RESUMEN
<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>
Asunto(s)
Adulto , Anciano , Femenino , Humanos , Masculino , Persona de Mediana Edad , Genes de la Neurofibromatosis 2 , Mutación , Neurilemoma , Genética , Neoplasias de la Médula Espinal , GenéticaRESUMEN
Objective The purpose of this study was to assess the imaging features of newly diagnosed high-grade glioma and the effect of relevant factors such as postoperative radiotherapy and chemotherapy on progression-free sur-vival (PFS) time. Methods A total of 54 patients with recurrent high-grade glioma confirmed by pathology or progressive malignant glioma proved by clinical follow-up were included in this retrospective study from 4 clinical centers. The prog-nostic factors selected included MR image features at initial diagnosis (including the maximum diameter of tumor, peritu-moral edema, degree of enhancement, degree of necrosis and presence of cystic or satellite), postoperative radiotherapy and chemotherapy. Kaplan-Meier method and Cox’s proportion-hazards model were used to analyse the factors influenc-ing the progression free survival (PFS) time. Results The univariate Kaplan-Meier analysis revealed that the degree of peritumoral edema (PTE, P=0.001), degree of necrosis (P<0.001) , degree of enhancement (P<0.001), postoperative radio-therapy (P=0.008) and chemotherapy(P=0.035) were significant factors for PFS. Cox multivariate analysis also showed that the degree of PTE(P=0.019),degree of necrosis (P<0.001) were all significantly correlated with PFS. The less edema or necrosis was associated with the longer PFS. In addition, postoperative radiotherapy (P=0.035) and chemotherapy (P=0.049) were also significantly correlated with PFS. The normative chemotherapy and radiotherapy were associated with longer PFS. Conclusions The PTE and necrosis on preoperative MR images can be used to predict the PFS of glioma af-ter total resection. Adjuvant normative chemotherapy and radiotherapy should be recommend for supratentorial high-grade glioma including those even with MRI confirmed total resection.
RESUMEN
Objective To explore the influence of peritumoral edema (PTE) on the tendency of recurrent location and morphological character after total resection using MRI. Methods MRI data was collected from 43 patients with recur-rent brain glioma after total resection from four clinical centers and then the influence of of PTE on recurrence patterns af-ter total resection was retrospectively analyzed based on the T2 weighted image. Results The PTE had a significant influ-ence on the recurrent patterns of brain gliomas after total resection. When PTE was mild, the shapes of recurrent gliomas tended to be focal (6/8) and the recurrent locations tended to be local (5/8). When PTE was severe, the shapes of the recur- rent gliomas tended to be spread(30/35 and the recurrent locations tended to be distant (25/35), followed by marginal (7/35), In addition, the morphological patterns and locations of recurrent gliomas were significantly different among different PTE types (all P<0.001). When PTE was ring shape, the shapes of recurrent gliomas tended to be focal (7/9) and the recur-rent locations tended to be local (6/9), followed by marginal (2/9) and distant (1/9). When PTE was irregular shape, most of recurrent locations tended to be distant (25/34), followed by marginal (7/34) but rarely local (2/34). Conclusions The de-grees and the types of brain glioma PTE can significantly influence the locations and morphological patterns of recurrent gliomas after total resection.