Occult Hepatitis B virus infection among Egyptian hepatitis C virus seropositive and seronegative hemodialysis patients in Sohag government, Upper Egypt

Background: Hepatitis B virus [HBV] and hepatitis C virus [HCV] Infections are important and common causes of liver disease in end-stage renal failure [ESRF] in patients on haemodialysis [HD]. HBV is less endemic than HCV in Egypt [ranges from 2%-7%]. Although, the prevalence of HBV in haemodialysis patients has decreased significantly due to HBV vaccine and screening of blood donors, the immunosuppressive nature of renal disease often leads to chronicity of the HBV infection and an opportunity for nosocomial spread of the infection among dialysis patients. Haemodialysis patients are more risky to develop occult hepatitis B infection [OBI] due to an increased number of blood transfusions, frequent invasive procedures, difficulty in diagnosis of occult hepatitis B infection [OBI] and immunosuppression. Occult hepatitis B infection [OBI] is defined by the presence of HBV DNA in serum or liver tissue in the absence of HBsAg

Objective: to study the prevalence of occult HBV infection in HCV-positive and HCV negative patients on regular hemodialysis from Upper Egypt

Methodology: One Hundred hemodialysis patients with negative HBsAg were included in the study. These patients were divided into two groups: HCV positive and HCV negative, based on the results of anti-HCV by ELISA and HCV-RNA by PCR. HBV-DNA was studied using the real-time PCR method in both groups

Results: HBV DNA was detected in 7 of the 100 patients [7%] and HBcAb was detected in 22 patients [22%]. There were no statistically significant differences in the age, sex, duration of hemodialysis, biochemical parameters, HBcAb, or HBV DNA between patients with and without HCV infection

Conclusion: The prevalence of occult HBV infection [OBI] among Egyptian hemodialysis patients is 7% with no significant difference in the prevalence of OBI between hemodialysis patients with or without HCV infection and we suggest screening of all HD patients for OBI by testing anti-HBc and HBV DNA

Diagnosis of pulmonary tuberculosis by polymerase chain reaction

A segment of DNA repeated in the chromosome of mycobacterium tuberculosis was sequenced and used as a target for amplification using polymerase chain reaction [PCR]. The sequences of the primers [5/ to 3/] were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG and a temperature of 68C was used for annealing the primers in the reaction. Amplification produced a 123-bp. fg with an internal restriction site. The PCR product was detected by gel electrophoresis after 35 cycles using 1 fg of input DNA. Amplification of this sequence may provide the basis for any assay to detect M. tuberculosis directly in clinical material