RESUMEN
Background: Resistance to chemotherapy chemicals is a major obstacle to sucessful treatment of cancer. Out of the mechanism of drug resistance is characterized by the overexpression of drug transporters on plasma membrane such as P-glycoprotein (Pgp), multidrug resistance associated protein (MRP), especially MRP1. Curcuminoids (curcumin, demethoxycurcumin, and bisdemethoxycurcumin) were reportedly used to reverse multidrug resistance phenotype and increase chemotherapeutic sensitivity in cancer cells.Aim: To investigate the effect of three curcuminoids on cell cytotoxicity and MDR phenotype in HEK293pcDNA3.1MRP1 cell line (drug resistance cell line) and HEK293pcDNA3.1 cell line (parental drug sensitive cell line).Methods: Curcuminoids were examined for the effect on MDR phenotypes of the cells by cytotoxicity assay with MTT method. Treatments of cell lines with non-toxic dose (10 M) of curcuminoids in combination with varying doses of etoposide VP16 (0-200 M) for 72 hr were analysed.Results: Curcumin, demethoxycurcumin, and bisdemethoxycurcumin exhibited cytotoxic activity on HEK293pcDNA3.1 MRP1 cell line with IC50 of 62.5, 68.7, and 56.3 M, respectively.\ HEK293pc DNA3.1 showed IC50 of 53.1, 56.2, and 50 M, respectively.\ At non-toxic dose of bisdemethoxycurcumin exhibited the highest effect on MDR phenotype, followed by curcumin and demethoxycurcumin, respectively.Conclusion: Bisdemethoxycurcumin was an excellent MDR phenotype reversing which increased drug sensitivity in drug resistance cell line (HEK293pcDNA3.1MRP1 cell line). This finding shows the possibility of using curcuminoids as an MDR modulator in cancer patients however further experiments needs to be studied to achieve this goal.
RESUMEN
Abstract We investigated the chemopreventive action of dietary curcumin in male Swiss albino mice 7 with 12-dimethylbenz(a) anthracene (DMBA)-initiated and 12, 0-tetradecanoylphorbol-13-acetate (TPA)-promoted skin tumor formation. At 6 weeks of age, the groups of animals were fed the control diet (modified AIN-76A) or one containing 0.2% or 1% curcumin. At 8 weeks of age, all animals, except those in the vehicle (acetone)-treated groups, received 100 ?g of DMBA dissolved in 100 ?l of acetone in a single application to the skin on their back. From 1 week after DMBA application, tumor promoter (2.5 ?g of TPA dissolved in 100 ?l of acetone) was applied to the same areas of the mouse skin twice a week for 26 weeks. All groups continued their respective dietary regimen until the termination of the experiment. The results showed that dietary administration at 0.2% or 1% curcumin significantly inhibited the number of tumors per mouse and the tumor volume. Curcumin in the diet did not hinder the animals. Overall results demonstrated the safety as well as the anti-carcinogenic effect of dietary curcumin in mice. Using the enhanced chemiluminescence Western blotting detection system (Amersham), we found a relative increase in the cellular oncogene of FBJ murine osteogenic sarcoma virus (c-fos) and cellular oncogene of Harvey rat sarcoma virus (c-Ha-ras) proteins in tumorous skin. This was compared with the non-tumorous skin isolated from the same mouse. Dot blot analysis of c-Ha-ras and c-fos RNA transcripts in the tumorous and non-tomorous skin was also determined. Both cellular oncogenes exhibited higher levels in tumorous rather than normal skin. The enhanced expression of ras and fos proto-oncogenes in skin tumors in DMBA and TPA-treated animals was decreased by dietary curcumin. Also, it was found that the curcumin inhibited protein kinase C (PKC) activities in mouse epidermal extracts in a dose dependent manner. Chiang Mai Med Bull 2001;40(3):127-137.
RESUMEN
Cancer chemotherapy is one of the major factors that can induce the development of multidrug resistance (MDR) in humans. Drug resistance is related to the overexpression of membrane protein, P-glycoprotein (Pgp), on the surface of tumor cells. The lowered drug concentration that results within the cell causes a reduction in the cytotoxicity of the drug. A variety of studies have tried to find potent MDR modulators. which increase drug accumulation in cancer cells. In this study, commercial grade curcuminoids (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemethoxycurcumin), pure curcumin, demethoxycurcumin and bisdemethoxycurcumin were compared for their potential ability to modulate the human MDR-1 gene expression in the multidrug resistant human cervical carcinoma cell line, KB-V1. Western blot analysis and RT-PCR showed that all of the three curcuminoids, as well as crude curcuminoids, inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. Revealing the regulatory mechanisms involved in MDR-1 gene expression is important to our understanding of multidrug resistance in tumor cells. The MDR-1 gene encoding P-glycoprotein, containing a promoter sequence (-84 to -65; GGCTGATTGGCTGGGCAGGA), was investigated. DNA-binding analyses suggest that the MDR-1 gene promoter (-84 to -65) interacted specifically with a nuclear protein. The nuclear protein was identified by competitive electrophoretic mobility shift assay (EMSA) using unlabeled SP1, AP1, AP2, OCT1, NFKB and CREB oligomers (200-molar excess). The result demonstrated that the CREB consensus sequence can compete more completely with the nuclear factor that binds to the labeled probe (MDR-1 gene promoter -84 to -65 DNA fragment) than other unlabeled probes. Therefore, indications are that CREB is the transcription factor that binds to the MDR-1 gene promoter in residue -84 to -65, and this result was confirmed by supershift assay using an anti-CREB antibody. In additional studies, we found that the pretreatment of KB-V1 cells with commercial curcuminoids significantly decreased the activity of the MDR-1 gene promoter, and bisdemethoxycurcumin produced the maximum inhibitory effect. These results indicate that bisdemthoxycurcumin is the most active of the curcuminoids present in turmeric for the modulation of MDR-1 gene expression. Chiang Mai Med Bull 2002;41(4):189-203.