RESUMEN
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
RESUMEN
Objective:A retrospective analysis was performed on clinical characteristics and deoxyguanosine kinase DGUOK gene mutations in a family with hepatocerebral mitochondrial DNA depletion syndrome (MTDPS). Methods:The clinical data, treatment process and gene detection results of a child with MTDPS in the second hospital of Hebei Medical University in April 2019 were analyzed and summarized.Results:Proband was a girl.From the first week of infantile, she suffered from recurrent hypoglycemia, hyperlactic acid, progressive cholestatic liver dysfunction, coagulopathy, difficult feeding, slow growth of body mass, microcephaly, hypotonia, and gradul intermittent binocular tremors, and eventually failed to thrive.Gene testing identified two compound heterozygous mutations c. 42-c.43insTTCA(p.F15fs129X)/c.808-1(IVS6)G>A in DGUOK gene.The former was a frame-shift mutation resulted in truncated protein and the later was a splicing mutation resulted in abnormal splicing.Each parent was a heterozygous carrier, and there were no mutations in the two sites with her elder sister. Conclusions:Both mutations were first reported worldwide. DGUOK gene mutations with MTDPS are important causes of infant liver failure.When hypoglycemia, hyperlactic acidemia and liver dysfunction occur in newborn and infant, MTDPS related gene DGUOK gene sequencing screening should be considered for early definitive diagnosis, or, when acute liver failure happen in infant and childhood, neuromuscular involvement is insufficient.
RESUMEN
Objective:To investigate clinical characteristics and ABCB11 gene mutations in probands suffering from progressive familial intrahepatic cholestasis type 2(PFIC2). Methods:The clinical data involving manifestations and laboratory examinations of 2 probands with PFIC2 admitted to Pediatric Digestive and liver Clinic in Second Hospital of Hebei Medical University during January 2017 to December 2018 were retrospectively analyzed.Target capture high-throughput sequencing, genome-wide gene copy number variation(CNV) detection and validation were performed on probands and their parental DNA.Results:The age of onset for the 2 probands ranged from 2 to 5 months, and they had hepatosplenomegaly, severe cholestasis, pruritus, and binding bilirubin/ total bilirubin (proband 1: 51.8%-77.5%, proband 2: 47.1%-66.5%). Bile acid and aminotransferase[mainly aspartate transaminase (AST)] increased, but γ-glutamyltransferase(GGT) remained normal.Compound heterozygous mutations of ABCBll gene were discovered in proband 1: single strand deletion/c.3213+ 5G>A splicing mutation, and deletion mutation were spontaneous mutation.A total of 2.256 Mb(chr2 2q24.3q31.1)was missing, whereas splicing mutation was originated from her father.Polymorphisms with Val444Ala(T1331C)and Ala1028Ala(A3084G)were proved in proband 1.Compound heterozygous mutations of ABCB11 gene were revealed in proband 2: c.1483A>G(p.R495G)/c.2594C>T(p.A865V), and both parents were heterozygous carriers.Single-strand 2.256 Mb deletion in proband 1 and 2 mutations in proband 2 were unreported new mutations worldwide. Conclusions:In clinical work, children with cholestasis, elevated bile acid and transaminase(mainly AST), but normal GGT, should be detected for PFIC genes as soon as possible.