RESUMEN
The 170 kDa plasma membrane, P-glycoprotein (Pgp), causes the efflux of chemotherapeutic drugs from cells and is believed to be an important mechanism in multidrug resistance (MDR) in human cancer. In this study, some well-know flavonoids from vegetables and fruit were tested for their potential ability to modulate the function of Pgp in the multidrug-resistant human cervical carcinoma cell line, KB-V1. The data demonstrated that kaempferol and daidzein stimulated vinblastine sensitivity of KB-V1 cells (P
RESUMEN
Abstract We investigated the chemopreventive action of dietary curcumin in male Swiss albino mice 7 with 12-dimethylbenz(a) anthracene (DMBA)-initiated and 12, 0-tetradecanoylphorbol-13-acetate (TPA)-promoted skin tumor formation. At 6 weeks of age, the groups of animals were fed the control diet (modified AIN-76A) or one containing 0.2% or 1% curcumin. At 8 weeks of age, all animals, except those in the vehicle (acetone)-treated groups, received 100 ?g of DMBA dissolved in 100 ?l of acetone in a single application to the skin on their back. From 1 week after DMBA application, tumor promoter (2.5 ?g of TPA dissolved in 100 ?l of acetone) was applied to the same areas of the mouse skin twice a week for 26 weeks. All groups continued their respective dietary regimen until the termination of the experiment. The results showed that dietary administration at 0.2% or 1% curcumin significantly inhibited the number of tumors per mouse and the tumor volume. Curcumin in the diet did not hinder the animals. Overall results demonstrated the safety as well as the anti-carcinogenic effect of dietary curcumin in mice. Using the enhanced chemiluminescence Western blotting detection system (Amersham), we found a relative increase in the cellular oncogene of FBJ murine osteogenic sarcoma virus (c-fos) and cellular oncogene of Harvey rat sarcoma virus (c-Ha-ras) proteins in tumorous skin. This was compared with the non-tumorous skin isolated from the same mouse. Dot blot analysis of c-Ha-ras and c-fos RNA transcripts in the tumorous and non-tomorous skin was also determined. Both cellular oncogenes exhibited higher levels in tumorous rather than normal skin. The enhanced expression of ras and fos proto-oncogenes in skin tumors in DMBA and TPA-treated animals was decreased by dietary curcumin. Also, it was found that the curcumin inhibited protein kinase C (PKC) activities in mouse epidermal extracts in a dose dependent manner. Chiang Mai Med Bull 2001;40(3):127-137.
RESUMEN
Cancer chemotherapy is one of the major factors that can induce the development of multidrug resistance (MDR) in humans. Drug resistance is related to the overexpression of membrane protein, P-glycoprotein (Pgp), on the surface of tumor cells. The lowered drug concentration that results within the cell causes a reduction in the cytotoxicity of the drug. A variety of studies have tried to find potent MDR modulators. which increase drug accumulation in cancer cells. In this study, commercial grade curcuminoids (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemethoxycurcumin), pure curcumin, demethoxycurcumin and bisdemethoxycurcumin were compared for their potential ability to modulate the human MDR-1 gene expression in the multidrug resistant human cervical carcinoma cell line, KB-V1. Western blot analysis and RT-PCR showed that all of the three curcuminoids, as well as crude curcuminoids, inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. Revealing the regulatory mechanisms involved in MDR-1 gene expression is important to our understanding of multidrug resistance in tumor cells. The MDR-1 gene encoding P-glycoprotein, containing a promoter sequence (-84 to -65; GGCTGATTGGCTGGGCAGGA), was investigated. DNA-binding analyses suggest that the MDR-1 gene promoter (-84 to -65) interacted specifically with a nuclear protein. The nuclear protein was identified by competitive electrophoretic mobility shift assay (EMSA) using unlabeled SP1, AP1, AP2, OCT1, NFKB and CREB oligomers (200-molar excess). The result demonstrated that the CREB consensus sequence can compete more completely with the nuclear factor that binds to the labeled probe (MDR-1 gene promoter -84 to -65 DNA fragment) than other unlabeled probes. Therefore, indications are that CREB is the transcription factor that binds to the MDR-1 gene promoter in residue -84 to -65, and this result was confirmed by supershift assay using an anti-CREB antibody. In additional studies, we found that the pretreatment of KB-V1 cells with commercial curcuminoids significantly decreased the activity of the MDR-1 gene promoter, and bisdemethoxycurcumin produced the maximum inhibitory effect. These results indicate that bisdemthoxycurcumin is the most active of the curcuminoids present in turmeric for the modulation of MDR-1 gene expression. Chiang Mai Med Bull 2002;41(4):189-203.