Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 2 de 2
Filtrar
Añadir filtros








Intervalo de año
1.
Journal of the Korean Ophthalmological Society ; : 1262-1267, 1997.
Artículo en Coreano | WPRIM | ID: wpr-10034

RESUMEN

To investigate the changes in refractive error following strabismus surgery, we stratified a total of 32 exotropic patients; 11 patients with horizontal recess/resect procedure in one eye; 11 patients with lateral rectus recession in one eye; and 10 patients with medial rectus resection in one eye. The cycloplegic refraction and corneal topography were examined prospectively in each group. We found a significant decrease in the refractive power at 180degrees meridian resulting in with the rule astigmatism in lateral rectus muscle recess group (p<0.05) and a significant decrease in the refractive power at 90degrees meridian resulting in against the rule astigmatism in medial rectus resection group in the first week after surgery (p<0.05). However, there was no statistically significant change due to mixture of the two procedures in recess/resect group. The changes in refractive power in four months after surgery gradually recovered to preoperative state in each group except 90degrees meridian in medial rectus resection group. These results indicate that the changes in refractive error in one week after strabismus surgery involved steepening of 180degrees meridian in medial rectus resection group, and flattening of 180degrees meridian in lateral rectus muscle recession group. However, there was no statistically significant change due to mixture of the two procedures in recess/resect group.


Asunto(s)
Humanos , Astigmatismo , Topografía de la Córnea , Estudios Prospectivos , Errores de Refracción , Estrabismo
2.
Journal of the Korean Ophthalmological Society ; : 1996-2002, 1996.
Artículo en Coreano | WPRIM | ID: wpr-22880

RESUMEN

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.


Asunto(s)
Humanos , Southern Blotting , ADN , Electroforesis en Gel de Agar , Herpes Simple , Queratitis , Queratitis Herpética , Reacción en Cadena de la Polimerasa , Simplexvirus
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA