestras de expectoración y líquido pleural por medio de amplificación directa por reacción en cadena de la polimerasa, utilizando las secuencias 5'CAGCCCGCTGGAGTCCCGCGGA3' y 5'GCGCGTTCACCATGGACACCG3'. Se utilizó como estándar de oro el cultivo en Lowenstein-Jensen.Resultados: Se incluyeron 79 pacientes consecutivos y un total de 212 especímenes. Utilizando el cultivo como estándar de oro, la sensibilidad de la reacción en cadena de la polimerasa en las muestras de expectoración fue de 97 por ciento, y su valor predictivo positivo de 57 por ciento. La reacción en cadena de la polimerasa fue positiva en 54 (98.18 por ciento) de los 55 casos con baciloscopia positiva en expectoración. Conclusión: La sensibilidad y el valor predictivo positivo de la secuencia utilizada para identificar a Mycobacterium tuberculosis en muestras de expectoración con baciloscopia positiva, son similares a la reportada en los estudios clínicos. Su aplicación permitirá identificar rápidamente a los pacientes infectados con micobacterias tuberculosas y distinguirlos de aquellos infectados por micobacterias no tuberculosas.