RESUMEN
Most of the neurogenetic disorders could not be cured until now. With the development of molecular biological techniques, gene therapies show brilliant application prospects in neurogenetic disorders, which contain gene supplementation, exon skipping, splicing enhancement, dynamic mutation correction and toxic expression product elimination, and so on.
RESUMEN
Objective To introduce the application of multiplex ligation-dependent probe amplification (MLPA) assays in the diagnosis of patients with hereditary neuropathy with liability to pressure palsies (HNPP).Methods Copy numbers of the exons in peripheral myelin prolein 22 (PMP22) gene,tektin 3 (TEKT3) gene and cytochrome c oxidase assembly protein 10 (COX10) gene were analyzed by MLPA in 8 patients diagnosed with HNPP clinically and 5 normal controls.Results Among the 8 patients,7 patients were identified to have deletion mutations according to their reduced peak area of PMP22 gene,TEKT3 gene and COX10 gene compared with that of normal controls.One patient with normal peak area of PMP22 gene,TEKT3 gene and COX10 gene showed no deletion of these genes.Conclusions MLPA assays can detect the copy numbers of genes in HNPP region through semi-quantitative analysis in a rapid,accurate way,which may be utilized widely in the genetic diagnosis among HNPP patients.
RESUMEN
Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.
RESUMEN
Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.