Effect of soluble PD-L1 released by lung cancer cells in regulating the function of T lymphocytes / 中华肿瘤杂志

<p><b>OBJECTIVE</b>To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes.</p><p><b>METHODS</b>Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation.</p><p><b>RESULTS</b>Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes.</p><p><b>CONCLUSIONS</b>Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.</p>

Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells / 中华肿瘤杂志

<p><b>OBJECTIVE</b>To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells.</p><p><b>METHODS</b>PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy.</p><p><b>RESULTS</b>The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference.</p><p><b>CONCLUSION</b>Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.</p>